Industrial fermentation production method of glutamic acid decarboxylase-containing whole cell and application of glutamic acid decarboxylase-containing whole cell in production of gamma-aminobutyric acid

Abstract

The invention relates to the field of bioengineering and enzyme engineering, in particular to an industrial fermentation production method of whole cells containing glutamate decarboxylase and application of the whole cells in production of gamma-aminobutyric acid. The method comprises the following steps: constructing an engineering bacterium of glutamic acid decarboxylase with genetic stability by a method of replacing a pET-28a (+) carrier with petduet-1, and performing seed liquid culture on the obtained engineering bacterium; inoculating the seed solution into a fermentation culture medium, and fermenting in a 5L fermentation tank; and controlling the dissolved oxygen content to be 30%, the ventilatory capacity to be 1.5 vvm and the pH to be 7 in the fermentation process, and feeding glucose and ammonia water. A high-density fermentation process is adopted, induction is performed twice at the earlier stage of a logarithmic phase and a stable phase, the enzyme activity of the produced glutamate decarboxylase is up to 327.4 U / g, and the concentration of gamma-aminobutyric acid obtained by finally converting glutamic acid can reach 750g / L.

Description

Technical Field

[0001] The present invention relates to the fields of bioengineering and enzyme engineering, and particularly to an industrial fermentation production method of a whole cell containing glutamate decarboxylase and its application in the production of γ-aminobutyric acid. Background Art

[0002] γ-Aminobutyric Acid (GABA) is a naturally occurring non-protein amino acid that widely exists in vertebrates, plants, and microorganisms, and is an important inhibitory neurotransmitter in the mammalian central nervous system. γ-Aminobutyric acid has various physiological functions, including regulating hormone secretion, delaying aging, enhancing memory, improving reproductive activity, improving brain cell metabolism, enhancing immunity, relieving anxiety, treating epilepsy, improving liver and kidney functions, lowering blood pressure, and preventing diabetes. In addition, γ-aminobutyric acid can also improve sleep and is known as the "third-generation sleeping pill", and its related products have been widely used in the fields of medicine, food, health products, and agriculture. γ-Aminobutyric acid can also prevent obesity, promote alcohol metabolism, regulate arrhythmia, prevent arteriosclerosis, and prevent skin aging.

[0003] The production methods of γ-aminobutyric acid include plant enrichment method, chemical synthesis method, and enzymatic catalysis method. Among them, the γ-aminobutyric acid enriched by plants has a small content and is relatively difficult to separate and extract, which is not suitable for the large-scale production of γ-aminobutyric acid. The chemical synthesis method has high costs, low yields, and uses dangerous chemical reagents such as ethanol and tetrahydrofuran during the production process. Therefore, the γ-aminobutyric acid prepared by the chemical synthesis method is not applicable to the food industry. Compared with the chemical method, the enzymatic catalysis method has the advantages of mild conditions, strong specificity, high safety, low cost, and high technical content. The enzymatic catalysis method uses glutamate decarboxylase to decarboxylate L-glutamate to generate γ-aminobutyric acid.

[0004] Many scholars have studied the properties of glutamate decarboxylase. Yu Ping et al. cloned the glutamate decarboxylase of Escherichia coli, expressed it in Escherichia coli BL21, and preliminarily studied its enzymatic properties; Park et al. cloned the gene encoding glutamate decarboxylase from newly isolated Lactobacillus brevis; Wuyundalai et al. cloned and expressed GAD of Lactococcus lactis and studied its enzymatic properties. Glutamate decarboxylases from different sources have certain differences in enzymatic properties.

