DsRNA / fused dsRNA and application thereof in prevention and treatment of spider mites

Abstract

The invention discloses dsRNA / fused dsRNA and application of the dsRNA / fused dsRNA in prevention and treatment of spider mites, the dsRNA is dsRpt3, and the fused dsRNA is obtained by fusing dsRNA of a plurality of genes of the same gene family of targeted spider mites; the gene family is selected from a proteasome ATP enzyme family and an apolipoprotein family; the nucleotide sequence of one chain of the fused dsRNA is as shown in any one of SEQ ID NO.1-4. The invention also discloses a preparation method of the fused dsRNA. Compared with the existing dsRNA for preventing and treating a single variety of spider mites, the dsRNA / fused dsRNA can prevent and treat various spider mites at the same time, is expected to be applied to preparation of biopesticides for preventing and treating spider mites, reduces the use of chemical pesticides, protects the environment, and reduces the damage of the chemical pesticides.

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering and pest control, and particularly relates to a dsRNA / fused dsRNA and its application in controlling spider mites. Background Art

[0002] Spider mites belong to the phylum Arthropoda, class Arachnida, superfamily Tetranychidae, genus Tetranychus, and are one of the important groups of agricultural and forestry pests. They are extremely destructive and have characteristics such as small body size, a wide variety of hosts, strong adaptability, and high reproductive capacity. Spider mites are piercing-sucking mouthpart insects that suck the contents of plant mesophyll cells through stylets. After the damage, white spots appear on the leaves. Moreover, spider mites usually secrete salivary proteins to inhibit the defense of host plants and increase the adaptability of other harmful organisms in the same ecological niche, so the losses caused are very serious. Biological invasion is an important ecological and economic challenge currently faced by China. Due to their unique growth, development, and reproductive characteristics, alien invasive organisms can quickly spread and replace local populations, resulting in time-consuming and laborious prevention and control work and high economic costs. Since it is difficult to take effective control measures in the early stage of invasion, invasive organisms often cause serious harm to agricultural production. Among invasive mites, Tetranychus evansi and Tetranychus urticae are typical representatives.

[0003] Tetranychus evansi, also known as the tomato red mite, originated in South America and has a wide host range, covering 138 plant species in 37 families, especially preferring Solanaceae plants. Tetranychus urticae, as a polyphagous insect, has a miscellaneous diet and more than 800 host plants in more than 50 families. It has characteristics such as a short life cycle, high reproductive rate, serious generation overlap, and strong environmental adaptability. Spider mites at all developmental stages will gather in large numbers on plant leaves, branches, fruits, etc. to cause damage. In severe cases, it can cause plant leaves and stems to wilt, turn yellow, wither, and even die, causing huge economic losses to world agriculture. At present, the control of spider mites mainly relies on chemical control, but the unreasonable use of pesticides has caused serious "3R" problems, seriously threatening the quality of human life and physical health. With the change of global climate and crop cultivation methods, single chemical control can no longer meet the requirements of people for food security, and it is urgent to find more green and effective control means.

[0004] RNAi (RNA interference) technology is known as "the third revolution in the history of pesticides" and is an important new technical means for pest control. The core concept of the RNAi green prevention and control technology is to inject exogenous (artificial) dsRNA into insects to inhibit the expression of target genes, resulting in the growth and development disorders or death of pests, thereby reducing the damage of pests to crops and achieving pest control. RNAi technology has many advantages in pest control, such as specific pest control targets, convenient target development, easy application, simple operation, and green and pollution-free, meeting the public's demand for green pesticides. Currently, in the field of R & D of RNAi biopesticides, products have been launched on the market. In 2007, dsRNA encoding a key protein (V-ATPase) involved in energy metabolism of the western corn rootworm (Diabrotica virgifera) was expressed in corn, which could effectively reduce the damage of the western corn rootworm to corn. Only 10 years later, the first commercial insect-resistant transgenic corn obtained the planting permission from the US Environmental Protection Agency (US EPA) and received the transgenic safety permission certificate from the Ministry of Agriculture and Rural Affairs of China in 2021. On September 29, 2023, the US Environmental Protection Agency proposed to approve Ledprona, the world's first RNA interference (RNAi) biopesticide based on exogenous spraying, as a special type of new active ingredient, mainly used to control the Colorado potato beetle (CPB). This dsRNA product kills pests by silencing the CPB gene required to produce the PSMB5 protein, which is essential for maintaining the life of the CPB, but does not produce genetically modified organisms. This RNAi-based pesticide is the world's first sprayable dsRNA pesticide allowed for commercial use. To ensure that this product does not cause unreasonable adverse effects on the environment (including the safety of human food from product residues), the EPA has conducted a comprehensive assessment of Ledprona and determined that it poses no risk to human health and the environment and has no impact on species listed in the Endangered Species Act.

