Fruit specific promoter from kiwi fruit and application thereof

Abstract

The invention provides a fruit specific promoter from kiwi fruit and application thereof, and relates to the technical field of plant genetic engineering, the fruit specific promoter is a KWL (Achv4p28g043954) gene promoter, the nucleotide sequence of the KWL (Achv4p28g043954) gene is as shown in SEQ ID NO: 1, and the nucleotide sequence of the promoter is as shown in SEQ ID NO: 2. The application of the specific promoter is to regulate and control the specific expression of a target gene in kiwi fruit tissues. The gene promoter disclosed by the invention can be applied to the specific high expression of kiwi fruit tissues, and can promote the specific expression of downstream genes in the middle development stage and the mature stage of kiwi fruits. When the gene promoter is applied to transgenic engineering, the expression level of the gene can be remarkably improved, the expression product of the target gene can be specifically accumulated in the later development period of the kiwi fruit, and meanwhile, the expression interference in other tissue parts is also avoided, so that the promoter has a good application prospect in the quality improvement and transgenic engineering of the kiwi fruit.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and particularly relates to a fruit-specific promoter derived from kiwifruit and its application. Background Art

[0002] The transgenic engineering technology in the plant field relies on promoters that drive gene expression. The choice of promoter type determines the time and location of gene expression, and the strength and specificity of the promoter are decisive factors affecting the improvement of plant traits. In previous applications of transgenic technology, two promoters, namely the 35S promoter of cauliflower mosaic virus (CaMV), i.e., CaMV35s, and the polyubiquitin protein gene Ubiquitin promoter, were often used to drive the expression of downstream genes, enabling the target gene to be expressed in plant tissue sites.

[0003] The expression driven by the strong promoters of CaMV35s and Ubi will cause the target gene to be highly expressed in all tissue sites of the plant. However, the improvement of plant traits and quality driven by these promoters may often be subject to different negative impacts. For example, the target gene is restricted by factors such as specific expression at a specific developmental stage or tissue specificity, or the growth and development of the plant are affected due to the excessive expression level of the genes induced by these constitutive promoters. For the study of fruit development, commonly used fruit-specific PG promoters and E8 promoters have been reported in tomato research. However, the most widely used promoter in current kiwifruit molecular breeding is still the CaMV35s promoter. The lack of the use of fruit-specific promoters means that in the research stage aiming at improving fruit quality and traits, the target gene driven by this constitutive promoter will not only be expressed throughout the development stage of the fruit, but also be expressed in all tissue sites other than the fruit, which interferes with the improvement of fruit quality to varying degrees and limits the research at different developmental stages of the fruit. Summary of the Invention

[0004] (1) Technical Problems to be Solved

[0005] Aiming at the deficiencies of the prior art, the promoter in current kiwifruit molecular breeding is still the CaMV35s promoter, and the CaMV35s promoter will drive the expression of all tissue sites including the fruit, resulting in interference with the improvement of fruit quality to a certain extent. The present invention provides a fruit-specific promoter derived from kiwifruit and its application, solving the technical problem that the prior art lacks a kiwifruit fruit-specific promoter to regulate the tissue-specific expression of the target gene in kiwifruit.

[0006] (2) Technical Solutions

[0007] To achieve the above objectives, the present invention is realized through the following technical solutions:

[0008] A fruit-specific promoter derived from kiwifruit, which is the promoter of the KWL (Achv4p28g043954) gene. The nucleotide sequence of the KWL (Achv4p28g043954) gene is shown in SEQ ID NO:1, and the nucleotide sequence of the promoter is shown in SEQ ID NO:2.

[0009] A primer set for amplifying the fruit-specific promoter derived from kiwifruit. The nucleotide sequence of the primer set is shown in SEQ ID NO:3-4.

[0010] A recombinant vector and an Agrobacterium transformation strain containing the fruit-specific promoter derived from kiwifruit.

[0011] A recombinant vector of the fruit-specific promoter derived from kiwifruit, which is the pBI121:GUS vector or the pRI101:RUBY vector;

[0012] The pBI121:GUS vector is a recombinant vector obtained by replacing the CaMV35s promoter sequence of the GUS gene in the pBI121 vector with the promoter sequence as described above;

[0013] The pRI101:RUBY vector is a recombinant vector obtained by replacing the CaMV35s promoter sequence of the RUBY gene in the pRI101 vector with the promoter sequence as described above.