[0005] Therefore, constructing a strain with a clear genetic background and high-yield glutamate decarboxylase to efficiently catalyze glutamate to generate γ-aminobutyric acid is a problem to be solved at present. Summary of the Invention

[0006] To solve the above problems, the present invention aims to improve the catalytic efficiency of glutamate decarboxylase. The present invention provides an industrial fermentation production method of whole cells containing glutamate decarboxylase and its application in the production of γ-aminobutyric acid. The glutamate decarboxylase produced by the whole cells containing glutamate decarboxylase is applied to the efficient production of γ-aminobutyric acid.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides an industrial fermentation production method of whole cells containing glutamate decarboxylase, including the following steps: constructing an engineered bacterium with genetically stable expression of glutamate decarboxylase; culturing the obtained engineered bacterium in a seed culture, inoculating the seed culture into a fermentation medium, and performing fermentation in a 5L fermenter; controlling the dissolved oxygen, aeration rate and pH during the fermentation process, and feeding carbon source and nitrogen source.

[0009] Preferably, the engineered bacterium is E.coli BL21(DE3), the pET-28a(+) vector is replaced with petduet-1, and the glutamate decarboxylase GadB gene is expressed. The nucleotide sequence of the glutamate decarboxylase GadB gene is as shown in SEQ ID No.1.

[0010] Preferably, the fermentation medium of the engineered bacterium consists of the following components: yeast extract 18 - 22g / L, magnesium sulfate 0.2 - 0.3g / L, glycerol 15 - 25g / L, disodium hydrogen phosphate 5 - 8g / L, potassium dihydrogen phosphate 2 - 5g / L, and ammonium sulfate 1 - 3g / L, and the solvent is water.

[0011] Preferably, IPTG is added for induction during the fermentation of the engineered bacterium, and the concentration of IPTG is 0.65 mM.

[0012] Preferably, the dissolved oxygen during the fermentation process is 20% - 40%, the rotation speed is 200 - 800 rpm, the aeration rate is 0.4 - 2 vvm, and the pH value of the fermentation broth is controlled at 7.0.

[0013] Preferably, the carbon source is fed when the dissolved oxygen begins to rise during fermentation, and the carbon source is glucose.

[0014] Preferably, the nitrogen source is fed after 6h of fermentation, and the maximum feeding rate is 1 - 3 mL / (L·h).

[0015] The present invention also provides an application of glutamate decarboxylase with high catalytic efficiency in the production of γ-aminobutyric acid (GABA): the steps of preparing γ-aminobutyric acid;

[0016] ① Construction of engineered bacteria: Using E. coli BL21(DE3) as the host, an engineered bacterium with genetically stable glutamate decarboxylase was constructed by replacing the pET-28a(+) vector with petduet-1. The GadB gene of glutamate decarboxylase was recombinantly expressed to obtain glutamate decarboxylase. The nucleotide sequence of the glutamate decarboxylase GadB gene is shown in SEQ ID No. 1;

[0017] ② Activation of bacterial strain: Inoculate the engineered bacteria from the glycerol tube into an LB test tube for activation culture for 10 - 12 h, and the culture temperature is 35 - 38 °C.

[0018] ③ Seed culture: Transfer the engineered bacteria from the LB test tube to a conical flask medium for further scale-up culture for 10 - 12 h, and the culture temperature is 35 - 38 °C.

[0019] ④ Fermentation culture: The inoculation amount is 5% - 10% of the fermentation medium, the culture temperature is 35 - 38 °C, pH 7.0, the stirring speed is 200 - 800 rpm, the ventilation rate is 0.4 - 2 vvm. After 5 h of fermentation, the OD 600 reaches 16, add 2 mL of IPTG with a concentration of 0.5 M, and start induction at 30 °C. After 6 h of fermentation, the OD 600 reaches 25, and add another 2 mL of IPTG with a concentration of 0.5 M; when the dissolved oxygen starts to rise at 11 h of fermentation, start feeding glycerol with a concentration of 50%, and a total of 10% v / v of glycerol is fed throughout the fermentation process, and the maximum feeding rate is 9 mL / (L·h); start feeding ammonia water with a concentration of 25% from 6 h of fermentation, and a total of 6.6% v / v of ammonia water is fed throughout the fermentation process, and the maximum feeding rate is 1 - 3 mL / (L·h);

[0020] ⑤ Conversion of L-glutamic acid: Add the prepared whole cells containing glutamate decarboxylase to water at a wet cell weight of 60 g / L, add 880 g of L-glutamic acid, and 0.125 g of pyridoxal phosphate; react at 45 °C for 12 h to prepare γ-aminobutyric acid.