[0005] The process of the growth and development of spider mites is a process of coordinated expression and inhibition of many genes. With the in-depth study, a large number of RNAi target genes have been discovered. By interfering with the RNAi target genes of spider mites, such as VATPase, COPB2, AQP9, Rpt3, COPE, Rop, GARP1d, etc., the survival rate of spider mites can be significantly reduced, and some genes can simultaneously significantly inhibit the fecundity of spider mites. Currently, the research on using RNAi technology to control spider mites mostly focuses on single genes, while there are a large number of homologous genes in spider mites. RNAi targeting a single gene may have a complementary effect, resulting in poor control effect and low efficiency, which is an urgent problem to be solved in the RNAi control of spider mites. Summary of the Invention

[0006] The object of the present invention is to address the above problems and provide a dsRNA / fused dsRNA and its application in controlling spider mites.

[0007] To achieve its object, the present invention adopts the following technical solutions:

[0008] The first aspect of the present invention provides a dsRNA for controlling spider mites, and the dsRNA is dsRpt3 or a fused dsRNA; the nucleotide sequence of one strand of the dsRpt3 is as shown in SEQ ID NO.21;

[0009] The fused dsRNA is obtained by fusing dsRNAs targeting multiple genes in the same gene family of spider mites; the gene family is selected from the proteasome ATPase family and the apolipoprotein family;

[0010] The nucleotide sequence of one strand of the fused dsRNA is as shown in any one of SEQ ID NOs.1 to 4.

[0011] The second aspect of the present invention provides the coding gene of the above dsRNA for controlling spider mites:

[0012] The nucleotide sequence of the coding gene of dsRpt3 as shown in SEQ ID NO.21 is as shown in SEQ ID NO.22;

[0013] The nucleotide sequences of the coding genes of the fused dsRNAs as shown in SEQ ID NOs.1 to 4 are sequentially as shown in SEQ ID NOs.6 to 9.

[0014] The third aspect of the present invention provides any one of the following applications of the above dsRNA or the above coding gene:

[0015] 1) Application in controlling spider mites or application in preparing products for controlling spider mites;

[0016] 2) Application in promoting the death of spider mites or application in preparing products for promoting the death of spider mites;

[0017] 3) Application in inhibiting the growth of spider mites or application in preparing products for inhibiting the growth of spider mites;

[0018] 4) Application in inhibiting the expression of the gene corresponding to the fused dsRNA in spider mites, or application in preparing products for inhibiting the expression of the gene corresponding to the fused dsRNA in spider mites.

[0019] The above application is to introduce the above dsRNA into spider mites to inhibit the growth of spider mites and reduce the survival rate of spider mites, thereby achieving the control of spider mites.

[0020] The introduction method of the dsRNA is to feed the spider mites with the dsRNA.

[0021] In the application described above, the working concentration of the dsRNA is 800-1200 ng / μL.

[0022] The fourth aspect of the present invention provides a recombinant expression vector, a recombinant bacterium or an expression cassette containing the above dsRNA.

[0023] The fifth aspect of the present invention provides a recombinant expression vector, a recombinant bacterium or an expression cassette containing the above coding gene.

[0024] The sixth aspect of the present invention provides any one of the following applications of the above recombinant expression vector, recombinant bacterium or expression cassette:

[0025] 1) Application in controlling spider mites or in preparing products for controlling spider mites;

[0026] 2) Application in promoting the death of spider mites or in preparing products for promoting the death of spider mites;

[0027] 3) Application in inhibiting the growth of spider mites or in preparing products for inhibiting the growth of spider mites;

[0028] 4) Application in inhibiting the expression of the gene corresponding to the fusion dsRNA in spider mites, or in preparing products for inhibiting the expression of the gene corresponding to the fusion dsRNA in spider mites.

[0029] In the above application technical solutions, the spider mites include Tetranychus urticae and Tetranychus evansi.

[0030] The beneficial effects of the present invention are as follows: dsRNA or fusion dsRNA is provided, and the lethal effect on spider mites is significant. Each fusion dsRNA targets multiple genes corresponding to a certain function of the spider mite. By feeding, after the spider mite feeds on the fusion dsRNA, the expression of multiple genes with the same function is inhibited, thereby inhibiting the growth of the spider mite, and the mortality rate is greatly increased compared with the control group; and for Tetranychus urticae and Tetranychus evansi, the fusion dsRNA significantly increases the mortality rate of spider mites compared with the dsRNA targeting a single gene.

[0031] In the present invention, the conserved regions of genes are selected for the design of dsRNA fragments, which can target homologous genes of various spider mites (not limited to Tetranychus urticae). For the designed multiple dsRNA fragments, the number of off-target times of each dsRNA fragment is analyzed, and regions with low off-target rates for genes of organisms such as Neoseiulus barkeri (a natural enemy of spider mites, which plays an important role in pest control) and Apis cerana cerana (an important pollinating insect) are selected to protect Neoseiulus barkeri and maintain the population of beneficial organisms in the field.

