Fusion dsRNA and application thereof in prevention and treatment of tomato leaf miner

Abstract

The invention discloses fused dsRNA (double-stranded ribonucleic acid) and application thereof in prevention and treatment of tomato leaf miner, and belongs to the technical field of biology. The dsRNA fusion protein is formed by fusing a plurality of dsRNAs targeting the same function, and the nucleotide sequence of the dsRNA fusion protein is as shown in SEQ ID NO.1, SEQ ID NO.2 and / or SEQ ID NO.3. Three fused dsRNAs are designed, each fused dsRNA can target multiple genes with the same function of the tomato leaf miner at the same time, and after the fused dsRNAs are delivered into the body of the tomato leaf miner through a soaking method, the survival rate and pupation number of the tomato leaf miner are remarkably reduced. And compared with dsRNA of a target single gene, the fused dsRNA has the advantages that the death rate of the tomato leaf miner is obviously improved, and meanwhile, the fused dsRNA has no influence on non-target biological nesidiocoris tenuis. The invention provides a new method for preventing and controlling the tomato leaf miner based on RNAi, and is expected to be applied to preparation of biopesticide for preventing and controlling the tomato leaf miner.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a fusion dsRNA and its use in the control of Tuta absoluta. Background Art

[0002] Tuta absoluta (Meyrick), also known as the tomato leafminer and the South American tomato leafminer, is native to Peru in South America. It has a wide range of hosts and mainly damages solanaceous crops. It is one of the most destructive invasive pests in the world. In 2017, this pest was first discovered in Xinjiang in China. It has now invaded more than 100 countries and regions including China. It is also a major newly emerging invasive species under key control in China (List of Alien Invasive Species under Key Management in China, 2022) and is included in the management of the List of Crop Pests of Category I (Ministry of Agriculture and Rural Affairs, 2023). Tuta absoluta has the characteristics of having many host crops, a wide suitable growth area, strong reproductive ability, and heavy damage losses. It seriously damages solanaceous crops such as tomatoes. Generally, it can cause a 20%-30% reduction in production, and in severe cases, it can reach more than 50% or even a complete harvest failure, seriously threatening the industrial safety of tomatoes and other crops and the security of the "vegetable basket" supply.

[0003] RNAi (RNA interference), also known as RNA interference, is a new technology that silences the target genes of the host by exogenously introducing dsRNA or expressing a construct of shRNA. The pest control technology based on RNAi has many characteristics and advantages that cannot be achieved by many traditional control methods, such as specificity, high efficiency, and environmental safety. It has great application potential and application value in the field of pest control. Currently, RNAi biopesticides have products on the market. In 2007, Monsanto Company in the United States found that expressing dsRNA of the V-ATPase A gene of Diabrotica virgifera virgifera larvae in corn could slow down the development of Diabrotica virgifera virgifera larvae and significantly increase the mortality rate, ultimately reducing the economic losses caused by it. In 2015, Monsanto Company developed the corn hybrid MON 87411, which can produce Cry3Bb1 Bt protein with activity against corn root pests and can also express dsRNA targeting the Snf7 gene of corn root pests. The developed dsRNA biopesticide with the PSMB5 gene is named Ledprona, which has now been approved by the EPA and officially registered as the world's first sprayable RNA biopesticide.

[0004] RNAi-based pest control methods rely on the silencing of specific genes involved in important life processes such as growth and development, reproduction, and immunity. To date, multiple studies have been conducted on the target mining of the tomato leafminer based on RNAi. In terms of growth and development, Juvenile hormone binding protein (JHBP), Coatomer subunit alpha protein (COP), Juvenile hormone inducible protein (JHP), and Chitin synthase A (CHI) of the tomato leafminer are potential RNAi targets. By applying the corresponding dsRNA to the leaves or mixing it with artificial diet and feeding it to the tomato leafminer, the growth and development of the larvae are inhibited and the survival rate is reduced.

[0005] ryanodine receptors (RyRs), acetyl-cholinesterase subunit 1 (AchE), and nicotinic acetylcholine alpha 6 (nAChRs) play important roles in neurotransmission. Moreover, by feeding the tomato leafminer through injection or the method of mediating dsRNA through the roots of plants, the survival rate of the larvae and the pupal weight are reduced. In addition to the above lethal genes, three hydrolase genes, Vacuolar ATPase-A (V-ATPase), Arginine kinase (AK), and Carboxylesterase (COE), also show great potential in the RNAi control of the tomato leafminer. When the corresponding dsRNA is delivered into the body of the tomato leafminer, the survival rate of the larvae is significantly reduced.