[0021] Preferably, the seed medium used in step ③ is peptone 8 - 12 g / L, yeast extract 3 - 8 g / L, NaCl 8 - 12 g / L, and the rest is water.

[0022] Preferably, the fermentation medium used in step ④ is: yeast extract 15 - 25 g / L, magnesium sulfate 0.2 - 0.3 g / L, glycerol 15 - 25 g / L, disodium hydrogen phosphate 4 - 8 g / L, potassium dihydrogen phosphate 2 - 4 g / L, ammonium sulfate 1 - 2 g / L, and the rest is water.

[0023] Beneficial effects:

[0024] The method of the present invention realizes the industrial fermentation production of glutamate decarboxylase and / or whole cells containing glutamate decarboxylase, and the enzyme activity of the produced glutamate decarboxylase is as high as 327.4 U / g. The method of the present invention lays a foundation for the industrial production of γ-aminobutyric acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments.

[0026] Figure 1 For the establishment of the GABA standard curve;

[0027] Figure 2 For the recombinant plasmid constructed in Example 1;

[0028] Figure 3 For the wet cell weight in Example 3;

[0029] Figure 4 For the cell density in Example 3;

[0030] Figure 5 For the liquid phase detection result of the γ-aminobutyric acid standard product in Example 4

[0031] Figure 6 For the liquid phase detection result of the conversion liquid in Example 4;

[0032] Figure 7 For the technical route map of γ-aminobutyric acid production. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0033] The present invention provides an industrial fermentation production method of whole cells containing glutamate decarboxylase, including the following steps: constructing an engineered bacterium that stably expresses glutamate decarboxylase; culturing the obtained engineered bacterium in a seed culture solution, inoculating the seed culture solution into a fermentation medium, and performing fermentation in a 5 L fermenter; controlling the dissolved oxygen, aeration volume and pH during the fermentation process, and feeding carbon sources and nitrogen sources.

[0034] Preferably, the engineered bacterium is E. coli BL21(DE3), the pET-28a(+) vector is replaced with petduet-1, and the glutamate decarboxylase GadB gene is expressed. The nucleotide sequence of the glutamate decarboxylase GadB gene is as shown in SEQ ID No.1.

[0035] Preferably, the fermentation medium of the engineered bacterium consists of the following components: yeast extract 18 - 22 g / L, magnesium sulfate 0.2 - 0.3 g / L, glycerol 15 - 25 g / L, disodium hydrogen phosphate 5 - 8 g / L, potassium dihydrogen phosphate 2 - 5 g / L, and ammonium sulfate 1 - 3 g / L, and the solvent is water.

[0036] Preferably, IPTG is added during the fermentation process of the engineered bacteria, and the concentration of IPTG is 0.65 mM.

[0037] Preferably, the dissolved oxygen content during the fermentation process is 20%-40%, the rotation speed is 200-800 rpm, the ventilation rate is 0.4-2 vvm, and the pH value of the fermentation broth is controlled at 7.0.

[0038] Preferably, when the dissolved oxygen begins to rise during fermentation, a carbon source is fed, and the carbon source is glucose.

[0039] Preferably, a nitrogen source is fed 6 h after fermentation, and the maximum feeding rate is 1-3 mL / (L·h).