[0032] Compared with the current dsRNA for controlling a single species of spider mite, the dsRNA / fusion dsRNA of the present invention can control multiple species of spider mites simultaneously (for example, controlling Tetranychus urticae and Tetranychus evansi simultaneously), and is expected to be applied in the preparation of biological pesticides for controlling spider mites, reducing the use of chemical pesticides, protecting the environment, and reducing the harm of chemical pesticides. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 It is a comparative analysis of the survival results of Tetranychus urticae in cowpea populations treated with fusion dsRpt2+dsRpt3, dsRpt3+dsRpt5, dsRpt5+dsRpt3+dsRpt2 and their single-gene dsRNAs.

[0034] Figure 2 It is a comparative analysis of the survival results of Tetranychus urticae in soybean populations treated with fusion dsRpt2+dsRpt3, dsRpt3+dsRpt5, dsRpt5+dsRpt3+dsRpt2 and their single-gene dsRNAs.

[0035] Figure 3 It is a comparative analysis of the survival results of Tetranychus urticae in cowpea populations treated with fusion dsRpt2+dsRpt3, dsRpt3+dsRpt5, dsRpt5+dsRpt3+dsRpt2 and their single-gene dsRNAs after being transferred to tomatoes.

[0036] Figure 4 It is a comparative analysis of the survival results of Tetranychus urticae in cowpea populations treated with fusion dsRpt2+dsRpt3, dsRpt3+dsRpt5, dsRpt5+dsRpt3+dsRpt2 and their single-gene dsRNAs after being transferred to roses.

[0037] Figure 5 It is a comparative analysis of the survival results of Tetranychus evansi in tomato populations treated with fusion dsRpt2+dsRpt3, dsRpt3+dsRpt5, dsRpt5+dsRpt3+dsRpt2 and their single-gene dsRNAs.

[0038] Figure 6 It is a comparative analysis of the survival results of Tetranychus urticae in soybean populations treated with fusion ds5970+ds1640 and their single-gene dsRNAs. DETAILED DESCRIPTION OF THE INVENTION

[0039] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0040] The experimental methods in the following embodiments are all conventional methods unless otherwise specified.

[0041] The spider mites used in the following experimental examples were provided by the College of Plant Protection, Southwest University. The spider mites were reared in a climate chamber using common cowpeas, soybeans, tomatoes, etc. The temperature conditions in the artificial climate chamber were 24 ± 1 °C, the relative humidity was 70% - 75%, and the photoperiod was 16 h of light: 8 h of darkness.

[0042] In the present invention, the dsRNA fragment design selects the conserved region of the gene, which can target homologous genes of various spider mites (not limited to Tetranychus urticae), and multiple dsRNA fragments are designed. The number of off-target times of each dsRNA fragment is analyzed, and regions with low off-target rates for biological genes such as Neoseiulus barkeri (a natural enemy of spider mites, which plays an important role in pest control) and Apis cerana (an important pollinating insect) are selected to protect Neoseiulus barkeri, etc., and maintain the population of beneficial organisms in the field.

[0043] Example 1. Design and preparation of fusion dsRNA

[0044] 1. Design of fusion dsRNA

[0045] Based on the transcriptomes of Tetranychus urticae, Tetranychus evansi, Neoseiulus barkeri, etc., we selected target pests such as Tetranychus urticae and Tetranychus evansi through the pipelineII module of dsRNA-Engineer, and selected non-target organisms such as Neoseiulus barkeri for analysis through the targeting strategy of Model I. Among the recommended dsRNA fragments, considering the analysis results of conservativeness and safety, the best dsRNA fragments were selected, and the lengths of the gene fragments in each fusion dsRNA were ensured to be as consistent as possible. The length of the fusion dsRNA fragment was generally about 300 - 600 bp. Then, using the dsRNAintargetingmultiple gene module of dsRNA-Engineer, the selected gene fragments were sorted and combined. Considering the analysis results of conservativeness and safety, the optimal arrangement order of the gene fragments was selected. One strand sequence of one of the 4 fusion dsRNAs is shown in SEQ ID NO.1 - 4 (the other strand is the reverse complementary sequence), and one strand sequence of the control dsGFP is shown in SEQ ID NO.5. The nucleotide sequences of the coding genes of the dsRNAs shown in SEQ ID NO.1 - 5 are shown in SEQ ID NO.6 - 10 in sequence. The candidate genes and the selected xbp fragments are shown in Table 1 below.

[0046] Table 1. Spider mite candidate genes

[0047]

[0048] 2. Preparation of fusion dsRNA

[0049] The sequences of the fusion dsRNAs shown in SEQ ID NO.1-4 designed previously were synthesized by Beijing Tsingke Biotechnology Co., Ltd. into puncture bacteria containing the fusion dsRNA sequences. After amplifying the dsRNA sequences using the primers in Table 2 with the puncture bacteria as the template, the sequences were purified. The purified cDNA sequence fragments were used as templates for synthesizing dsRNAs. The corresponding fusion dsRNAs were synthesized using the TranscriptAid T7 HighYield Transcription Kit (Thermo Scientific, USA). The dsRNA synthesis system was 4 μL of 10× Transcription Buffer, 2 μL of 20× Ribonucleotide Solution Mix, the cDNA (1 μg) purified previously, 2 μL of 20× HMW Mix, 2 μL of T7 RNA Polymerase (500 units / μL -1 ), and RNase-Free ddH2O was added to make up to 40 μL, and incubated overnight at 37°C. After the reaction, the reaction products were purified using the Min Elute PCR Cleaning Kit (Qiagen, Germany). The operation process referred to the kit instruction manual. Finally, the dsRNAs were dissolved in nuclease-free water, and the concentration and purity of the dsRNAs were detected using a Nanodrop one spectrophotometer, and the integrity of the dsRNAs was detected by 1% agarose gel electrophoresis.