[0014] The pBI121:GUS recombinant vector of the fruit-specific promoter derived from kiwifruit is recombined by the homologous recombination method, and the homologous recombination primers are shown in SEQ ID NO:5-6.

[0015] A method for constructing the fruit-specific promoter derived from kiwifruit, comprising the following steps:

[0016] Using the DNA of kiwifruit as a template and performing PCR amplification with the primer set shown in SEQ ID NO:3-4 to obtain the fruit-specific promoter derived from kiwifruit.

[0017] A method for transient transformation and verification in kiwifruit, including the step of transferring the Agrobacterium transformation strain of the recombinant vector of the fruit-specific promoter derived from kiwifruit into kiwifruit.

[0018] Applications of the fruit-specific promoter, primer set, recombinant vector, or Agrobacterium transformation strain derived from kiwifruit in mediating the expression regulation of downstream target genes in kiwifruit.

[0019] Preferably, the application specifically is to regulate the specific expression of the target gene in kiwifruit fruit tissues.

[0020] Preferably, the application is more specifically to regulate the high-level specific expression of target genes in the later stage of kiwifruit fruit tissue.

[0021] (III) Beneficial effects

[0022] The present invention provides a specific promoter derived from kiwifruit fruit tissue and its application. Compared with the prior art, the following beneficial effects are achieved:

[0023] The present invention clones the promoter of the KWL (Achv4p28g043954) gene from kiwifruit. This promoter can be applied to the specific high expression in kiwifruit fruit tissue, and it can initiate the specific expression of downstream genes in the mid and late stages of kiwifruit fruit development. Applying this gene promoter to transgenic engineering can significantly improve the gene expression level, enable the expression product of the target gene to specifically accumulate in the later stage of kiwifruit development, and at the same time avoid the expression interference in other tissue parts. Therefore, this promoter has good application prospects in kiwifruit quality improvement and transgenic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0025] Figure 1 It is the GUS staining verification diagram of the promoter activity of each gene in kiwifruit fruit tissue in Example 2 and Comparative Example 1 of the present invention and the blank control diagram of Comparative Example 2;

[0026] In the figure, A is the GUS staining diagram driven by the CaMV35s promoter; B is the GUS staining diagram driven by the KWL gene promoter; C is the blank control diagram after removing the CaMV35s promoter in the pBI121 vector.

[0027] Figure 2 It is the quantitative analysis diagram of the expression level of the KWL gene in different tissues of kiwifruit in Example 3 of the present invention.

[0028] Figure 3 It is the quantitative analysis diagram of the expression level in fruit tissue driven by different gene promoters in Example 3 of the present invention.

[0029] Figure 4 It is the specific verification diagram of the expression of kiwifruit leaf disc tissue and root tissue driven by different gene promoters in Example 4, Comparative Example 3 and Comparative Example 4 of the present invention;

[0030] Among them, in the figure, A is the GUS staining verification diagram driven by the CaMV35s promoter; B in the figure is the GUS staining verification diagram driven by the KWL gene promoter; C in the figure is the blank control diagram after removing the CaMV35s promoter in the pBI121 vector.

[0031] Figure 5 This is the visualization expression diagram of the RUBY gene driven by the specific KWL gene promoter in kiwifruit fruits in Example 5 of the present invention;

[0032] Among them, in the figure, A is the visualization expression diagram of the RUBY gene driven by the KWL gene promoter in kiwifruit fruits; B in the figure is the blank control group. Detailed implementation manners

[0033] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described. Obviously, the described embodiments are some but not all of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0034] In the embodiments of the present application, by providing a specific promoter derived from kiwifruit fruit tissue and its application, the CaMV35s promoter is used in the existing kiwifruit molecular breeding. The CaMV35s promoter will drive the expression of all tissue parts including fruits, resulting in a certain degree of interference in fruit quality improvement. The present invention provides a specific promoter derived from kiwifruit fruit tissue and its application, solving the technical problem in the prior art of lacking a kiwifruit fruit-specific promoter to regulate the tissue-specific expression of a target gene in kiwifruit fruit tissue.

