Wheat TaRPM1-1A gene and application thereof in improving salt tolerance of plants
By overexpressing the TaRPM1-1A gene in wheat, the problem of insufficient salt tolerance in wheat was solved, and the salt tolerance in wheat was significantly improved under salt stress conditions was achieved, providing a new genetic resource and theoretical basis for wheat molecular breeding.
Patent Information
- Application Number
- CN202510667722.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-23
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2045-05-23
AI Technical Summary
The prior art is difficult to effectively improve the salt tolerance of wheat, resulting in limited growth of wheat under salt stress, affecting yield and quality.
By overexpressing the TaRPM1-1A gene in wheat, this gene is used to regulate plant salt tolerance and improve the stress resistance of wheat to salt stress.
Wheats overexpressing the TaRPM1-1A gene showed significant salt tolerance under salt stress conditions, including increased plant height, fresh weight and dry weight, as well as reduced relative conductivity, significantly improving the salt stress tolerance of wheat.
Smart Images

Figure CN120210232A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of plant biotechnology, and specifically relates to wheat TaRPM1-1A genes that promote salt tolerance in plants and their applications in salt tolerance. Background Art
[0002] Soil salinization is one of the main adverse stresses in agricultural production, affecting almost all important growth and development stages of plants. More than 900 million hectares of land globally (about one-third of which is agricultural irrigated land) are affected by salinization, and this problem is worsening due to the impact of climate change and human activities. Due to the poor water retention capacity and low water and fertilizer utilization efficiency of saline soils, it poses a major challenge to crop production. Wheat is one of the main food crops globally and is also the second largest cereal for human consumption. According to data from the Food and Agriculture Organization (FAO) of the United Nations, more than 80 countries produce wheat globally, and China is the largest wheat producer in the world. In the past 20 years (2000 - 2020), the wheat output exceeded 2.4 billion tons, accounting for about 17% of the global total output. However, due to the lack of salt-tolerant wheat varieties in production, the yield and quality of wheat are severely restricted. Conducting research on the molecular mechanism of wheat salt tolerance, exploring salt-tolerant genes for wheat molecular breeding, and improving the salt tolerance of wheat are important strategies to ensure food security and sustainable agricultural development.
[0003] Currently, different RPM1 genes have been identified in wheat, such as TaRPM1 (TraesCS3D03G0966600) located on 3D may be related to powdery mildew resistance, TaRPM1 (TraesCS1A03G0059400) located on 1A plays a positive regulatory role in the process of wheat resistance to stripe rust at high temperature through the salicylic acid signaling pathway, TaRPM1 (TraesCSC2D01G059100) located on 2D regulates leaf senescence, TaRPM1-7BL (TraesCS7B03G0850400) located on 7B negatively regulates the frost resistance of wheat. However, there is no report on TaRPM1 salt tolerance research.
[0004] Therefore, identifying wheat TaRPM1-1A genes and exploring their functions in regulating salt stress are of great significance for improving the ability of crops to resist salt stress and crop genetic improvement. Summary of the Invention
[0005] To solve the above technical problems, the present invention aims to clarify the TaRPM1-1A application of genes in promoting salt tolerance in wheat.
[0006] To achieve the above object, the present invention adopts the following technical solutions: In the first aspect of the present invention, a wheat gene promoting plant salt tolerance is provided. TaRPM1-1A The TaRPM1-1A nucleotide sequence of the gene is shown as SEQ ID NO:1.
[0007] By overexpressing the TaRPM1-1A gene in wheat, the salt tolerance of transgenic plants is improved; the plants include wheat.
[0008] In the research of the present invention, it is found that under salt stress treatment conditions, compared with wild-type Fielder wheat, the phenotype of the wheat overexpressing the TaRPM1-1A gene is better than that of wild-type Fielder wheat. Therefore, the applicant speculates that the TaRPM1- 1A gene has a certain stress resistance to salt stress, providing a theoretical basis for using TaRPM1-1A for wheat salt tolerance improvement.