[0050] The names of the dsRNAs in Table 2 correspond to the names of the dsRNAs in Table 1.

[0051] Table 2. Primers for synthesizing dsGFP and fusion dsRNAs

[0052]

[0053] * The 5' ends of the primers in Table 2 are all ligated with T7 promoter sequences (i.e., the lowercase letter parts of the sequences in Table 2).

[0054] Example 2. Application of fusion dsRNAs in inhibiting the growth of spider mites

[0055] In this example, the test spider mites were Tetranychus urticae and Tetranychus evansi. The Tetranychus urticae population on cowpea or soybean refers to the Tetranychus urticae fed with cowpea or soybean before feeding dsRNA, and the Tetranychus evansi population on tomato refers to the Tetranychus evansi fed with tomato before feeding dsRNA.

[0056] Both Tetranychus urticae and Tetranychus evansi have a wide range of hosts. Especially for Tetranychus urticae, there are more than a thousand hosts that it can damage. In the field, if one kind of plant is not enough for feeding, the spider mites can easily transfer to other host plants to cause damage. Therefore, it is very important that dsRNA also has good lethality for Tetranychus urticae and Tetranychus evansi after they have changed hosts. Therefore, in this example, spider mite populations fed on different plants were transferred to plant leaves different from those used in the previous rearing of spider mites after feeding dsRNA to verify the lethal effect of dsRNA in this case.

[0057] The dsRNA used in the experiment was the fusion dsRNA in Table 1.

[0058] 1. Preparation of Spider Mites and Devices

[0059] Starvation device: Take a petri dish with a diameter of 10 cm, tear the moist cotton into thin strips, surround the inside of the petri dish, and seal the petri dish tightly with plastic wrap.

[0060] Feeding device: Take a petri dish with a diameter of 3.5 cm, cover the small petri dish with parafilm sealing film, press it firmly, cut a piece of gauze with a size of 1 cm×1 cm and place it in the middle of the petri dish, add 40 μL of dsRNA aqueous solution with a concentration of 1000 ng / ul, stretch the sealing film more than 4 times, cover the petri dish, and gently press with fingers to make the dsRNA solution evenly distributed on the gauze. Surround the feeding device with lens cleaning paper to prevent the test mites from escaping.

[0061] 2. Application of Fusion dsRNA in Controlling Spider Mites

[0062] Dissolve the fusion dsRNA in nuclease-free water to a concentration of 1000 ng / μL. Pick female adult spider mites with the same instar and place them in the starvation device. After 12 h, transfer the spider mites to the feeding device. After 24 h, transfer the spider mites to plant leaves such as cowpea and tomato for feeding. Count the number of surviving spider mites every 24 h for a total of 10 days. Each treatment includes 3 biological replicates. At the same time, set up a dsGFP control group and 3 groups of single-gene dsRNA treatment groups. The single-gene dsRNA treatment groups include the dsRpt3 (the dsRNA sequence is shown in SEQ ID NO.21, and its coding gene sequence is shown in SEQ ID NO.22) treatment group, the ds5970 (the dsRNA sequence is shown in SEQ ID NO.23) treatment group, and the ds1640 (the dsRNA sequence is shown in SEQ ID NO.24) treatment group.

[0063] The survival curve was analyzed by using the log-rank test (Mantel-Cox) with GraphPad Prism 8.0.2.

[0064] After feeding female adult spider mites with dsRNA for 24 h, the spider mites were transferred to plant leaves to count their mortality rate, and the results are as Figure 1-6 shown.

[0065] After treating spider mites with fused dsRpt2+dsRpt3, dsRpt3+dsRpt5, dsRpt5+dsRpt3+dsRpt2 and their single-gene dsRNAs for 24 h, the spider mites were transferred to the same kind of plant leaves used for feeding spider mites to allow them to feed on the leaves, and their mortality rate was counted every 24 h. The results are shown in Table 3 and Figure 1-2 (Tetranychus urticae) and Figure 5 (Tetranychus evansi) as follows: Compared with the control dsGFP, the survival rate of spider mites on cowpea, soybean and tomato was significantly reduced when fed with fused dsRNAs compared with single-gene dsRNAs; there were also significant differences in part between the fused dsRNA treatment group and the single-gene dsRNA treatment group: the mortality rate of spider mites in the fused dsRNA treatment groups (dsRpt2+dsRpt3 treatment group, dsRpt3+dsRpt5 treatment group, dsRpt5+dsRpt3+dsRpt2 treatment group) of the soybean population of Tetranychus urticae was significantly higher.