[0035] To better understand the above technical solutions, the above technical solutions will be described in detail below in conjunction with the accompanying drawings of the specification and specific implementation manners.

[0036] The kiwifruit variety used in Examples 1-4 and Comparative Examples 1-4 of the present invention is Actinidia chinensis - Hongyang.

[0037] The kiwifruit variety used in Example 5 of the present invention is Actinidia eriantha - Huate.

[0038] Example 1: Obtaining the promoter of the kiwifruit fruit tissue-specific KWL (Achv4p28g043954) gene

[0039] 1.1 Primer design

[0040] Screen out the gene KWL (Achv4p28g043954) with high specific expression in the middle and late stages of fruit development from the Hongyang kiwifruit database. Its nucleotide sequence is shown in SEQ ID NO:1. Obtain the KWL gene sequence and clone the promoter sequence of this gene, whose nucleotide sequence is shown in SEQ ID NO:2.

[0041] Design amplification primers based on the sequence of the kiwifruit KWL (Achv4p28g043954) gene promoter. The upstream primer sequence is shown in SEQ ID NO:3, and the downstream primer sequence is shown in SEQ ID NO:4, specifically as follows:

[0042] Upstream primer (SEQ ID NO:3): (direction 5’-3’)

[0043] proKWL-F: TCTTAGACATATCTTCCGCTCATGG;

[0044] Downstream primer (SEQ ID NO:4): (direction 5’-3’)

[0045] KWL-CDS-R: TCGACCACCTTTGCAGACACG.

[0046] 1.2 PCR amplification

[0047] Perform PCR amplification using the upstream primer and downstream primer designed in step 1.1 to obtain a PCR product.

[0048] PCR reaction system (50 μL): 2×Phanta Flash Master Mix (Dye Plus) 25 μL, upstream primer 1.5 μL, downstream primer 1.5 μL, DNA template 1 μL, ddH2O 21 μL.

[0049] PCR reaction conditions: pre-denaturation at 98°C for 30 s, denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 2 min 30 s, for 32 cycles.

[0050] Recover the PCR product by agarose gel electrophoresis. The results show that a DNA fragment with a size of 2000 bp is obtained by PCR amplification. Sequence this 2000-bp DNA fragment, and its nucleotide sequence is shown in SEQ ID NO.2.

[0051] Example 2: Verification of transient expression of the GUS gene driven by the specific KWL gene promoter in kiwifruit fruit tissues

[0052] The promoter sequence of the cloned KWL gene in Example 1 was ligated into the pBI121 vector by homologous recombination to replace the conventional CaMV35s promoter and drive the expression of the GUS gene.

[0053] The homologous recombination primer sequences are shown in SEQ ID NO:5 and SEQ ID NO:6, specifically as follows:

[0054] SEQ ID NO:5: (direction 5'-3')

[0055] HRSproKWL-F: upstream homologous arm 20bp + TCTTAGACATATCTTCCGCTCATGG;

[0056] SEQ ID NO:6: (direction 5'-3')

[0057] HRSproKWL-R: downstream homologous arm 20bp + GCCTTTATATAGAAAAATACTGGTTAAC.

[0058] PCR reaction conditions: pre-denaturation at 98°C for 30 s, denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 2 min 30 s, for 32 cycles.

[0059] After successfully constructing the recombinant plasmid, it was transferred into Agrobacterium tumefaciens for expression verification. Injection points were marked around the kiwifruit. A 1 mL sterile syringe was used to aspirate the resuspended bacterial solution and inject it into the kiwifruit in the marked and arrow directions to allow the Agrobacterium cells to spread in the fruit. First, inject along the direction of the fruit's central column, and then inject around the circumference of the fruit. Start injecting when the syringe needle penetrates about 4 mm into the fruit. After each injection point, wait for a few seconds for the bacteria to spread to prevent excessive reflection of the resuspended bacterial solution. The injected fruits were placed in a box with a moist filter paper at the bottom, covered with plastic wrap for moisture retention, and then transferred to a light incubator (24°C, 16 h light / 8 h dark photoperiod) for 3 days of culture.