[0006] Currently, the control of pests by RNAi technology mostly focuses on single genes. However, there are a large number of homologous genes in the tomato leafminer, and single genes may have complementary effects, resulting in poor control effects. Moreover, the tomato leafminer itself is not sensitive to RNAi. These are all problems that need to be solved in the RNAi control of the tomato leafminer. Summary of the Invention

[0007] In view of the above deficiencies in the prior art, the present invention provides a fused dsRNA and its use in the control of Tuta absoluta. Based on the known lethal target genes of Tuta absoluta with known functions, according to gene functions, they are divided into growth and development-related genes Juvenile hormone binding protein (JHBP), Coatomer subunit alphaprotein (COP), Juvenile hormone inducible protein (JHP), and Chitin synthase A (CHI), neurotransmission-related genes ryanodine receptors (RyRs), acetyl-cholinesterase subunit 1 (AchE), and nicotinic acetylcholine alpha 6 (nAChRs), and hydrolase genes Vacuolar ATPase-A (V-ATPase), Arginine kinase (AK), and Carboxylesterase (COE). Fused dsRNA sequences targeting these three types of genes (obtained by fusing dsRNAs targeting similar functional genes) are designed, and regions with low off-target rates for homologous genes of Nesidiocoris tenuis are used as dsRNAs. The corresponding dsRNA fragments are synthesized in vitro and mixed with nanomaterials, and then delivered into the larvae of Tuta absoluta by the soaking method to measure the lethal effect on Tuta absoluta. The results show that both the survival rate and the number of pupae of Tuta absoluta are significantly reduced. At the same time, the lethal effects of the fused dsRNA and single dsRNA are compared. It is found that the fused dsRNA targeting growth and development-related genes significantly reduces the survival rate, the number of pupae, body length, and body width of Tuta absoluta compared with single dsCOP. And the safety evaluation shows that it has no effect on the predatory natural enemy Nesidiocoris tenuis, indicating that the three fused dsRNAs have great potential for controlling Tuta absoluta and are safe for natural enemies, and are expected to be applied to the preparation of biological pesticides for controlling Tuta absoluta.

[0008] To achieve the above object, the technical solution adopted by the present invention to solve its technical problems is: The object of the present invention is to provide a fused dsRNA, the nucleic acid of which is composed of multiple dsRNAs targeting the same function, and its sequence is shown in SEQ ID NO.1, SEQ ID NO.2, and / or SEQ ID NO.3.

[0009] Further, the fused dsRNA shown in SEQ ID NO.1 targets growth and development-related genes; The fused dsRNA shown in SEQ ID NO.2 targets neurotransmission-related genes; The fusion dsRNA targeting the hydrolase-related gene as shown in SEQ ID NO.3.

[0010] Furthermore, the growth and development-related genes include Juvenile hormone binding protein (JHBP), Coatomer subunit alpha protein (COP), Juvenile hormone inducible protein (JHP), and Chitin synthase A (CHI)); The neurotransmission-related genes include ryanodine receptors (RyRs), acetyl-cholinesterase subunit 1 (AchE), and nicotinic acetylcholine alpha 6 (nAChRs); The hydrolase genes include Vacuolar ATPase-A (V-ATPase), Arginine kinase (AK), and Carboxylesterase (COE).

[0011] Another object of the present invention is to provide a recombinant vector, which comprises the above-mentioned fusion dsRNA.

[0012] Another object of the present invention is a cell line, which comprises the above-mentioned fusion dsRNA, or the recombinant vector.

[0013] Another object of the present invention is an engineered bacterium, which comprises the above-mentioned fusion dsRNA, or the recombinant vector.

[0014] Use of the above-mentioned fusion dsRNA, recombinant vector, cell line or engineered bacterium in the preparation of a preparation for controlling Tuta absoluta.

[0015] Another object of the present invention is a preparation for controlling Tuta absoluta, which uses the above-mentioned fusion dsRNA as an active ingredient.

[0016] Furthermore, the preparation further comprises a pharmaceutically acceptable adjuvant.

[0017] Another object of the present invention is a primer set for amplifying the above-mentioned fusion dsRNA, and the sequences of the primer set are as shown in SEQ ID NO.4~9; wherein, The primer set as shown in SEQ ID NO.4 and 5 amplifies the fusion dsRNA shown in SEQ ID NO.1; The primer set as shown in SEQ ID NO.6 and 7 amplifies the fusion dsRNA shown in SEQ ID NO.2; The primer sets shown in SEQ ID NO.8 and 9 amplify the fusion dsRNA shown in SEQ ID NO.3.