[0066] Table 3. Statistical results of the mortality rate of spider mites at 10 days

[0067]

[0068] After treating spider mites with fused dsRpt2+dsRpt3, dsRpt3+dsRpt5, dsRpt5+dsRpt3+dsRpt2 and their single-gene dsRNAs for 24 h, the spider mites were transferred to different kinds of plant leaves from the leaves used for feeding spider mites to allow them to feed on the leaves, and their mortality rate was counted every 24 h. The results are shown in Table 4 and Figure 3 (Transfer of Tetranychus urticae population on cowpea to tomato) and Figure 4 (Transfer of Tetranychus urticae population on cowpea to Chinese rose) as follows: Compared with the control dsGFP, the survival rate of Tetranychus urticae population on cowpea was significantly reduced when transferred to tomato and Chinese rose when fed with fused dsRNAs compared with single-gene dsRNAs; there were also significant differences in part between the fused dsRNA treatment group and the single-gene dsRNA treatment group. When transferred to tomato, the mortality rate of spider mites in the fused dsRNA treatment group (dsRpt3+dsRpt5 treatment group) of Tetranychus urticae was significantly higher.

[0069] Table 4. Statistical results of the mortality rate of spider mites at 10 days

[0070]

[0071] After feeding the adult female two-spotted spider mites with the fused ds5970 + ds1640 and the single genes ds5970 and ds1640 respectively for 24 h, the spider mites were transferred to soybeans to count their mortality rate. The results are shown in Table 5 and Figure 6 as follows: Compared with the control dsGFP, the survival rate of spider mites on soybeans was significantly reduced when fed with the fused dsRNA compared to the single gene dsRNAs; there were also significant differences in the survival rate of spider mites between the fused dsRNA treatment group and the single gene dsRNA treatment groups, and the mortality rate of spider mites in the fused dsRNA treatment group was significantly higher.

[0072] Table 5. Statistical results of the mortality rate of spider mites at 10 days

[0073] Tetranychus urticae / fused dsRNA ds5970 ds1640 ds5970 + ds1640 dsGFP WT Soybean population of Tetranychus urticae 36.37％ 43.23％ 63.25％ 19.75％ 21.18％

[0074] The dsRNA and its coding gene sequences in the embodiments of the present invention are as follows:

[0075] SEQ ID NO.1 (dsRpt2 + dsRpt3):

[0076] GGAGGAGAAAGGGAAAUCCAAAGAACCAUGUUGGAGUUACUUAACCAAUUGGAUGGUUUUGAUUCUCGUGGUGAUGUCAAAGUUGUGAUGGCAACUAAUAGAAUCGAAACACUUGAUCCUGCCCUUAUUCGGCCUGGUCGUAUCGAUCGUAAAAUUGAAUUCCCCCUUCCAGAUGAAAAGACCAAAAGAAGGAUAUUUACCAUUCAUACCUCAAGGAUGACCUUAGCAGAAGACGUCAAUUUUGAUGAAAUCGUUUUGUCAAAGGACGAUUUGAGUGGAGCUGAUAUUAAAGCCAUUUGUACCGAAGCCGGUCUUAUGGCACUAAUGGGUUUGAUCAAAGUACUAAUGUUAAAGUAAUCAUGGCCACUAAUCGGGCAGAUACUUUGGACCCUGCUUUACUCCGUCCAGGACGUUUAGACAGGAAAAUUGAAUUCCCGUUACCAGAUCGUCGACAAAAACGUCUUGUUUUCUCAACCAUCACUGCAAGGAUGAAUCUCAGUGAUGAAGUAGAUUUAGAAGACUAUGUGGCUCGACCAGAACGUAUAUCUGGUGCUGAUAUAAAUGCUAUUUGCCAGGAGGCUGGUAUGCAUGCAGUUAGAGAGAAUCGUUAUGUCAUUCUUCCAAAAGAUUUCGAAAA。

[0077] SEQ ID NO.2 (dsRpt3 + dsRpt5):

[0078] UGGAUGGGUUUGAUCAAAGUACUAAUGUUAAAGUAAUCAUGGCCACUAAUCGGGCAGAUACUUUGGACCCUGCUUUACUCCGUCCAGGACGUUUAGACAGGAAAAUUGAAUUCCCGUUACCAGAUCGUCGACAAAAACGUCUUGUUUUCUCAACCAUCACUGCAAGGAUGAAUCUCAGUGAUGAAGUAGAUUUAGAAGACUAUGUGGCUCGACCAGAACGUAUAUCUGGUGCUGAUAUAAAUGCUAUUUGCCAGGAGGCUGGUAUGCAUGCAGUUAGAGAGAAUCGUUAUGUCAUUCUUCCAAAAGAUUUCGAAGGAGUGAACAAAGAUUCUUAUCUGGUUUUAGAGACUUUACCAGCUGAAUACGACUCAAGGGUUAAAGCGAUGGAAGUCGACGAGCGUCCAACAGAACAAUAUAAUGAUAUCGGAGGUUUAGAUAAACAAAUCCAAGAACUUAUCGAAGCUGUUGUCUUGCCAAUGACUCACAAAGAAAAAUUCGAGAACAUCGGUAUCCAGCCACCUAAAGGUGUUUUACUUUACGGUCCUCCCGGUACUGGUAAAACUUUAAUGGCUCGUGCUUGUGCAGCACAAACAAAAUCAACUUUCCUUAAACUGGCGGGUCCACAAUUAGUUCAGAU。