[0060] Prepare the GUS staining working solution. Cut the injected fruits along the marked direction, transfer them to the GUS staining working solution, place them in a vacuum pump to draw negative pressure for 10 min, and then stain overnight in a 37°C constant temperature incubator. Observe the staining results and decolorize the next day, take pictures and record. The recorded results are as Figure 1 shown.

[0061] As can be seen from Figure 1 Figure B in, after 3 days of transient expression in the fruit, strong indigo staining was shown in the fruit sections, and the staining was relatively uniform throughout the fruit tissue, with a darker color in the center of the fruit tissue.

[0062] Comparative Example 1, the difference from Example 2 is:

[0063] Using the connection of the CaMV35s promoter sequence in the pBI121 vector to drive the expression of the GUS gene as the control group, after staining, the results are as Figure 1 shown in Figure A in

[0064] As can be seen from Figure 1 Figure A in

[0065] Comparative Example 2, the difference from Example 2 is that:

[0066] Using the empty pBI121 vector without the CaMV35s promoter as the blank control group, the results after GUS gene expression staining are as Figure 1 shown in Figure C in

[0067] As can be seen from Figure 1 Figure C in Figure 1 the fruit tissue was not stained, which can be used as a blank control group to highlight Figure 1 the staining results of Figure A in

[0068] From the staining results of Example 2, Comparative Example 1, and Comparative Example 2, it can be seen that after 3 days of transient expression in the fruit, the pBI121 vector with the recombinant KWL gene promoter sequence can drive the specific expression of the GUS gene in kiwifruit fruit tissue, and the expression effect is significantly better than that driven by the CaMV35s promoter sequence.

[0069] Example 3: Quantitative analysis of the expression level of the KWL gene in different tissues of kiwifruit

[0070] 1.1 Quantitative analysis was performed on fruit samples, leaf, and root tissues of kiwifruit at 30 days, 120 days, and 180 days after pollination to verify the expression level of the KWL gene.

[0071] The primer pairs for quantitative analysis of the KWL gene expression level are shown in SEQ ID NO:7 and SEQ ID NO:8:

[0072] SEQ ID NO:7: (direction 5'-3')

[0073] qRT.KWL-F: CAACACCACCAGCCTTCCAA;

[0074] SEQ ID NO:8: (direction 5'-3')

[0075] qRT.KWL-R: TGACCGTCGCAGTCGTTTAG.

[0076] The quantitative analysis results of gene expression levels are as follows Figure 2 shown. The expression level of the KWL gene in roots and leaves is extremely low, and it remains at a relatively low level 30 days after pollination. The expression levels of the KWL gene in fruits 120 days and 180 days after pollination are approximately 10,000 times and 56,000 times that in roots and leaves, respectively. This indicates that the expression of the KWL gene is fruit tissue-specific and has a high level of expression in the late stage of fruit development.

[0077] 1.2 Quantitative analysis of fruit tissue expression levels driven by different gene promoters

[0078] Quantitative analysis was performed on the kiwifruit fruit tissues of Example 1, Comparative Example 1, and Comparative Example 2 to verify the expression levels of different genes. The results are as follows Figure 3 shown.

[0079] Figure 3 The quantitative analysis in [reference] shows that there are significant differences in the expression levels of the KWL gene promoter and the CaMV35s promoter in fruit tissues. The expression activity of the KWL gene promoter is approximately 2.6 times that of the CaMV35s promoter, indicating that the KWL gene promoter has significantly excellent expression activity in kiwifruit fruit tissues.

[0080] Example 4: Verification of the specificity of the KWL gene promoter driving the expression of different parts of kiwifruit tissues

[0081] The promoter sequence of the KWL gene was recombinantly ligated into the pBI121 vector to replace the CaMV35s promoter, driving the expression of the GUS gene. The homologous recombination primers were the same as those used in Example 2.

[0082] The vacuum infiltration inoculation method was used. After cleaning the surface of kiwifruit leaves, they were punched into round leaf discs with a diameter of 16 mm, soaked in the Agrobacterium suspension, and transferred to a vacuum pump for treatment 3 times. The negative pressure in the vacuum pump was 0.08 MPa, and the treatment time was 10 min, so that the bacterial solution entered from all around into the interior. Subsequently, the liquid on the surface of the leaves was removed with filter paper and then transferred to 1 / 2 MS solid medium and cultured at 24 °C and a light cycle of 16 h / 8 h for 3 days.