[0009] In the second aspect of the present invention, an overexpression vector is provided, and the overexpression vector contains the TaRPM1-1A gene.
[0010] In another preferred embodiment, the overexpression vector is obtained by constructing the pCAMBIA3300 overexpression vector plasmid using the Gateway method with the TaRPM1-1A gene.
[0011] In the third aspect of the present invention, an engineered bacterium containing the overexpression vector is provided.
[0012] In another preferred embodiment, the overexpression vector is obtained by transferring the overexpression vector into Agrobacterium competent cells.
[0013] The engineered bacterium can be understood as the engineered bacterium used by those skilled in the art in the transgenic process, such as Agrobacterium competent cell EHA105. However, with the development of technology, the selection of the engineered bacterium may change, or in non-transgenic application fields, the use of vectors and engineered bacteria is also involved, but as long as it contains the gene or the vector of the present invention, it is within the protection scope of the present invention.
[0014] In the fourth aspect of the present invention, the application of the overexpression vector in cultivating salt-tolerant transgenic plants is provided. Compared with the wild type, the salt tolerance of transgenic plants is improved.
[0015] In another preferred embodiment, the plants include wheat.
[0016] The fifth aspect of the present invention provides the application of the overexpression vector in promoting salt tolerance of plants, and the plants include wheat.
[0017] The sixth aspect of the present invention provides the application of the engineered bacteria in promoting salt tolerance of plants, and the plants include wheat.
[0018] The method for improving the salt tolerance of wheat provided by the present invention specifically includes cloning of the target gene, construction of the overexpression vector of the target gene, transformation of Agrobacterium tumefaciens with the target gene, transformation of wheat with the target gene, identification of positive strains, and phenotypic observation to determine salt-tolerant materials.
[0019] Compared with the prior art, the present invention has the following beneficial effects: The present invention first discovers the role of overexpressing TaRPM1-1A gene in regulating the salt tolerance of wheat. The present invention transforms the overexpression of TaRPM1-1A gene into wheat for functional verification. The results show that the salt tolerance of wheat overexpressing TaRPM1-1A gene is significantly improved compared with that of wild-type Fielder wheat. Therefore, TaRPM1-1A gene plays a positive regulatory role in the process of wheat salt tolerance, providing a theoretical basis and gene resources for wheat molecular breeding, and having very important significance for future wheat salt tolerance breeding and production. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 It is a phenotypic diagram of overexpressing wheat before and after salt stress treatment.
[0021] Figure 2 It is a phenotypic statistical chart of overexpressing wheat before and after salt stress treatment, where A is the plant height chart, B is the fresh weight chart, C is the dry weight chart, and D is the relative conductivity chart.
