Wheat ta rpm1-1a gene and application thereof in improving plant salt tolerance

Abstract

This invention relates to the field of plant biotechnology, specifically to the wheat TaRPM1-1A gene and its application in improving plant salt tolerance. TaRPM1-1A The nucleotide sequence of the gene is shown in SEQ ID NO:1. This invention will... TaRPM1-1A Functional studies were conducted on gene overexpression transfected into Fielder wheat, and the results showed that overexpression... TaRPM1-1A Genetically modified wheat exhibits significantly improved salt tolerance compared to Fielder wheat, therefore TaRPM1-1A Genes play a positive regulatory role in wheat salt tolerance, providing a theoretical basis and gene resources for wheat molecular breeding, and are of great significance for future wheat salt tolerance breeding and production.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant biotechnology, in particular to a wheat TaRPM1-1A gene and its application in salt tolerance. BACKGROUND

[0002] Soil salinization is one of the major abiotic stresses in agricultural production, which affects almost all important growth and development stages of plants. More than 900 million hectares of land worldwide (about 1 / 3 of which is agricultural irrigation land) are affected by salinization, which is worsening due to climate change and human activities. Saline soils have poor water retention capacity and low water and fertilizer use efficiency, posing a major challenge to crop production. Wheat is one of the major food crops in the world and also the second most important grain for human consumption. According to the Food and Agriculture Organization (FAO), there are more than 80 countries in the world that produce wheat, and China is the world's largest wheat producer, with wheat production exceeding 2.4 billion tons in the past 20 years (2000-2020), accounting for about 17% of the world's total production. However, the lack of salt-tolerant wheat varieties in production has severely restricted the yield and quality of wheat. Therefore, it is an important strategy to ensure food security and sustainable agricultural development to study the molecular mechanism of wheat salt tolerance and to explore salt-tolerant genes for wheat molecular breeding to improve wheat salt tolerance.

[0003] Currently, different RPM1 genes have been identified in wheat, such as TaRPM1 (TraesCS3D03G0966600) located on 3D, which may be related to powdery mildew resistance, and TaRPM1 (TraesCS1A03G0059400) located on 1A, which plays a positive regulatory role in wheat high-temperature resistance to stripe rust through the salicylic acid signaling pathway, and TaRPM1 (TraesCSC2D01G059100) located on 2D, which regulates leaf senescence, and TaRPM1-7BL (TraesCS7B03G0850400) located on 7B, which negatively regulates the frost resistance of wheat. However, there is no report on TaRPM1 salt tolerance.

[0004] Therefore, identifying wheat TaRPM1-1A genes and exploring their functions in regulating salt stress is of great significance for improving the ability of crops to resist salt stress and genetic improvement of crops. SUMMARY

[0005] To solve the above technical problems, the present application aims to clarify the application of TaRPM1-1A gene in promoting wheat salt tolerance.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The first aspect of this invention provides a wheat that promotes plant salt tolerance. TaRPM1-1A Genes, the ones mentioned TaRPM1-1A The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0008] By overexpressing the above in wheat TaRPM1-1A Genes that enhance the salt tolerance of transgenic plants; the plants include wheat.

[0009] This invention found in its research that, under salt stress conditions, compared with wild-type Fielder wheat, after... TaRPM1-1A The phenotypic performance of wheat with overexpressed genes was superior to that of wild-type Fielder wheat. Therefore, the applicant speculated... TaRPM1- 1A The gene has a certain resistance to salt stress, which is beneficial for utilization. TaRPM1-1A This provides a theoretical basis for improving the salt tolerance of wheat.

[0010] A second aspect of the present invention provides an overexpression vector, the overexpression vector comprising the... TaRPM1-1A Gene.

[0011] In another preferred embodiment, the overexpression vector is the vector containing the... TaRPM1-1A The gene was constructed using the Gateway method to obtain the pCAMBIA3300 overexpression vector plasmid.