[0083] The K599 Agrobacterium carrying the recombinant vector was soaked in kiwifruit tissues and then transferred to 1 / 2 MS medium for hairy root induction.

[0084] To confirm the tissue expression pattern of the GUS gene, histochemical staining was performed. The transiently expressed leaf discs and fruit sections, as well as the induced hairy roots, were immersed in the staining buffer under vacuum for 30 min, and then incubated overnight at 37 °C. The staining time was appropriately adjusted according to the size of the tissue samples. After decolorization with ethanol, observation and photography were carried out. The results are as Figure 4 shown in Figure B of

[0085] As can be seen from Figure 4 Figure B of

[0086] After the leaf discs were stained for the GUS gene expression driven by the KWL gene promoter, a very light indigo color was presented in the leaves, indicating that the promoter activity in the leaves was extremely low, suggesting that the KWL gene promoter had almost no expression activity in the leaves.

[0087] Comparative Example 3, the difference from Example 4 is that:

[0088] Taking the expression of the GUS gene driven by the CaMV35s promoter sequence ligated in the pBI121 vector as the control group, after the leaf discs and hairy roots were stained, the results are as Figure 4 shown in Figure A of

[0089] Figure 4 Figure A of

[0090] showed that the CaMV35s promoter had good gene expression effects in the leaf discs and hairy roots. After staining, the leaf discs and hairy roots presented a relatively deep indigo color, indicating that the CaMV35s promoter had no fruit tissue expression specificity.

[0091] Comparative Example 4, the difference from Example 4 is that: Figure 4 shown in Figure C of

[0092] As can be seen from Figure 4 Figure C of Figure 4 the GUS gene without a promoter drive did not express in the leaf discs and hairy roots, and the leaf discs and hairy roots were not stained, which can be used as a blank control group to highlight Figure 4 the staining results of Figure A of

[0093] From the staining results of Example 4, Comparative Example 3, and Comparative Example 4, it can be seen that after the leaf discs were stained, the CaMV35s promoter drove strong GUS expression, resulting in obvious indigo staining. In contrast, the indigo staining of the KWL gene promoter was not obvious, indicating that the activity of the KWL gene promoter in the leaves was extremely low.

[0094] The same result was also obtained by using the hairy root-mediated rapid transformation of kiwifruit. Only the control group with the CaMV35s promoter had obvious GUS staining results, while the KWL gene promoter had almost no expression activity in the roots. Comparing again Figure 1 with the transient expression verification results in the fruit tissues, it can be concluded that the KWL gene promoter has fruit-specific expression activity.

[0095] Example 5: Visual expression of the RUBY gene driven by the specific KWL gene promoter in kiwifruit

[0096] The KWL gene promoter sequence was ligated by homologous recombination into the pRI101 vector to replace the CaMV35s promoter sequence and drive the expression of the RUBY gene. The steps of transient expression by injection into the fruits of Actinidia eriantha 'Huata' were the same as those in Example 2. After 3 days of expression culture, the kiwifruit was cut open to observe the red accumulation in the pulp. The empty vector without the CaMV35s promoter was used as the blank control group, and the results were as Figure 5 shown.

[0097] From Figure 5 it can be seen that red accumulation occurred in the kiwifruit tissue, and it was concentrated in the middle area of the fruit tissue, indicating that the KWL gene promoter had excellent expression activity in the fruit tissue.

[0098] In summary, compared with the prior art, the following beneficial effects are achieved:

[0099] 1. The promoter of the KWL (Achv4p28g043954) gene was cloned from kiwifruit in the present invention. This promoter can be applied to the high expression specific to kiwifruit fruit tissues, and it can initiate the specific expression of downstream genes in the mid-term and mature stages of kiwifruit fruit development. Applying this gene promoter to transgenic engineering can significantly improve the expression level of genes, enable the expression products of target genes to specifically accumulate in the late stage of kiwifruit development, and at the same time avoid expression interference in other tissue parts. Therefore, this promoter has good application prospects in kiwifruit quality improvement and transgenic engineering.