[0018] Advantages of the present invention: The present invention designs 3 fusion dsRNAs, each of which can simultaneously target multiple genes with the same function in Tuta absoluta. After delivering the fusion dsRNAs into Tuta absoluta by the soaking method, the survival rate and pupation number of Tuta absoluta are significantly reduced. Moreover, the fusion dsRNAs significantly increase the mortality rate of Tuta absoluta compared with the dsRNAs targeting single genes, and at the same time, the fusion dsRNAs have no effect on the non-target organism, Nesidiocoris tenuis. It provides a new method for controlling Tuta absoluta based on RNAi and is expected to be applied to the preparation of biological pesticides for controlling Tuta absoluta. Description of the drawings

[0019] Figure 1 is the larval mortality rate after soaking Tuta absoluta with 3 fusion dsRNAs; Figure 2 is the number of pupae of larvae after soaking Tuta absoluta with 3 fusion dsRNAs; Figure 3 is the larval mortality rate after soaking Tuta absoluta with the fusion dsMolt and the single dsRNA targeting COP; Figure 4 is the effect of 3 fusion dsRNAs on the survival of adult Nesidiocoris tenuis; Figure 5 is the effect of 3 fusion dsRNAs on the body weight of adult Nesidiocoris tenuis. Detailed implementation manners

[0020] The following describes the detailed implementation manners of the present invention to facilitate those skilled in the art of the present technology to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the detailed implementation manners. For those of ordinary skill in the art of the present technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions made using the concept of the present invention are within the scope of protection.