[0012] A third aspect of the present invention provides engineered bacteria comprising the overexpression vector.

[0013] In another preferred embodiment, the overexpression vector is obtained by transfecting the overexpression vector into Agrobacterium competent cells.

[0014] The engineered bacteria mentioned can be understood as those used by those skilled in the art in the process of transgenic research, such as Agrobacterium competent cells EHA105. However, with the development of technology, the selection of engineered bacteria may change, or the application fields for non-transgenic purposes may also involve the use of vectors and engineered bacteria, but any application containing the gene or vector described in this invention is within the scope of protection of this invention.

[0015] The fourth aspect of this invention provides the application of the overexpression vector in the cultivation of salt-tolerant transgenic plants, which exhibit improved salt tolerance compared to wild-type plants.

[0016] In another preferred embodiment, the plant includes wheat.

[0017] The fifth aspect of the present application provides the use of the overexpression vector in promoting the salt tolerance of plants, and the plants include wheat.

[0018] The sixth aspect of the present application provides the use of the engineering bacteria in promoting the salt tolerance of plants, and the plants include wheat.

[0019] The method for improving the salt tolerance of wheat provided by the present application specifically comprises the following steps: cloning of a target gene, construction of an overexpression vector of the target gene, transformation of the target gene into Agrobacterium, transformation of the target gene into wheat, identification of positive lines, phenotype observation, and determination of salt-tolerant materials.

[0020] Compared with the prior art, the present application has the following beneficial effects:

[0021] The present application first discovers the role of overexpression of the gene in regulating the salt tolerance of wheat. TaRPM1-1A The present application transforms the overexpression of the gene into wheat for function verification, and the results show that the salt tolerance of the wheat overexpressing the gene is significantly improved compared with the wild type Fielder wheat. TaRPM1-1A Therefore, the gene plays a positive regulation role in the process of wheat salt tolerance, and provides a theoretical basis and gene resources for wheat molecular breeding. TaRPM1-1A TaRPM1-1A The present application has very important significance for wheat salt-tolerant breeding and production in the future. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 The figure is the phenotype of the overexpression wheat before and after salt stress treatment.

[0023] Figure 2 The figure is the phenotype statistics of the overexpression wheat before and after salt stress treatment, wherein A is a plant height graph, B is a fresh weight graph, C is a dry weight graph, and D is a relative conductivity graph.

[0024] Figure 3 The figure is the physiological index graph of the wheat leaves before and after salt stress treatment, wherein A is a POD activity graph, B is a SOD activity graph, C is a CAT activity graph, D is a MDA content graph, E is a proline content graph, and F is a soluble sugar content graph. DETAILED DESCRIPTION

[0025] The technical solutions in the present application will be clearly and completely described below with the specific embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.

[0026] The present application provides a new use of the gene. TaRPM1-1A The present application provides a new use of the gene. TaRPM1-1A ​The nucleotide sequence of the gene is shown in SEQ ID NO. 1 :

[0027]

[0028] The amino acid sequence of the TaRPM1-1A protein is shown in SEQ ID NO. 2:

[0029] MAEAILLAVSKIGAVILNEAVFAVIDKLSRKVDNLKELPAKIKRINTELNTMNDVIQHLGTTQLSNKVINGWIGNVRKLAYHVEDVIDKYSYEALKLKDEGFLDRYIFRGSRHIKVFSKIAEEVVELEEEIRHVKGLRDYWSDAVQPAKNGHAEIDRQRSGGCFPEHVSDKDLVGIDENRSKLTEWLTTNENESTVITVSGMGGLGKTTLVKNVYDREKTNFPDAHAWIVVSQAYDVVDLLKTLLTKIHDTQESPPPSPLRAGAKPHVYELTGAIKKILQDRKCLIVLDDVWDKEAYSQMFTAFRDLQGCRVMITTRKEDVAALAPPRRRLVLQPLGSVESFKLFCSRAFHNSLDHNCPPELHAVATAIVERCRGLPLAIVSSGSLLSRKQPAEHAWNDVYNHLRSELRGDNHVQAILNLSYHDLPGDLTNCFLYCSLFREDYAMSRENLVRLWVAEGFAMKKDDSTPEEVAEGYLMELIGRNMLEVVERDELFGVSTCKMHDLVRDLALAVAKEERFGSASDQSEVKDMDKEVRRFSTCGWRDNMAAAPEVEFPRLRTVISLSPALSSTNMISSVLSGSNYLTVLELQDSAIVQVPESIGNLFNLRYIGLRRTKVQSLPDTIEKLSNLETLDVKQTRIEKLPPGIVKVERLRHLLADKFADEKQVEFRYFVGVEALKKLSNFKELQTLETVHASKDLPLQLKEMKELRTVWIDNINGSNCDDLFKTLSDRPQLSSLLLSACDVKETISFQALKPVSKNFHRLIIRGGWADGTLNCPIFQGHGKNLKYLALSWCDLGSEDPLELLATHLPALTYLTLNKVRCAGALVLSAGCFPQLKTLVLKNMLDVKKLDILEGAIPYIDGIYIMSLSELSTVPCGIEALGSLKKLWMLYLHKGFKDDWDQKEMHNRMKHVLELRA.

[0030] Example 1: TaRPM1-1A Cloning of the gene

[0031] Take Qingmai No. 6 as the material, when the wheat grows to the two-leaf one-heart stage, take 1 g of wheat leaves with tweezers, and extract RNA with a plant RNA extraction kit, which is purchased from Aikuerui Biological Company. The specific method is as follows.

[0032] 1. Lysis of plant tissue

[0033] (1) Transfer the fresh plant tissue sample to a mortar pre-cooled with liquid nitrogen, and grind the plant tissue until it is powdered, with the addition of liquid nitrogen during the grinding process.

[0034] (2) Transfer 100 mg of the powdered sample to a 1.5 mL sterile and enzyme-free centrifuge tube containing 500 μL of lysis solution, and ensure that there are no obvious visible particles. Wherein, confirm that the 50x reducing agent has been added to the lysis solution before use.

[0035] (3) After the above lysis solution is placed at room temperature for 2 minutes, centrifuge at 12000 rpm and 4°C for 5 minutes.

[0036] (4) Carefully pipette the supernatant into a new 1.5 mL sterile and enzyme-free centrifuge tube.

[0037] 2. Purification

[0038] (1) Add 250 μL of anhydrous ethanol to the above lysis solution, mix well with a pipette gun, and if obvious sticky or precipitate appears, use the pipette gun to blow and disperse the precipitate several times.

[0039] (2) Transfer the above mixture and precipitate to a plant RNA filter column, centrifuge at 12000 rpm and room temperature for 2 minutes, and discard the filtrate.

[0040] (3) Add 600 μL of buffer RWA to the plant RNA filter column, centrifuge at 12000 rpm and room temperature for 1 minute, and discard the filtrate.

[0041] (4) Add 750 μL of buffer RBW to the plant RNA filter column, centrifuge at 12000 rpm and room temperature for 1 minute, and discard the filtrate.

[0042] (5) DNase I digestion: Prepare DNase I according to Table 1, i.e. DNase I reaction solution and mix well. Add 50 μL of DNase I reaction solution to the center of the membrane of the Plant RNA Mini Column, and let it stand at room temperature for 15 minutes. Add 350 μL of buffer RBW to the center of the membrane of the above plant RNA filter column, centrifuge at 12000 rpm and room temperature for 1 minute, and discard the filtrate.

[0043] Table 1 Reaction system

[0044] Component Amount Deoxyribonuclease I 4 μL 10 x Deoxyribonuclease I buffer 5 μL Sterile water 41 μL

[0045] (6) Add 750 μL of buffer RWB to the plant RNA filter column, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate.