[0040] The present invention also provides an application of a glutamate decarboxylase with high catalytic efficiency in the production of γ-aminobutyric acid (GABA): steps for preparing γ-aminobutyric acid;

[0041] ① Construction of engineered bacteria: Using E. coli BL21(DE3) as the host, an engineered bacterium with genetically stable glutamate decarboxylase is constructed by replacing the pET-28a(+) vector with petduet-1, the GadB gene of glutamate decarboxylase is recombinantly expressed, and glutamate decarboxylase is obtained. The nucleotide sequence of the glutamate decarboxylase GadB gene is as shown in SEQ ID No. 1;

[0042] ② Activation of the bacterial strain: The engineered bacteria are inoculated from a glycerol tube into an LB test tube for activation culture for 10-12 h, and the culture temperature is 35-38 °C.

[0043] ③ Seed culture: The engineered bacteria are transferred from the LB test tube to a conical flask medium for further scale-up culture for 10-12 h, and the culture temperature is 35-38 °C.

[0044] ④ Fermentation culture: The inoculation amount is 5%-10% of the fermentation medium, the culture temperature is 35-38 °C, pH 7.0, the stirring speed is 200 rpm-800 rpm, the ventilation rate is 0.4-2 vvm. After 5 h of fermentation, the OD 600 reaches 16, 2 mL of IPTG with a concentration of 0.5 M is added, and induction starts at 30 °C. After 6 h of fermentation, the OD 600 reaches 25, and 2 mL of IPTG with a concentration of 0.5 M is added again; when the dissolved oxygen begins to rise at 11 h of fermentation, glycerol with a concentration of 50% is fed, and a total of 10% v / v of glycerol is fed during the whole fermentation process, and the maximum feeding rate is 9 mL / (L·h); starting from 6 h of fermentation, ammonia water with a concentration of 25% is fed, and a total of 6.6% v / v of ammonia water is fed during the whole fermentation process, and the maximum feeding rate is 1-3 mL / (L·h);

[0045] ⑤Conversion of L-glutamic acid: The prepared whole cells containing glutamic acid decarboxylase were added to water at a wet cell weight of 60 g / L, 880 g of L-glutamic acid and 0.125 g of pyridoxal phosphate were added; the reaction was carried out at 45 °C for 12 h to prepare γ-aminobutyric acid.

[0046] Preferably, the seed culture medium used in step ③ is peptone 8 - 12 g / L, yeast extract 3 - 8 g / L, NaCl 8 - 12 g / L, and the rest is water.

[0047] Preferably, the fermentation medium used in step ④ is: yeast extract 15 - 25 g / L, magnesium sulfate 0.2 - 0.3 g / L, glycerol 15 - 25 g / L, disodium hydrogen phosphate 4 - 8 g / L, potassium dihydrogen phosphate 2 - 4 g / L, ammonium sulfate 1 - 2 g / L, and the rest is water.

[0048] SEQ ID No.1:

[0049] ATGGCGATGCTGTATGGCAAACATAACCATGAAGCGGAAGAATATCTGGAACCGGTGTTTGGCGCGCCGAGCGAACAGCATGATCTGCCGAAATATCGCCTGCCGAAACATAGCCTGAGCCCGCGCGAAGCGGATCGCTTAGTTCGCGATGAACTGCTGGATGAAGGCAACAGCCGCCTGAACCTGGCGACCTTTTGCCAGACCTATATGGAACCGGAAGCGGTGGAACTGATGAAAGATACCCTGGCGAAAAACGCGATTGATAAAAGCGAATATCCGCGCACCGCGGAAATTGAAAACCGCTGCGTGAACATTATTGCGAACCTGTGGCATGCGCCGGATGATGAACATTTTACCGGCACCAGCACCATTGGCAGCAGCGAAGCGTGCATGCTGGGCGGTTTAGCGATGAAATTTGCGTGGCGCAAACGCGCGCAGGCGGCAGGTTTAGATCTGAATGCGCATCGCCCAAACCTGGTGATTAGCGCGG GCTATCAGGTGTGCTGGGAA AAATTTTGCGTGTATTGGGA TGTGGATATT CATGTGGTGCCGATGGATGAACAGCACATG GCGCTGGATG TGAACCATGTGCTGGATTATGTGGATGAAT ATACCATTGG CATTGTGGGC ATTATGGGCA TTACCTATACCGGCCAGTATGATGATCTGG CGGCGCTGGA TAAAGTGGTG ACCCATTATAACCATCAGCATCCGAAACTG CCGGTGTATATTCATGTGGA TGCGGCGAGCGGCGGCTTTT ATACCCCGTT TATTGAACCG CAGCTGATTT GGGATTTTCGCCTGGCGAACGTGGTGAGCATTAACGCGAG CGGCCATAAA TATGGCCTGGTTTATCCAGG CGTGGGCTGGGTGGTGTGGC GTGATCGCCA GTTTTTACCGCCAGAACTGGTGTTTAAAGTGAGCTATCTG GGCGGCGAACTGCCGACAATGGCGATTAAC TTTAGCCATAGCGCGGCGCA GCTGATTGGC CAGTATTATAACTTTATTCGCTTTGGCATG GATGGCTATC GCGAAATTCA GACCAAAACCCATGATGTGGCGCGCTATCT GGCGGCGGCGCTGGATAAAG TTGGCGAATTTAAGATGATC AACAACGGCC ATCAGCTGCC GCTGATTTGC TATCAACTGGCGCCGCGCGAAGATCGCGAATGGACCCTGT ATGATCTGAG CGATCGCCTGCTGATGAACGGCTGGCAGGTGCCGACCTAT CCGTTACCGG CGAACCTGGAACAGCAAGTGATTCAGCGCATTGTGGTGCG CGCGGATTTTGGCATGAACATGGCGCATGA TTTTATGGAT GATCTGACCAAAGCGGTGCA TGATCTGAACCAGGCGCATATTGTGTATCATCATTAA。

[0050] For the instruments, reagents, materials, etc. involved in the examples, unless otherwise specified, they are all conventional instruments, reagents, materials, etc. existing in the prior art and can be obtained through regular commercial channels. For the experimental methods, detection methods, etc. involved in the examples, unless otherwise specified, they are all conventional experimental methods, detection methods, etc. existing in the prior art.

[0051] GABA detection method: Dansyl chloride (DNS) is used as a pre-column derivatization reagent, the chromatographic column is a C18 column, the mobile phase is a mixed solution of 25 mM sodium acetate (pH = 6) and acetonitrile (volume ratio 68:32), the flow rate is 1 mL / min, the column temperature is 30 °C, the injection volume is 10 μL, isocratic elution, and the ultraviolet detection wavelength is 216 nm. The GABA standard product spectrum is as Figure 5 shown.

[0052] Glutamate decarboxylase activity detection: Establishment of GABA standard curve: A mixed standard solution was composed of GABA and L-Glu with an equimolar concentration increase and decrease strategy. 0.4 ml of the mixed standard solution was taken respectively, and 0.1 ml of Na2CO3 (1 mol / L) solution, 0.5 ml of pH 10.0 borate buffer (0.2 mol / L), and 1 ml of 6% phenol were added. After mixing, 1 ml of NaClO solution (active chlorine was 5.2%) was added. After mixing, it was left for 6 min, then placed in a boiling water bath for 10 min, immediately ice-bathed for 20 min. After the solution turned blue-green, 2.0 ml of 60% ethanol solution was added. After mixing, it was placed in a 20°C water bath for 40 min. The same operation was carried out with 10 mmol / L L-Glu as the blank, and the absorbance at 640 nm was measured. With the concentration of GABA as the abscissa and OD 640 as the ordinate, a standard curve was plotted. The GABA standard curve is shown in Figure 1 .

[0053] Sample determination: 0.4 ml of the enzyme reaction solution was taken, 0.1 ml of Na2CO3 (1 mol / L), 0.5 ml of pH 10.0 borate buffer (0.2 mol / L), and 1 ml of 6% phenol were added. After mixing, 1 ml of 5.2% NaClO solution was added within 5 min at room temperature (20°C). After mixing, it was left for 6 min, then placed in a boiling water bath for 10 min, immediately ice-bathed for 20 min. After the solution turned blue-green, 2.0 ml of 60% ethanol solution was added. After mixing, it was placed in a 20°C water bath for 30 min, and the absorbance at 640 nm was measured. The amount of enzyme required to release 1 μmoL of γ-aminobutyric acid per minute was defined as 1 enzyme activity unit of glutamate decarboxylase.