[0079] SEQ ID NO.3 (dsRpt5 + dsRpt3 + dsRpt2):

[0080] AAAAAGCUGGUGAUCGUGAAGUGCAGCGAACUAUGUUGGAACUACUUAACCAGCUUGACGGAUUUAGUUCUCAAUCUGAUAUAAAGGUUAUAGCUGCUACAAACAGAGUAGACAUUCUUGAUCCAGCCUUACUUCGAUCCGGUCGUUUGGAUAGAAAAAUCGAAUUCCCUCAUCCCAAUGAGGAGGCUCGAUCUCGCAUAAUGCAAAUUCAUUCCAGGCGAGUACUAAUGUUAAAGUAAUCAUGGCCACUAAUCGGGCAGAUACUUUGGACCCUGCUUUACUCCGUCCAGGACGUUUAGACAGGAAAAUUGAAUUCCCGUUACCAGAUCGUCGACAAAAACGUCUUGUUUUCUCAACCAUCACUGCAAGGAUGAAUCUCAGUGAUGAAGUAGAUUUAGAAGACUAUGUGGCUCGACCAGAACGUAUAUCUGGUUAACCAAUUGGAUGGUUUUGAUUCUCGUGGUGAUGUCAAAGUUGUGAUGGCAACUAAUAGAAUCGAAACACUUGAUCCUGCCCUUAUUCGGCCUGGUCGUAUCGAUCGUAAAAUUGAAUUCCCCCUUCCAGAUGAAAAGACCAAAAGAAGGAUAUUUACCAUUCAUACCUCAAGGAUGACCUUAGCAGAAGACGUCAAUUUUGA。

[0081] SEQ ID NO.4 (ds5970 + ds1640):

[0082] UCCUCCAGCUGCUCCUGAAGGUACAGACAUCACCAAGAUUGCCGGUAGAUGGUAUGAGAUUGCUCGACCAACCAAAGCCUCUGAAAAUGGUUUAACAUGUGUUACAUCUGACUUCACUCUUCGACCUGAUGGUGACUACAAGCAACUCCAAAGAUCGGUAAGUGUCCAACUCCAGGUGAUGAAAAGACUGAUUUCGAAGUGUCCAGAUAUCUUGGUCGUUGGUAUGAAAUCAAAAGAUCGGAUACUCCAAGCGAAAAGGGUGUUAAAUGUUCAACUGCAAAU。

[0083] SEQ ID NO.5 (dsGFP):

[0084] AGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGG。

[0085] SEQ ID NO.6 (coding gene sequence of dsRpt2 + dsRpt3):

[0086] GGAGGAGAAAGGGAAATCCAAAGAACCATGTTGGAGTTACTTAACCAATTGGATGGTTTTGATTCTCGTGGTGATGTCAAAGTTGTGATGGCAACTAATAGAATCGAAACACTTGATCCTGCCCTTATTCGGCCTGGTCGTATCGATCGTAAAATTGAATTCCCCCTTCCAGATGAAAAGACCAAAAGAAGGATATTTACCATTCATACCTCAAGGATGACCTTAGCAGAAGACGTCAATTTTGATGAAATCGTTTTGTCAAAGGACGATTTGAGTGGAGCTGATATTAAAGCCATTTGTACCGAAGCCGGTCTTATGGCACTAATGGGTTTGATCAAAGTACTAATGTTAAAGTAATCATGGCCACTAATCGGGCAGATACTTTGGACCCTGCTTTACTCCGTCCAGGACGTTTAGACAGGAAAATTGAATTCCCGTTACCAGATCGTCGACAAAAACGTCTTGTTTTCTCAACCATCACTGCAAGGATGAATCTCAGTGATGAAGTAGATTTAGAAGACTATGTGGCTCGACCAGAACGTATATCTGGTGCTGATATAAATGCTATTTGCCAGGAGGCTGGTATGCATGCAGTTAGAGAGAATCGTTATGTCATTCTTCCAAAAGATTTCGAAAA。