[0022] Figure 3 It is a physiological index diagram of wheat leaves before and after salt stress treatment. Among them, A is the POD activity diagram, B is the SOD activity diagram, C is the CAT activity diagram, D is the MDA content diagram, E is the proline content diagram, and F is the soluble sugar content diagram. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0023] Next, in combination with the specific implementation of the present invention, the technical solutions in the present invention will be clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0024] The present invention provides TaRPM1-1A a new use of the gene, and the TaRPM1-1AThe nucleotide sequence of the gene is shown in SEQ ID NO.1:
[0025] The amino acid sequence of TaRPM1-1A protein is shown in SEQ ID NO.2: MAEAILLAVSKIGAVILNEAVFAVIDKLSRKVDNLKELPAKIKRINTELNTMNDVIQHLGTTQLSNKVINGWIGNVRKLAYHVEDVIDKYSYEALKLKDEGFLDRYIFRGSRHIKVFSKIAEEVVELEEEIRHVKGLRDYWSDAVQPAKNGHAEIDRQRSGGCFPEHVSDKDLVGIDENRSKLTEWLTTNENESTVITVSGMGGLGKTTLVKNVYDREKTNFPDAHAWIVVSQAYDVVDLLKTLLTKIHDTQESPPPSPLRAGAKPHVYELTGAIKKILQDRKCLIVLDDVWDKEAYSQMFTAFRDLQGCRVMITTRKEDVAALAPPRRRLVLQPLGSVESFKLFCSRAFHNSLDHNCPPELHAVATAIVERCRGLPLAIVSSGSLLSRKQPAEHAWNDVYNHLRSELRGDNHVQAILNLSYHDLPGDLTNCFLYCSLFREDYAMSRENLVRLWVAEGFAMKKDDSTPEEVAEGYLMELIGRNMLEVVERDELFGVSTCKMHDLVRDLALAVAKEERFGSASDQSEVKDMDKEVRRFSTCGWRDNMAAAPEVEFPRLRTVISLSPALSSTNMISSVLSGSNYLTVLELQDSAIVQVPESIGNLFNLRYIGLRRTKVQSLPDTIEKLSNLETLDVKQTRIEKLPPGIVKVERLRHLLADKFADEKQVEFRYFVGVEALKKLSNFKELQTLETVHASKDLPLQLKEMKELRTVWIDNINGSNCDDLFKTLSDRPQLSSLLLSACDVKETISFQALKPVSKNFHRLIIRGGWADGTLNCPIFQGHGKNLKYLALSWCDLGSEDPLELLATHLPALTYLTLNKVRCAGALVLSAGCFPQLKTLVLKNMLDVKKLDILEGAIPYIDGIYIMSLSELSTVPCGIEALGSLKKLWMLYLHKGFKDDWDQKEMHNRMKHVLELRA。
[0026] Example 1: TaRPM1-1A Cloning of Genes Using Qingmai 6 as the material, when the wheat grows to the two-leaf and one-heart stage, use forceps to remove 1 g of wheat leaves, and extract RNA using a plant RNA extraction kit, which is purchased from Aikrui Biotech Co., Ltd. The specific method is as follows.
[0027] 1. Lysis of Plant Tissues (1) Transfer the fresh plant tissue sample to a mortar pre-cooled with liquid nitrogen, and grind the plant tissue in the mortar until it becomes powdery, adding liquid nitrogen continuously during the grinding process.
[0028] (2) Transfer 100 mg of the powdered sample to a 1.5 mL sterile and enzyme-free centrifuge tube containing 500 μL of lysis buffer, and ensure that there are no obvious visible particles. Among them, confirm that 50× reducing agent has been added to the lysis buffer before use.
[0029] (3) Let the above lysis buffer stand at room temperature for 2 minutes, then centrifuge at 12000 rpm and 4 °C for 5 minutes.
[0030] (4) Carefully pipette the supernatant into a new 1.5 mL sterile and enzyme-free centrifuge tube.
[0031] 2. Purification (1) Add 250 μL of absolute ethanol to the above lysis buffer, and pipette to mix well. If obvious viscous substances or precipitates appear, pipette several times to disperse the precipitates.
[0032] (2) Transfer all of the above mixture and precipitate to a plant RNA filter column, centrifuge at 12000 rpm at room temperature for 2 minutes, and discard the filtrate.
[0033] (3) Add 600 μL of buffer RWA to the plant RNA filter column, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate.
[0034] (4) Add 750 μL of buffer RWB to the plant RNA filter column, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate.
[0035] (5) Deoxyribonuclease Ⅰ digestion: Prepare deoxyribonuclease Ⅰ, that is, DNase l reaction solution according to Table 1 and mix well. Add 50 μL of the DNase l reaction solution to the center of the membrane of the Plant RNAMini Column, let it stand at room temperature for 15 minutes, add 350 μL of buffer RWB to the center of the membrane of the above plant RNA filter column, and centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate.