[0054] As Figure 7 shown is the technical route map for γ-aminobutyric acid production;

[0055] To further illustrate the present invention, the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0056] Example 1

[0057] Construction of glutamate decarboxylase engineering bacteria

[0058] 1. Construction of glutamate decarboxylase engineering bacteria

[0059] The target gene fragment of glutamate decarboxylase was obtained by gene synthesis method. The base sequence of glutamate decarboxylase in the gene engineering bacteria is shown in SEQ ID No.11.

[0060] The pET-28a(+) vector was replaced with petduet-1, and a new plasmid was synthesized to express the GadB gene of glutamate decarboxylase. The map is shown inFigure 2 。

[0061] Take out the E. coli BL21 competent cells from the -80 °C refrigerator, place them in an ice bath, add all the ligation products to an EP tube containing 50 μL of competent cells in a laminar flow hood, gently pipette and mix well, and incubate in the ice bath for 30 min. Heat shock in a 42 °C water bath for 90 s and then incubate in the ice bath for 2 min. Add 1 mL of LB recovery solution to the EP tube in the laminar flow hood, place it on a shaker at 37 °C, shake and culture at 220 r / min for 60 min, then centrifuge at 4000 r / min for 5 min to collect the bacterial cells, pipette and mix well, and then spread them on an LB plate containing Amp resistance, and incubate inverted in a 37 °C incubator overnight to obtain the glutamate decarboxylase engineering bacteria.

[0062] Example 2

[0063] Shake flask verification test

[0064] The shake flask medium is: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L. The filling volume of the shake flask is 50 mL / 250 mL, the temperature is 37 °C, the pH is natural, and the shaker speed is 220 rpm. After fermentation and culture for 3 h, add IPTG with a final concentration of 0.5 mmol / L to start induction, adjust the culture temperature to 16 °C after induction, and the fermentation cycle is 24 h. After fermentation, centrifuge to collect the bacterial cells for glutamate decarboxylase enzyme activity detection and transformation experiment. The transformation system consists of 0.6 g of whole cell bacterial cells, 17.6 g of glutamate, 0.0025 g of pyridoxal phosphate, and 10 mL of ultrapure water. The reaction is carried out at 37 °C for 12 h and then the transformation is completed, and the glutamate precipitate completely disappears.

[0065] Example 3

[0066] 5 L fermentor high-density fermentation culture

[0067] 1. Cultivation of the seed liquid of the glutamate decarboxylase engineering bacteria: Take the preserved engineering bacteria and activate them on a culture medium plate containing ampicillin resistance, and culture at 37 °C for 12 h; use an inoculation loop to pick up a loop of plate seeds under sterile conditions and inoculate them into the seed medium. The medium composition is: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH natural, and sterilize at 121 °C for 20 min. Then culture the inoculated seed shake flask at 37 °C and 220 rpm / min for 16 h to obtain the seed culture solution for small-scale fermentation.

[0068] 2. High-density fermentation culture method of the glutamate decarboxylase engineering bacteria: Use a 5 L fermentor for high-density cell culture of glutamate decarboxylase. The filling volume is

[0069] The seed culture obtained in step 1 was inoculated into the fermentation medium at an inoculation amount of 8%, the temperature was controlled at 37°C, the stirring speed was 200 rpm / min, the aeration rate was 1.5 vvm, and after 5 h of fermentation, the OD 600 reached 16, 2 mL of IPTG with a concentration of 0.5 M was added, and induction was carried out at 30°C. After 6 h of fermentation, the OD 600 reached 25, and 2 mL of IPTG with a concentration of 0.5 M was added again.