[0046] (7) Place the adsorption column of the plant RNA filter column on a new 2.0 mL collection tube, centrifuge at 12000 rpm at room temperature for 2 minutes.

[0047] (8) Place the adsorption column of the plant RNA filter column on a new filter column, add 70 μL of sterile water at the center of the adsorption column membrane, stand at room temperature for 5 minutes, and then centrifuge at 12000 rpm at room temperature for 2 minutes to elute the RNA, which can be used for subsequent experiments. If the subsequent experiments are not performed immediately, the dissolved RNA can be stored in -80 °C.

[0048] 3. Reverse transcribe the RNA into cDNA using a cDNA synthesis kit, which is purchased from Aikangrui Biological Company, and the specific steps are as follows.

[0049] (1) Prepare the RNA template solution according to Table 2 on ice, and perform denaturation and annealing reaction in a PCR instrument, the denaturation and annealing reaction conditions are 65 °C, 5 min; 4 °C storage.

[0050] Table 2 RNA template solution

[0051] Component Amount 50 μM reverse transcription primer 1 μL 50 μM random primer 1 μL 10 mM each dNTP mix 1 μL Ribonucleic acid template 7 μL

[0052] (2) Prepare the reverse transcription reaction system according to Table 3 to synthesize cDNA.

[0053] Table 3 Reverse transcription reaction system

[0054] Component Amount Reaction solution after denaturation and annealing above 10 μL 5 x RTase reaction buffer 4 μL RNase inhibitor 0.5 μL Reverse transcriptase 1 μL Sterile water 4.5 μL

[0055] The cDNA synthesis reaction conditions are shown in Table 4.

[0056] Table 4 cDNA synthesis reaction conditions

[0057] Temperature Time 30 ℃ 10 min 42 ℃ 50 min 95 ℃ 5 min 4 ℃ ∞

[0058] Design gene-specific primers, as shown in Table 5 below, to amplify the full-length coding frame with cDNA as the template, and connect into the intermediate vector pEASY, and the specific method is as follows. TaRPM1-1A

[0059] Table 5 Gene-specific primers

[0060] Primer Nucleotide sequence Number TaRPM1-1A-F 5'- ATGGCAGAGGCTATACTGCTCG -3' SEQ ID NO. 3 TaRPM1-1A-R 5'- CTAGGCACGGAGCTCTAGAACA -3' SEQ ID NO. 4

[0061] The cloning reaction system is shown in Table 6.​

[0062] Table 6 Cloning reaction system

[0063] Component Amount PCR product 4 μL DEASy®-T&B Zero Cloning Vector 1 μL

[0064] Gently mix, react for 15 minutes at 37°C, after the reaction, place the centrifuge tube on ice to obtain the ligation product.

[0065] (3) Transformation.

[0066] S1, add the ligation product to 100 μL of E. coli competent cells, add the ligation product when the E. coli competent cells are just thawed, gently mix, and ice bath for 30 minutes.

[0067] S2, heat shock at 42°C for 45 seconds, immediately place on ice for 3 minutes.

[0068] S3, add 700 mL of LB liquid medium, cultivate at 200 rpm and 37°C for 1 hour.

[0069] S4, centrifuge at 5000 rpm for 3 minutes, discard 700 mL of supernatant, take 100 μL of bacterial solution to plate, and place in a 37°C incubator to cultivate for 16 hours; pick 10 single colonies on the plate to 700 mL of LB liquid medium, cultivate at 200 rpm and 37°C for 6 hours, extract the plasmid after sequencing success, and name the plasmid as pESAY:TaRPM1-1A.

[0070] Example 2: TaRPM1-1A Construction of gene overexpression vector

[0071] Gateway method is used to construct TaRPM1-1A Gene overexpression vector pCAMBIA3300:TaRPM1-1A. The specific steps are as follows.

[0072] (1) Design primers with homologous recombination arms, as shown in Table 7.