[0036] Table 1 Reaction System Component Dosage Deoxyribonuclease I 4 μL 10× Deoxyribonuclease I Buffer 5 μL Sterile water 41 μL (6) Add 750 μL of buffer RWB to the plant RNA filter column, centrifuge at 12,000 rpm for 1 minute at room temperature, and discard the filtrate.
[0037] (7) Place the adsorption column of the plant RNA filter column on a new 2.0 mL collection tube and centrifuge at 12,000 rpm for 2 minutes at room temperature.
[0038] (8) Place the adsorption column of the plant RNA filter column on a new filter column, add 70 μL of sterile water to the center of the adsorption column membrane, let it stand at room temperature for 5 minutes, and then centrifuge at 12,000 rpm for 2 minutes at room temperature to elute the RNA, which can be used for subsequent experiments. If the subsequent experiments are not to be carried out immediately, the dissolved RNA can be stored at -80 °C.
[0039] 3. Reverse transcribe the RNA into cDNA using a cDNA synthesis kit, and the cDNA synthesis kit was purchased from Aikrui Biotech Co., Ltd. The specific steps are as follows.
[0040] (1) Prepare the RNA template solution on ice according to Table 2, place it in a PCR instrument for denaturation and annealing reactions. The denaturation and annealing reaction conditions are 65 °C for 5 min; store at 4 °C.
[0041] Table 2 RNA template solution Component Dosage 50 μM Reverse transcription primer 1 μL 50 μM Random primer 1 μL 10 mM each dNTP Mix 1 μL RNA template 7 μL (2) Prepare the reverse transcription reaction system according to Table 3 to synthesize cDNA.
[0042] Table 3 Reverse transcription reaction system Component Dosage The above reaction solution after denaturation and annealing 10 μL 5× RTase Reaction Buffer 4 μL RNase Inhibitor 0.5 μL Reverse transcriptase 1 μL Sterile water 4.5 μL The reaction conditions for synthesizing cDNA are shown in Table 4.
[0043] Table 4 Reaction conditions for synthesizing cDNA Temperature Time 30 ℃ 10 min 42 ℃ 50 min 95 ℃ 5 min 4 ℃ ∞ Design gene-specific primers as shown in Table 5 below, and amplify the full-length coding frame using cDNA as a template, and ligate it into the intermediate vector pEASY. The specific method is as follows. TaRPM1-1A of the full-length coding frame, and ligate it into the intermediate vector pEASY. The specific method is as follows.
[0044] Table 5 Gene-specific primers Primer Nucleotide sequence Number TaRPM1-1A-F 5′- ATGGCAGAGGCTATACTGCTCG -3′ SEQ ID NO.3 TaRPM1-1A-R 5′- CTAGGCACGGAGCTCTAGAACA -3′ SEQ ID NO.4 The cloning reaction system is shown in Table 6.
[0045] Table 6 Cloning reaction system Component Dosage PCR product 4 μL DEASy®-T&B Zero Cloning Vector 1 μL Gently mix, react at 37 °C for 15 minutes. After the reaction is completed, place the centrifuge tube on ice to obtain the ligation product.
[0046] (3)Transformation.
[0047] S1. Add the ligation product to 100 μL of E. coli competent cells. Add the ligation product when the E. coli competent cells are just thawed. Gently flick to mix and incubate on ice for 30 minutes.
[0048] S2. Heat shock in a 42 °C water bath for 45 seconds and immediately place on ice for 3 minutes.
[0049] S3. Add 700 mL of LB liquid medium and culture at 200 rpm and 37 °C for 1 hour.
[0050] S4. Centrifuge at 5000 rpm for 3 minutes, discard 700 mL of the supernatant, take 100 μL of the bacterial solution and spread it on a plate, and place it in a 37 °C incubator for 16 h; Pick 10 monoclonal colonies on the plate into 700 mL of LB liquid medium and culture at 200 rpm and 37 °C for 6 hours. After successful sequencing, extract the plasmid for standby, and name the plasmid pESAY:TaRPM1-1A.