[0070] The fermentation medium used was: yeast extract 20 g / L, magnesium sulfate 0.256 g / L, glycerol 20 g / L, disodium hydrogen phosphate 6 g / L, potassium dihydrogen phosphate 3 g / L, ammonium sulfate 1.25 g / L, and the pH was natural.

[0071] When the dissolved oxygen began to rise at 11 h of fermentation, glycerol with a concentration of 50% was fed. A total of 10% v / v of glycerol was fed during the whole fermentation process, and the maximum feeding rate was 9 mL / (L·h); Ammonia water with a concentration of 25% was fed starting from 6 h of fermentation. A total of 6.6% v / v of ammonia water was fed during the whole fermentation process, and the maximum feeding rate was 3 mL / (L·h). The aeration rate was adjusted to 1.2 vvm, and the stirring speed was increased to control the dissolved oxygen at 30%. As the bacteria grew, the oxygen consumption rate of the bacteria gradually increased, and the carbon source feeding rate needed to be gradually increased. Ammonia water was automatically fed according to the consumption rate of the carbon source, and the pH value was controlled at 7 during the fermentation process.

[0072] After 23 h of fermentation, the final OD of the bacteria was 57. The whole-cell bacteria containing glutamate decarboxylase were collected using a 500 mL centrifuge cup and washed three times with deionized water. The wet weight of the obtained bacteria was 170 g / L, and the enzyme activity was 327.4 U / g. The wet weight of the bacteria was as Figure 3 shown, and the cell concentration of the bacteria was as Figure 4 shown. After the fermentation ended, the bacteria were collected by centrifugation for glutamate decarboxylase enzyme activity detection and transformation experiments. The composition of the transformation system was 30 g of whole-cell bacteria, 440 g of glutamate, 0.125 g of pyridoxal phosphate, and 500 mL of ultrapure water. The reaction ended after 12 h at 37°C. The glutamate precipitate completely disappeared, and the final concentration of γ-aminobutyric acid was 750 g / L, and the conversion rate was as high as 100%, indicating that the GAD produced by the engineered bacteria had high catalytic activity.

[0073] Example 4

[0074] Whole-cell transformation in a 5 L fermenter and detection of γ-aminobutyric acid

[0075] 5L fermenter whole-cell conversion of L-glutamic acid: After the high-density fermentation was completed, the cells obtained in Example 3 were added to 500 mL of ultrapure water according to the wet weight, and the addition amount was 60 g / L of the wet weight of the cells added to 500 mL of ultrapure water. Then, 1760 g / L of L-glutamic acid and 0.25 g / L of pyridoxal phosphate (0.125 g) were added, and the temperature was controlled at 45 °C. As the reaction proceeded, solid L-glutamic acid was converted into γ-aminobutyric acid and dissolved in water. The liquid chromatography detection chromatogram of the γ-aminobutyric acid standard product is as Figure 5 shown, and its concentration is 0.1 mg / mL. The concentration of γ-aminobutyric acid in the conversion solution was detected to be 750 g / L ( Figure 6 ), and the conversion rate was 100%. The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above examples. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

[0076] Although the above examples have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments are all within the protection scope of the present invention.

Claims

1. An industrial fermentation production method containing whole cells of glutamate decarboxylase, characterized in that: The following steps are involved: The invention relates to constructing an engineered bacterium which stably expresses glutamate decarboxylase; culturing the obtained engineered bacterium with seed liquid, inoculating the seed liquid into a fermentation medium, and fermenting the culture medium in a 5L fermentation tank; controlling the dissolved oxygen content, aeration volume and pH value during the fermentation process, and feeding carbon source and nitrogen source.

2. The industrial fermentation production method according to claim 1, characterized in that: The engineered bacteria is E. coli BL21 (DE3), the pET-28a (+) vector is replaced with petduet-1, and the glutamate decarboxylase GadB gene is expressed. The nucleotide sequence of the glutamate decarboxylase GadB gene is shown in SEQ ID No.