[0087] SEQ ID NO. 7 (coding gene sequence of dsRpt3 + dsRpt5): TGGATGGGTTTGATCAAAGTACTAATGTTAAAGTAATCATGGCCACTAATCGGGCAGATACTTTGGACCCTGCTTTACTCCGTCCAGGACGTTTAGACAGGAAAATTGAATTCCCGTTACCAGATCGTCGACAAAAACGTCTTGTTTTCTCAACCATCACTGCAAGGATGAATCTCAGTGATGAAGTAGATTTAGAAGACTATGTGGCTCGACCAGAACGTATATCTGGTGCTGATATAAATGCTATTTGCCAGGAGGCTGGTATGCATGCAGTTAGAGAGAATCGTTATGTCATTCTTCCAAAAGATTTCGAAGGAGTGAACAAAGATTCTTATCTGGTTTTAGAGACTTTACCAGCTGAATACGACTCAAGGGTTAAAGCGATGGAAGTCGACGAGCGTCCAACAGAACAATATAATGATATCGGAGGTTTAGATAAACAAATCCAAGAACTTATCGAAGCTGTTGTCTTGCCAATGACTCACAAAGAAAAATTCGAGAACATCGGTATCCAGCCACCTAAAGGTGTTTTACTTTACGGTCCTCCCGGTACTGGTAAAACTTTAATGGCTCGTGCTTGTGCAGCACAAACAAAATCAACTTTCCTTAAACTGGCGGGTCCACAATTAGTTCAGAT。

[0088] SEQ ID NO. 8 (coding gene sequence of dsRpt5 + dsRpt3 + dsRpt2):

[0089] AAAAAGCTGGTGATCGTGAAGTGCAGCGAACTATGTTGGAACTACTTAACCAGCTTGACGGATTTAGTTCTCAATCTGATATAAAGGTTATAGCTGCTACAAACAGAGTAGACATTCTTGATCCAGCCTTACTTCGATCCGGTCGTTTGGATAGAAAAATCGAATTCCCTCATCCCAATGAGGAGGCTCGATCTCGCATAATGCAAATTCATTCCAGGCGAGTACTAATGTTAAAGTAATCATGGCCACTAATCGGGCAGATACTTTGGACCCTGCTTTACTCCGTCCAGGACGTTTAGACAGGAAAATTGAATTCCCGTTACCAGATCGTCGACAAAAACGTCTTGTTTTCTCAACCATCACTGCAAGGATGAATCTCAGTGATGAAGTAGATTTAGAAGACTATGTGGCTCGACCAGAACGTATATCTGGTTAACCAATTGGATGGTTTTGATTCTCGTGGTGATGTCAAAGTTGTGATGGCAACTAATAGAATCGAAACACTTGATCCTGCCCTTATTCGGCCTGGTCGTATCGATCGTAAAATTGAATTCCCCCTTCCAGATGAAAAGACCAAAAGAAGGATATTTACCATTCATACCTCAAGGATGACCTTAGCAGAAGACGTCAATTTTGA。

[0090] SEQ ID NO.9 (Coding gene sequence of ds5970 + ds1640):

[0091] TCCTCCAGCTGCTCCTGAAGGTACAGACATCACCAAGATTGCCGGTAGATGGTATGAGATTGCTCGACCAACCAAAGCCTCTGAAAATGGTTTAACATGTGTTACATCTGACTTCACTCTTCGACCTGATGGTGACTACAAGCAACTCCAAAGATCGGTAAGTGTCCAACTCCAGGTGATGAAAAGACTGATTTCGAAGTGTCCAGATATCTTGGTCGTTGGTATGAAATCAAAAGATCGGATACTCCAAGCGAAAAGGGTGTTAAATGTTCAACTGCAAAT。

[0092] SEQ ID NO.10 (Coding gene sequence of dsGFP):

[0093] AGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGG。

[0094] SEQ ID NO.21 (dsRpt3):

[0095] UAGAGCUUCCAUUAACUCACUUUGAAUUGUAUAAACAAAUCGGUAUUGACCCACCUCGUGGUGUUCUCAUGUAUGGUCCUCCAGGUUGUGGUAAAACUAUGUUAGCCAAAGCAGUUGCUCAUCAUACCACUGCAUCUUUCAUUCGUGUUGUUGGUUCUGAGUUUGUCCAAAAGUACCUUGGUGAAGGUCCUAGGAUGGUCCGAGAUGUGUUUAGACUAGCGCGAGAAAAUGCCCCGGCAAUUAUAUUUAUUGAUGAAAUCGAUGCUAUAGCAACCAAGAGAUUUGAUGCUCAAACUGGUGCUGACAGAGAGGUUCAAAGAAUCUUGUUAGAAUUAUUGAAUCAAAUGGAUGGGUUUGAUCAAAGUACUAAUGUUAAAGUAAUCAUGGCCACUAAUCGGGCAGAUACUUUGGACCCUGCUUUACUCCGUCCAGGACGUUUAGACAGGAAAAUUGAAUUCCCGUUACCAGAUCGUCGACAAAAACGUCUUGUUUUCUCAACCAUCACUGCAAGGAUGAAUCUCAGUGAUGAAGUAGAUUUAGAAGACUAUGUGGCUCGACCAGAACGUAUAUCUGGUGCUGAUAUAAAUGCUAUUUGCCAGGAGGCUGGUAUGCAUGCAGUUAGAGAGAAUCGUUAUGU。

[0096] SEQ ID NO.22 (Coding gene sequence of dsRpt3):