[0021] Example 1 Design of fusion dsRNAs of Tuta absoluta Based on the existing lethal target genes of Tuta absoluta, according to gene functions, they are divided into three categories: genes related to growth and development, genes related to neurotransmission, and hydrolase genes. Among them, the genes related to growth and development include JHBP, JHP, COP, and CHI, the genes related to neurotransmission include nAChRs, RyRs, and AchE, and the hydrolase genes include COE, V-ATPase, and AK. And fusion dsRNAs targeting these three categories of genes are designed. The design of the fusion dsRNAs is as follows: (1) The length of each fused dsRNA is limited to 480 bp. The fused dsRNA (dsMolt) targeting genes related to growth and development consists of 4 dsRNA fragments, each with a length of 120 bp. The fused dsRNA (dsNerve) targeting genes related to neurotransmission and the fused dsRNA (dsHydro) targeting hydrolase genes consist of 3 dsRNA fragments, each with a length of 160 bp. (2) The dsRNA is designed in the effective region: According to the dsRNA design website (dsRNA engineer: http: / / www.dsrna-engineer.cn / ), each dsRNA fragment is designed in the region that can produce more effective siRNAs and has a low off-target rate for the natural enemy, Nesidiocoris tenuis. (3) According to the above principles, the dsRNA fragments corresponding to each gene are designed, and the corresponding dsRNA fragments are combined to construct the fused dsRNA. At the same time, the sequence of the fused dsRNA is synthesized by Beijing Tsingke Biotechnology Co., Ltd. The nucleic acid sequence of the fused dsRNA is as follows, and the primer set sequences for amplifying the corresponding fused dsRNA are shown in Table 1: Sequence of the fused dsRNA (dsMelt) targeting growth and development: GACACTCATTTTGTAATTGAACTTACCTACAACTATGGAGTTGATGATTACAAACTTGGAAATGATTTCCTTGGAATAACATTAAAATCTTCAAAAGTGTTAGAAAATGCTAAATCGCTCCCGGATTGTGTGCAACTACTTGATGTTCAGCAAAAGAGGACTATTGCTAGCGTTAAAGTGAGCAAATGCCGCTACGCGATCTGGAACTCCGACATGTCGCTCGTCGCTTTACTCGGCAAACTGCCAAAACAGCCAATGAGAAGATTGAAAAGTCTTTCATAGATGGTTCGAGGTTCGCTAAAGGAACTTTAGAGAAAACTATTACTACTTCTAGGGCAGTCAGGGATTCTGTCACAAAATTAGGGATTTAGGTAGAGATAAGCAGTTTATAGTGAGTTTACCAGACGAAGAGCGCGTGGCATGGATGTGGGCGCTACTTGCCGCCTTCGCCATTCCTGAAATAGGATCTTTCATCCGATC. (SEQ ID NO.1) Fusion dsRNA (dsNerve) sequence targeting neurotransmission: TCGAGAACATTGCTGACAAAAACATCCCACCCGACTTGTCGCAATGCGTCTTTGTCATTGAACAGGCGCTGTCTGTGCGTGCCCTTCAAGAGTTAGTGACAGCGGCCGGCTCAGAGACAGGGAAAGAAAACCTAGGTAAAGGTACAGGCTCGGGGCACAGCTGTCTCTATATAAACATAGTTGTGCCGAAGCCGCGTCCCAAGAATGCGGCAGTAATGTTATGGGTGTTCGGCGGAGGGTTTTACTCCGGCACCGCTACTTTAGATGTTTATGACCCTAAAATATTGGTATCAGAAGAGAAAGTAGTTTATGTTTCAATGACCAACATTGCGACATGAAGTTTGGTAGCTGGACGTACGATGGCAACCAGTTGGATCTGGTGCTCAAAGATGAAAATGGAGGCGATTTATCAGACTTCATCACCAATGGCGAATGGTATTTGATAGGAATGCCAGGAAAAAAGAATACAATATCATACGC. (SEQ ID NO.2) Fusion dsRNA (dsHydrolase) sequence targeting hydrolase: TCCGTTGAAGGACATCAACGAACTCACGCAGTCCATCTACATCCCCAAGGGAGTGAACGTGCCCTGCCTGGCCCGTGAGACCGCGTGGGAGTTCAACCCACTTAACGTTAAGGTCGGATCGATACAACGAGCTGGTCGGAGAAATCATCCGTCTTGAGGGAGACATGGCCACCATCCAAGTATACGAGGAAACCTCAGGCGTGACTGTCGGCGACCCCGTATTGCGTACCGGCAAGCCCCCTGATATTACACTCATCAAATTGATCATCAAAAAGACAATTTGGATTTGGATTGAACTGATGCTGGCGACTGGCTCTGGGAACGATTCAGCGGTCCACCCGTTAGGCGGCGGCGGTAGCAACACGACGTGTTCAGTTTCGGAGTGGTGCTCATAGAGATGGCGACCGCGCTCCTGGCGCTCGACAGGAACCGGCCGGCCGCACTGCTCAGCGACTTCATACAGCTGCAGGCCAAGAACAT. (SEQ ID NO.3) Table 1 Primer sequences of the fusion dsRNA dsRNA Primer Name Sequence (5'-3') Fusion dsMolt dsMolt-F taatacgactcactatagggTCCGTTGAAGGACATCAACG SEQ ID NO.4 dsMolt-R taatacgactcactatagggATGTTCTTGGCCTGCAGCTG SEQ ID NO.5 Fusion dsNerve dsNerve-F taatacgactcactatagggGACACTCATTTTGTAATTGA SEQ ID NO.6 dsNerve-R taatacgactcactatagggGATCGGATGAAAGATCCTAT SEQ ID NO.7 Fusion dsHydrolase dsHydrolase-F taatacgactcactatagggTCGAGAACATTGCTGACAAA SEQ ID NO.8 dsHydrolase-R taatacgactcactatagggGCGTATGATATTGTATTCTT SEQ ID NO.9 dsCOP dsCOP-F taatacgactcactatagggACCTGAAGAACGATGTCTC SEQ ID NO.10 dsCOP-R taatacgactcactatagggTATTCAGTGGGGTCGATGT SEQ ID NO.11 T7 promoter: taatacgactcactataggg Example 2 Effects of the fusion dsRNA on the larvae of Tuta absoluta According to the synthesized fusion dsRNA sequence, 20 bp was intercepted from the front and back and the T7 promoter was added as the dsRNA primer (Table 1). Using the synthesized sequence as the template, the PCR product was amplified by PCR, purified by the agarose gel DNA recovery kit (Tiangen), and the dsRNA was synthesized and purified using the Transcript Aid T7 High Yied Transcription Kit according to the instructions.

[0022] dsRNA delivery was completed using the soaking method. Third-instar larvae of Tuta absoluta with plump morphology, consistent size, and uniform development were selected and starved for 4 h. They were placed in 1.5 mL centrifuge tubes, and the dsRNA completed by incubating with the nanomaterial CQDs was added to completely immerse the test insects. dsGFP was used as a control. 20 test insects were treated in each group, and 4 biological replicates were set. After standing for 20 min, the dsRNA in the centrifuge tube was aspirated with a pipette, and the test insects were gently transferred to fresh tomato leaves for feeding and placed in an artificial climate chamber. The larval status was observed every 24 h, and the larval mortality and pupation numbers were recorded. The results are shown in Figure 1 and Figure 2 .