[0051] Example 2: TaRPM1-1A Construction of gene overexpression vector Construct using the Gateway method TaRPM1-1A The overexpression vector pCAMBIA3300:TaRPM1-1A of the gene. The specific steps are as follows.
[0052] (1)Design primers with homologous recombination arms, as shown in Table 7.
[0053] Table 7 Gene-specific primers Primer Nucleotide sequence Number OE-TaRPM1-1A-F 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGCAGAGGCTATACTGCTC -3′ SEQ ID NO.5 OE-TaRPM1-1A-R 5′- GGGGACCACTTTGTACAAGAAAGCTGGGTGCTAGGCACGGAGCTCTAGAAC -3′ SEQ ID NO.6 (2)Using the pESAY:TaRPM1-1A plasmid obtained in Example 1 as a template, amplify the sequence using high-fidelity enzyme TaRPM1- 1A as shown in Table 8.
[0054] Table 8 TaRPM1-1A Amplification system Component name Added amount KOD OneTM PCR Master Mix 25 μL pESAY:TaRPM1-1A 5 µL OE-TaRPM1-1A-F 2 µL OE-TaRPM1-1A-R 2 µL <![CDATA[ddH2O]]> 16 µL Detect the PCR amplification product by 1% agarose gel electrophoresis, perform gel recovery and purification on the target product, and measure the concentration of the recovered product.
[0055] (3)Use Gateway BP Clonase II enzyme mix (Invitrogen, USA) to perform a BP recombination reaction on the gene recovery product with known concentration and the pDONR(Zeo) entry vector. The reaction system is shown in Table 9.
[0056] Table 9 BP Recombination Reaction System Component name Dosage Gateway BP Clonase II enzyme mix 2 μL PCR product 2 μL pDONR(Zeo) Entry vector (Youbao Biotechnology, product number VT1519) 1 μL TE buffer (pH = 8.0) 5 μL React at 25 °C for 4 h, add 1 μL of Proteinase K, continue to react at 37 °C for 10 min. Immediately transform the reaction product into competent Escherichia coli DH5α cells, coat it on LB solid medium with bleomycin resistance, culture at 37 °C for about 16 h, pick monoclonal colonies, shake the bacteria, perform colony PCR, send the bacterial liquid of positive clones to the company for sequencing. Expand the monoclonal colonies with correct sequencing, preserve the bacterial liquid with glycerol and extract and preserve the plasmid. Name the plasmid pDONR(Zeo): TaRPM1-1A.
[0057] (4)Use Gateway LR Clonase II enzyme mix (Invitrogen, USA) to perform LR recombination reaction on the above-mentioned pDONR(Zeo): TaRPM1-1A plasmid with known concentration and the target vector pCAMBIA3300. The LR recombination reaction system is shown in Table 10.
[0058] Table 10 LR Recombination Reaction System Component name Dosage Gateway LR Clonase II enzyme mix 2 μL pDONR(Zeo): TaRPM1-1A 1 μL pCAMBIA3300 1 μL TE buffer (pH = 8.0) 6 μL React at 25 °C for 4 h, add 1 μL of Proteinase K, continue to react at 37 °C for 10 min. Immediately transform the reaction product into competent Escherichia coli DH5α cells, coat it on LB solid medium with kanamycin resistance, culture at 37 °C for about 16 h, pick monoclonal colonies, shake the bacteria, perform colony PCR, send the bacterial liquid with the target band to the company for sequencing. Expand the monoclonal colonies with correct sequencing, preserve the bacterial liquid with glycerol and extract and preserve the plasmid. Name the plasmid pCAMBIA3300:TaRPM1-1A.
[0059] Example 3: Overexpression TaRPM1-1A Construction of Transgenic Lines 1. Transformation of Agrobacterium
[0060] Transfer the successfully constructed pCAMBIA3300:TaRPM1-1A plasmid into Agrobacterium competent EHA105 by electroporation. After PCR identification of positive colonies, expand and shake the correct bacterial liquid for standby.