1.

3. The industrial fermentation production method according to claim 1, characterized in that: The engineered bacteria fermentation medium comprises the following components: 18-22 g / L yeast extract, 0.2-0.3 g / L magnesium sulfate, 15-25 g / L glycerol, 5-8 g / L disodium hydrogen phosphate, 2-5 g / L potassium dihydrogen phosphate and 1-3 g / L ammonium sulfate, and the solvent is water.

4. The industrial fermentation production method according to claim 1, characterized in that: The engineered bacteria were induced by adding IPTG during the fermentation process, and the concentration of IPTG was 0.65 mM.

5. The industrial fermentation production method according to claim 1, characterized in that: The dissolved oxygen content in the fermentation process is 20%-40%, the rotation speed is 200-800rpm, the ventilation volume is 0.4-2vvm, and the pH value of the fermentation liquid is controlled to be 7.

0.

6. The industrial fermentation production method according to claim 1, characterized in that: When the fermentation is continued until the dissolved oxygen starts to rise, a carbon source is added, wherein the carbon source is glucose.

7. The industrial fermentation production method according to claim 1, characterized in that: After 6 h of fermentation, nitrogen source was added at a maximum flow rate of 1-3 mL / (L·h).

8. Application of glutamate decarboxylase with high catalytic efficiency in the production of gamma-aminobutyric acid (GABA): steps for preparing gamma-aminobutyric acid; ① Construction of engineering bacteria: Using E. coli BL21 (DE3) as a host, replacing the pET-28a (+) vector with petduet-1 to construct an engineering bacterium having genetically stable glutamate decarboxylase, recombinantly expressing the glutamate decarboxylase GadB gene, and expressing glutamate decarboxylase, wherein the nucleotide sequence of the glutamate decarboxylase GadB gene is shown in SEQ ID No. 1; ② Activation of bacteria: inoculate the engineered bacteria from the glycerol tube into the LB test tube for activation culture for 10-12 hours at a culture temperature of 35-38°C. ③ Seed culture: transfer the engineered bacteria from the LB test tube to the conical flask culture medium and continue to expand the culture for 10-12 hours at a culture temperature of 35-38°C. ④ Fermentation culture: the inoculation amount is 5%-10% of the fermentation medium, the culture temperature is 35-38℃, pH 7.0, the stirring speed is 200-800rpm, the ventilation volume is 0.4-2vvm, and the OD after fermentation for 5h is 600 When the OD value reaches 16, 2 mL of 0.5 M IPTG was added and induction was started at 30 °C. After 6 h of fermentation, the OD value 600 When the concentration of IPTG reaches 25, 2 mL of 0.5 M IPTG is added again; when the fermentation is carried out for 11 hours, the dissolved oxygen begins to rise, and 50% glycerol is added, and 10% v / v glycerol is added during the whole fermentation process, with a maximum flow rate of 9 mL / (L·h); from the 6th hour of fermentation, 25% ammonia water is added, and 6.6% v / v ammonia water is added during the whole fermentation process, with a maximum flow rate of 1-3 mL / (L·h); ⑤Conversion of L-glutamate: Add the prepared whole cells containing glutamate decarboxylase into water at a wet weight of 60 g / L, add 880 g of L-glutamate and 0.125 g of pyridoxal phosphate; react at 45°C for 12 hours to prepare γ-aminobutyric acid.

9. The use according to claim 8, characterized in that: The seed culture medium used in step ③ is 8-12 g / L of peptone, 3-8 g / L of yeast powder, 8-12 g / L of NaCl, and the rest is water.

10. The use according to claim 8, characterized in that: The fermentation medium used in step ④ is: 15-25 g / L yeast extract, 0.2-0.3 g / L magnesium sulfate, 15-25 g / L glycerol, 4-8 g / L disodium hydrogen phosphate, 2-4 g / L potassium dihydrogen phosphate, 1-2 g / L ammonium sulfate, and the rest is water.

Images