[0100] 2. When quantitatively analyzing the expression level of the KWL gene, the expression levels in roots, leaves, and fruits at different stages (early, middle, and late) were verified. The results showed that the expression level of the KWL gene in roots and leaves was extremely low, remaining at a relatively low level 30 days after pollination. The expression levels of the KWL gene in fruits 120 days and 180 days after pollination were approximately 10,000 times and 56,000 times higher than those in roots and leaves, respectively. This indicates that the expression of the KWL gene is fruit tissue-specific and has a high level of expression in the late stage of fruit development.

[0101] 3. After leaf disc staining, the CaMV35s promoter drove strong GUS gene expression, resulting in strong indigo staining of the leaves. In contrast, the weak indigo staining result of the KWL gene promoter indicates that the promoter has extremely low expression activity in leaves. The same result was obtained using hairy root-mediated rapid transformation of kiwifruit. Only the control driven by the CaMV35s promoter showed obvious GUS staining, while the KWL gene promoter had almost no expression activity in roots. Meanwhile, obvious color accumulation was observed in the transient expression of the KWL gene promoter in fruits, indicating that the KWL gene promoter has fruit-specific expression activity.

[0102] 4. Three days after transient expression in fruits, stronger indigo staining was shown in the fruit sections of the KWL gene promoter compared to the CaMV35s promoter. Quantitative analysis verified that the activity of the KWL gene promoter was approximately 2.6 times that of the CaMV35s promoter, indicating that the expression activity of the KWL gene promoter in fruits is superior to that of the CaMV35s promoter in fruits.

[0103] 5. The red accumulation of the RUBY gene product was significantly produced in the gene expression in fruits driven by the KWL gene promoter, further indicating that the KWL gene promoter has a high level of expression activity in fruits.

[0104] It should be noted that in this article, relational terms such as first and second are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variant thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements not only includes those elements but also includes other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. Without further limitation, an element defined by the statement "including a..." does not exclude the existence of another identical element in the process, method, article or device including the said element.

[0105] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A fruit-specific promoter derived from kiwi fruit, characterized in that: The promoter is the promoter of the KWL (Achv4p28g043954) gene, the nucleotide sequence of the KWL (Achv4p28g043954) gene is shown in SEQ ID NO:1, and the nucleotide sequence of the promoter is shown in SEQ ID NO:

2.

2. A primer set for amplifying the fruit-specific promoter derived from kiwi fruit according to claim 1, characterized in that: The nucleotide sequence of the primer set is shown in SEQ ID NO: 3-4.

3. A recombinant vector and an Agrobacterium transformation strain containing the fruit-specific promoter derived from kiwifruit according to claim 1.

4. The recombinant vector according to claim 3, characterized in that The recombinant vector is a pBI121:GUS vector or a pRI101:RUBY vector; The pBI121:GUS vector is a recombinant vector obtained by replacing the CaMV35s promoter sequence of the GUS gene in the pBI121 vector with the promoter sequence as claimed in claim 1; The pRI101:RUBY vector is a recombinant vector obtained by replacing the CaMV35s promoter sequence of the RUBY gene in the pRI101 vector with the promoter sequence as claimed in claim 1.

5. The pBI121:GUS recombinant vector according to claim 4, characterized in that The recombination was performed by homologous recombination method, and the homologous recombination primers were shown in SEQ ID NO: 5-6.

6. The method for constructing the fruit-specific promoter derived from kiwi fruit according to claim 1, characterized in that: The following steps are involved: The fruit-specific promoter derived from kiwifruit is obtained by using the DNA of kiwifruit as a template and a primer set consisting of the nucleotide sequence shown in SEQ ID NO:3-4.

7. A method for verifying transient transformation of kiwi fruit, characterized in that: The method comprises the step of transferring the Agrobacterium transformation strain of the recombinant vector according to claim 3 into kiwi fruit.

8. Use of the fruit-specific promoter derived from kiwifruit as claimed in claim 1, the primer set as claimed in claim 2, or the recombinant vector and Agrobacterium transformation strain as claimed in claim 3 to mediate expression and regulation of downstream target gene expression in kiwifruit.

9. The use according to claim 8, characterized in that: Specifically, it is to regulate the specific expression of the target gene in kiwi fruit tissue.

10. The use according to claim 9, characterized in that: Specifically, it is to regulate the high-level specific expression of the target gene in the middle and late stages of kiwi fruit tissues.

Images