[0073] Table 7 Gene-specific primers

[0074] Primer Nucleotide sequence Number OE-TaRPM1-1A-F 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGCAGAGGCTATACTGCTC -3' SEQ ID NO. 5 OE-TaRPM1-1A-R 5'- GGGGACCACTTTGTACAAGAAAGCTGGGTGCTAGGCACGGAGCTCTAGAAC -3' SEQ ID NO. 6

[0075] (2) Take the pESAY:TaRPM1-1A plasmid obtained in Example 1 as a template, and use high-fidelity enzyme to amplify the sequence as shown in Table 8. TaRPM1- 1A

[0076] Table 8 TaRPM1-1A Amplification system

[0077] Component name Amount added KOD OneTM PCR Master Mix 25 μL pESAY:TaRPM1-1A 5 µL OE-TaRPM1-1A-F 2 µL OE-TaRPM1-1A-R 2 µL ddH2O 16 µL ​

[0078] The PCR amplification product was detected by 1% agarose gel electrophoresis, the target product was recovered and purified, and the concentration of the recovered product was measured.

[0079] (3) The known concentration of the gene recovery product was subjected to BP recombination reaction with the pDONR(Zeo) entry vector by using Gateway BP Clonase II enzyme mix (Invitrogen, USA), and the reaction system is shown in Table 9.

[0080] Table 9 BP recombination reaction system

[0081] Component name Amount Gateway BP Clonase II enzyme mix 2 μL PCR product 2 μL pDONR(Zeo)entry vector (OriGene, Cat. No. VT1519) 1 μL TE buffer (pH = 8.0) 5 μL

[0082] 25 ℃ reaction for 4 h, 1 μL of Proteinase K was added, and the reaction was continued at 37 ℃ for 10 min. The reaction product was immediately transformed into E. coli DH5α competent cells, coated with LB solid medium resistant to kanamycin, and cultured at 37 ℃ for about 16 h. Single colonies were picked and shaken, and bacterial liquid PCR was performed. The bacterial liquid of the positive clone was sent to the company for sequencing. The single colony with correct sequencing was expanded, and the bacterial liquid glycerol and plasmid were preserved. The plasmid was named pDONR(Zeo): TaRPM1-1A.

[0083] (4) The known concentration of the pDONR(Zeo): TaRPM1-1A plasmid was subjected to LR recombination reaction with the target vector pCAMBIA3300 by using Gateway LR Clonase II enzyme mix (Invitrogen, USA), and the LR recombination reaction system is shown in Table 10.

[0084] Table 10 LR recombination reaction system

[0085] Component name Amount Gateway LR Clonase II enzyme mix 2 μL pDONR(Zeo): TaRPM1-1A 1 μL pCAMBIA3300 1 μL TE buffer (pH=8.0) 6 μL

[0086] 25 ℃ reaction for 4 h, 1 μL of Proteinase K was added, and the reaction was continued at 37 ℃ for 10 min. The reaction product was immediately transformed into E. coli DH5α competent cells, coated with LB solid medium resistant to kanamycin, and cultured at 37 ℃ for about 16 h. Single colonies were picked and shaken, and bacterial liquid PCR was performed. The bacterial liquid of the positive clone was sent to the company for sequencing. The single colony with correct sequencing was expanded, and the bacterial liquid glycerol and plasmid were preserved. The plasmid was named pCAMBIA3300:TaRPM1-1A.

[0087] Example 3: Overexpression TaRPM1-1A Construction of transgenic lines

[0088] 1. Transformation of Agrobacterium.

[0089] The successfully constructed pCAMBIA3300:TaRPM1-1A plasmid was transformed into Agrobacterium competent EHA105 by electroporation. After positive colonies were identified by PCR, the correct bacterial liquid was expanded and reserved.