[0097] TAGAGCTTCCATTAACTCACTTTGAATTGTATAAACAAATCGGTATTGACCCACCTCGTGGTGTTCTCATGTATGGTCCTCCAGGTTGTGGTAAAACTATGTTAGCCAAAGCAGTTGCTCATCATACCACTGCATCTTTCATTCGTGTTGTTGGTTCTGAGTTTGTCCAAAAGTACCTTGGTGAAGGTCCTAGGATGGTCCGAGATGTGTTTAGACTAGCGCGAGAAAATGCCCCGGCAATTATATTTATTGATGAAATCGATGCTATAGCAACCAAGAGATTTGATGCTCAAACTGGTGCTGACAGAGAGGTTCAAAGAATCTTGTTAGAATTATTGAATCAAATGGATGGGTTTGATCAAAGTACTAATGTTAAAGTAATCATGGCCACTAATCGGGCAGATACTTTGGACCCTGCTTTACTCCGTCCAGGACGTTTAGACAGGAAAATTGAATTCCCGTTACCAGATCGTCGACAAAAACGTCTTGTTTTCTCAACCATCACTGCAAGGATGAATCTCAGTGATGAAGTAGATTTAGAAGACTATGTGGCTCGACCAGAACGTATATCTGGTGCTGATATAAATGCTATTTGCCAGGAGGCTGGTATGCATGCAGTTAGAGAGAATCGTTATGT。

[0098] SEQ ID NO.23(ds5970):

[0099] UCCUCCAGCUGCUCCUGAAGGUACAGACAUCACCAAGAUUGCCGGUAGAUGGUAUGAGAUUGCUCGACCAACCAAAGCCUCUGAAAAUGGUUUAACAUGUGUUACAUCUGACUUCACUCUUCGACCUGAUGGUGACUACAA。

[0100] SEQ ID NO.24(ds1640):

[0101] GCAACUCCAAAGAUCGGUAAGUGUCCAACUCCAGGUGAUGAAAAGACUGAUUUCGAAGUGUCCAGAUAUCUUGGUCGUUGGUAUGAAAUCAAAAGAUCGGAUACUCCAAGCGAAAAGGGUGUUAAAUGUUCAACUGCAAAU。

Claims

1. A dsRNA for controlling spider mites, characterized in that: The dsRNA is dsRpt3 or fusion dsRNA; the nucleotide sequence of one strand of the dsRpt3 is shown in SEQ ID NO.21; The fused dsRNA is obtained by fusing dsRNAs targeting multiple genes of the same gene family of spider mites; the gene family is selected from the proteasome ATPase family and the apolipoprotein family; The nucleotide sequence of one of the chains of the fusion dsRNA is shown in any one of SEQ ID NOs. 1 to 4.

2. The gene encoding dsRNA for controlling spider mites according to claim 1, characterized in that: The nucleotide sequence of the gene encoding dsRpt3 as shown in SEQ ID NO.21 is shown in SEQ ID NO.22; The nucleotide sequences of the genes encoding the fusion dsRNAs shown in SEQ ID NOs. 1 to 4 are shown in SEQ ID NOs. 6 to 9, respectively.

3. Any of the following uses of the dsRNA of claim 1 or the encoding gene of claim 2: 1) Application in controlling spider mites or in preparing products for controlling spider mites; 2) Use in promoting the death of spider mites or in preparing products that promote the death of spider mites; 3) Use in inhibiting the growth of spider mites or in preparing products for inhibiting the growth of spider mites; 4) Use in inhibiting the expression of a gene corresponding to fused dsRNA in spider mites, or in preparing a product for inhibiting the expression of a gene corresponding to fused dsRNA in spider mites.

4. The use according to claim 3, characterized in that: The application is to introduce the dsRNA described in claim 1 into spider mites to inhibit the growth of spider mites and reduce the survival rate of spider mites, thereby achieving the prevention and control of spider mites.

5. The use according to claim 4, characterized in that: The dsRNA is introduced by feeding spider mites with dsRNA.

6. The use according to claim 5, characterized in that: The working concentration of the dsRNA is 800-1200 ng / μL.

7. A recombinant expression vector, recombinant bacteria or expression cassette containing the dsRNA according to claim 1.

8. A recombinant expression vector, recombinant bacteria or expression cassette containing the coding gene according to claim 2.

9. Any of the following uses of the recombinant expression vector, recombinant bacteria or expression cassette according to claim 7 or 8: 1) Application in controlling spider mites or in preparing products for controlling spider mites; 2) Use in promoting the death of spider mites or in preparing products that promote the death of spider mites; 3) Use in inhibiting the growth of spider mites or in preparing products for inhibiting the growth of spider mites; 4) Use in inhibiting the expression of a gene corresponding to fused dsRNA in spider mites, or in preparing a product for inhibiting the expression of a gene corresponding to fused dsRNA in spider mites.

10. The use according to claim 3 or 9, characterized in that: The spider mites include two-spotted spider mites and Ichthyophthirius urticae.

Images