[0061] 2. Genetic Transformation of Wheat Immature Embryos Culture the Agrobacterium bacterial liquid in a shaker (28 °C, 200 rpm, 12 h) until the OD of the Agrobacterium bacterial liquid 600= 0.6, and then centrifuge the bacterial solution (5000 rpm, 10 min) to separate the supernatant and obtain the sedimented Agrobacterium. Then, dropwise add solutions of acetosyringone (200 μmol / L) and the PE / F68 mixture onto each scutellum, with a dropwise addition volume of 10 μl. Wait for the solution to completely evaporate for 20 min to complete the Agrobacterium infection. Transfer the immature embryos to the callus induction medium and culture for 3 days. After 2 weeks of callus induction culture, select the best immature embryos and place them in the medium to promote their differentiation and regeneration. In addition, we can also select the bright yellow embryogenic callus and continue the screening culture. After 2 weeks of green shoot culture, transfer them to the rooting medium to promote the healthy growth of the seedlings. After the roots are fully developed, take out the seedlings with established roots, wash off the medium, and transfer them to a plastic culture pot containing vermiculite and nutrient substrate, and grow them in an artificial climate chamber (22°C / 18°C, day / night) until the seeds are harvested.
[0062] 3. Verification of positive transgenic wheat seedlings TaRPM1-1A Verify the positive transgenic wheat seedlings Extract the DNA of wild-type Fielder wheat and transgenic wheat leaves at the seedling stage using the CTAB method. Use the DNA of wild-type Fielder wheat as the negative control and the pCAMBIA3300:TaRPM1-1A plasmid as the positive control to verify whether the vector carrying the target fragment has been transferred into the wheat genome. Select the plants with positive DNA verification, extract the leaf RNA and reverse transcribe it. Taking the expression level of the TaRPM1-1A gene in wild-type Fielder wheat as a reference, verify the expression level of the TaRPM1-1A gene by fluorescence quantitative PCR. Select three lines with relatively high expression levels, OE1-TaRPM1-1A, OE2-TaRPM1-1A, and OE3-TaRPM1-1A, and continuously breed them until the T3 generation seeds are harvested. The primers used for positive seedling verification are shown in Table 11.
[0063] Table 11 Primers for positive seedling verification Primer Nucleotide sequence Number pCAMBIA3300-TaRPM1-1A-F 5'- CTAGGATAGGTATACATGTTGATGCGGG-3' SEQ ID NO.7 pCAMBIA3300-TaRPM1-1A-R 5'- ACCGGAACTCCACCTGCTTCTCGTCAG-3' SEQ ID NO.8 RT-TaRPM1-1A-F 5'- ATGAGAACGAAAGCACAGTG -3' SEQ ID NO.9 RT-TaRPM1-1A-R 5'- GTAGCTCAGATTAAGTATAG -3' SEQ ID NO.10 TaActinF 5'- TTGCTGACCGTATGAGCAAG -3' SEQ ID NO.11 TaActinR 5'- ACCCTCCAATCCAGACACTG -3' SEQ ID NO.12
[0064] Example 4: Salt tolerance identification of transgenic wheat Respectively take the overexpressed TaRPM1-1AGenes and seeds of wild-type Fielder wheat were disinfected with 75% ethanol for 15 min, washed 3 - 5 times with distilled water, and sown in 1 L plastic pots containing an equal amount of nutrient substrate (peat: perlite: vermiculite = 3:1:1). Each pot was watered equally to maintain the soil humidity at about 80%. Four seedlings were thinned per pot on the 7th day after germination and then continued to be cultured in an incubator (22 °C / 18 °C, day / night). When the seedlings reached the two-leaf and one-heart stage, salt stress treatment was started. The treatment group was applied with an equal amount of salt treatment solution (300 mM NaCl) per pot, while the control group was watered with an equal volume of water, and replenished every 3 days. On the 10th day of treatment, the plants were observed and photographed, the plant height, fresh weight, and dry weight were measured, and the conductivity was measured using a conductivity meter (DDSJ-308A, Shanghai). There were 3 biological replicates, and the results were as Figure 1 and Figure 2 shown.