[0023] As Figure 1 and Figure 2 shown, compared with the control group dsGFP, after soaking the larvae with 3 fusion dsRNAs, the survival rate and pupation number of Tuta absoluta larvae were significantly reduced.

[0024] Example 3 Effects of fusion dsRNA and single dsRNA on Tuta absoluta Specific primers were designed according to the COP sequence and the T7 promoter was added (Table 1). Using the cDNA of Tuta absoluta as a template, PCR amplification was performed, and the PCR products were purified using an agarose gel DNA recovery kit (Tiangen). dsRNA was synthesized and purified using the Transcript Aid T7 HighYied Transcription Kit. According to the above soaking method, the fusion dsMolt and single dsRNA (dsCOP) were soaked into the third-instar larvae of Tuta absoluta. The larval status was observed every 24 h, and the larval mortality was recorded. The results are shown in Figure 3 .

[0025] As Figure 3 shown, after soaking with the single dsRNA targeting COP, the mortality of Tuta absoluta was 46.67%, while after soaking with the fusion dsMolt targeting growth and development designed by the present invention, the mortality of Tuta absoluta was 97.77%, indicating that the fusion dsMolt improved the control effect on Tuta absoluta.

[0026] Example 4 Safety assessment of Nesidiocoris tenuis Three fusion dsRNAs (dsMolt, dsHydrolase, dsNerve) were mixed with 15% sucrose solution in equal volume. 10 μL of the mixed solution was dropped into a cotton ball, and the cotton ball was placed at the bottom of a 1.5 mL centrifuge tube. Single Nesidiocoris tenuis adults were picked and placed in the centrifuge tube for feeding. The dsRNA was added every 12 h. After 48 h, it was replaced with 10% sucrose solution. The survival of Nesidiocoris tenuis was counted every 24 h. The results are shown in Figure 4 and 5 .

[0027] As Figure 4 and Figure 5 shown, the three fusion dsRNAs have no effect on the survival and body weight of the predatory natural enemy Nesidiocoris tenuis of Tuta absoluta, indicating that the fusion dsRNAs designed in the present invention have no effect on non-target organisms and have good safety.

[0028] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the examples, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered within the scope of the claims of the present invention.

Claims

1. A fusion dsRNA, characterized in that: It is formed by the fusion of multiple dsRNAs targeting the same function, and its nucleic acid sequence is shown in SEQ ID NO.1, SEQ ID NO.2 and / or SEQ ID NO.

3.

2. The fusion dsRNA according to claim 1, characterized in that The fusion dsRNA shown in SEQ ID NO.1 targets growth and development related genes; The fusion dsRNA as shown in SEQ ID NO.2 targets a gene related to neurotransmission; The fusion dsRNA shown in SEQ ID NO.3 targets hydrolase-related genes.

3. A recombinant vector, characterized in that: Comprising the fusion dsRNA of claim 1 or 2.

4. A cell line, characterized in that It comprises the fusion dsRNA according to claim 1 or 2, or the recombinant vector according to claim 3.

5. An engineered bacterium, characterized in that: It comprises the fusion dsRNA according to claim 1 or 2, or the recombinant vector according to claim 3.

6. Use of the fusion dsRNA according to claim 1 or 2, the recombinant vector according to claim 3, the cell line according to claim 4 or the engineered bacteria according to claim 5 in preparing a preparation for controlling tomato leafminer.

7. A preparation for controlling tomato leafminer, characterized in that: The preparation contains the fusion dsRNA according to claim 1 as an active ingredient.

8. The preparation according to claim 7, characterized in that The preparation also includes pharmaceutically acceptable adjuvants.

9. A primer set for amplifying the fusion dsRNA according to claim 1, characterized in that: The sequences of the primer sets are shown in SEQ ID NOs. 4 to 9; wherein, Amplify the fusion dsRNA shown in SEQ ID NO. 1 using the primer set shown in SEQ ID NO. 4 and 5; The primer set shown in SEQ ID NO. 6 and 7 amplifies the fusion dsRNA shown in SEQ ID NO. 2; The primer set shown in SEQ ID NO. 8 and 9 amplified the fusion dsRNA shown in SEQ ID NO. 3.

Images