[0065] From Figure 1 and Figure 2 it can be seen that after 10 days of salt stress treatment, TaRPM1-1A the plant height, fresh weight, and dry weight of the overexpressed wheat lines in the aboveground part were significantly higher than those of wild-type Fielder wheat, and the relative electrical conductivity of the leaves was significantly lower than that of wild-type Fielder wheat.
[0066] After 10 days of salt stress treatment, wheat leaves were taken to measure the following physiological indexes: superoxide dismutase activity, peroxidase activity, catalase activity, malondialdehyde content, proline content, and soluble sugar content. The results were as Figure 3 shown. Among them, superoxide dismutase was denoted as POD, catalase was denoted as SOD, peroxidase was denoted as CAT, and malondialdehyde was denoted as MDA.
[0067] From Figure 3 it can be seen that after salt stress treatment, the superoxide dismutase activity, peroxidase activity, catalase activity, proline content, and soluble sugar content of OE1-TaRPM1-1A, OE2-TaRPM1-1A, and OE3-TaRPM1-1A were all higher than those of wild-type Fielder wheat, and the malondialdehyde content was significantly lower than that of wild-type Fielder wheat. Thus, it can be seen that TaRPM1-1A the gene has certain stress resistance to salt stress.
[0068] Example 5: TaRPM1-1A Application of the gene in genetic improvement breeding of wheat salt tolerance In production practice, the above gene can also be used to enhance the efficiency and accuracy of breeding goals through molecular marker-assisted selection breeding methods. For example, molecular markers are used to associate the target gene with the salt tolerance trait of wheat, and by detecting the presence of the target gene, the purpose of selecting the target trait is achieved.
[0069] In the present invention, it has been found that TaRPM1-1A the function and specific application of the TaRPM1-1A gene in regulating plant salt tolerance provide new gene resources for wheat salt-tolerant breeding and also lay a foundation for further analyzing
[0070] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they learn the basic creative concept. Obviously, those skilled in the art can make various changes and deformations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and deformations of the present invention fall within the scope of the equivalent technology of the present invention, the present invention also intends to include these changes and deformations.
Claims
1. A kind of wheat TaRPM1-1A gene, characterized in that The said TaRPM1-1A The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
2. The wheat according to claim 1 TaRPM1-1A The protein encoded by the gene, characterized in that The protein has the amino acid sequence shown in SEQ ID NO:
2.
3. An overexpression vector, characterized in that, It includes the gene described in claim 1 TaRPM1-1A gene.
4. An engineered bacterium containing the overexpression vector described in claim 3.
5. Use of the wheat according to claim 1 TaRPM1-1A in enhancing the salt tolerance of plants.
6. The application according to claim 5, wherein The plant includes one of wheat and corn.
7. Use of the overexpression vector described in claim 3 in improving the salt tolerance of plants.
8. Use of the engineered bacterium described in claim 4 in improving the salt tolerance of plants.
9. A method for improving the salt tolerance of plants, characterized in that The overexpression vector described in claim 3 or the engineered bacterium described in claim 4 mediates plant genetic transformation by means of genetic engineering, and the obtained transgenic plant thus improves the salt tolerance of the plant.
Citation Information
Patent Citations
High-flux method for cloning plant disease-resistant gene
CN103805595A
Wheat salt-tolerant gene TaNAS1 and application thereof
CN104513825A
Protein kinase in arabidopsis thaliana, coding gene and application of coding gene
CN105039279A
KASP primer for detecting powdery mildew resistance gene PmBMYD in wheat adult-plant stage and application of KASP primer
CN113025745A
Corn VPS23 similar gene ZmVPS23L and application thereof
CN115927394A