[0090] 2. Genetic transformation of wheat immature embryos

[0091] The Agrobacterium liquid was cultured in a shaker (28℃, 200 rpm, 12 h). When the OD 600 of the Agrobacterium liquid reached 0.6, the liquid was centrifuged (5000 rpm, 10 min) to separate the supernatant and the Agrobacterium that sank. Then, 10 μl of a solution of acetosyringone (200 μmol / L) and PE / F68 mixture was dropped onto each shield. After 20 min when the solution was completely evaporated, the Agrobacterium was infected. The immature embryos were transferred to induction medium for 3 days. After 2 weeks of induction and callus culture, the best immature embryos were selected and placed in medium to promote their differentiation and regeneration. In addition, yellowish embryogenic calli were selected and further screened. After 2 weeks of green bud culture, the green buds were transferred to rooting medium to promote the healthy growth of seedlings. After the root system was fully developed, the seedlings with roots were taken out, washed of the medium, and transferred to plastic culture pots containing vermiculite and nutrient medium for growth in an artificial climate chamber (22℃ / 18℃, day / night) until the seeds were harvested.

[0092] 3. Positive seedling verification of transgenic wheat TaRPM1-1A

[0093] DNA of the wild-type Fielder wheat was used as a negative control, and the pCAMBIA3300:TaRPM1-1A plasmid was used as a positive control to verify whether the vector carrying the target fragment was transferred into the wheat genome. The plants with positive DNA verification were selected, and the leaf RNA was extracted and reverse transcribed. The expression level of the TaRPM1-1A gene in the wild-type Fielder wheat was used as a reference to verify the expression level of the TaRPM1-1A gene by fluorescent quantitative PCR. Three strains OE1-TaRPM1-1A, OE2-TaRPM1-1A, and OE3-TaRPM1-1A with relatively high expression levels were selected for further breeding until the T3 generation seeds were harvested. The primers used for positive seedling verification are shown in Table 11. TaRPM1-1A TaRPM1-1A

[0094] Table 11 Primers for positive seedling verification

[0095] Primer Nucleotide sequence No. pCAMBIA3300-TaRPM1-1A-F 5'- CTAGGATAGGTATACATGTTGATGCGGG-3' SEQ ID NO. 7 pCAMBIA3300-TaRPM1-1A-R 5'- ACCGGAACTCCACCTGCTTCTCGTCAG-3' SEQ ID NO. 8 RT-TaRPM1-1A-F 5'- ATGAGAACGAAAGCACAGTG -3' SEQ ID NO. 9 RT-TaRPM1-1A-R 5'- GTAGCTCAGATTAAGTATAG -3' SEQ ID NO. 10 TaActinF 5'- TTGCTGACCGTATGAGCAAG -3' SEQ ID NO. 11 TaActinR 5'- ACCCTCCAATCCAGACACTG -3' SEQ ID NO. 12 ​​​

[0096] Example 4: Transgenic wheat salt tolerance identification

[0097] The seeds of overexpression TaRPM1-1A of the gene and wild type Fielder wheat were taken respectively, sterilized with 75% alcohol for 15 min, washed with distilled water for 3-5 times, and sowed in 1 L plastic pots containing equal amount of nutrient medium (peat: perlite: vermiculite = 3: 1: 1), and each pot was watered with equal amount of water to keep the soil humidity about 80%. Four seedlings were fixed in each pot on the 7th day of germination, and placed in a incubator for continuous culture (22 ℃ / 18 ℃, day / night). When the seedlings reached the two-leaf-one-heart stage, salt stress treatment was started, and equal amount of salt treatment solution (300 mM NaCl) was applied to each pot in the treatment group, and equal volume of water was applied to the control group, and the water was replenished every 3 days. On the 10th day of treatment, the plants were observed and photographed, the plant height, fresh weight and dry weight were measured, and the conductivity was measured using a conductivity meter (DDSJ-308A, Shanghai), and the results of three biological replicates are shown in Figure 1 and Figure 2 .

[0098] It can be seen from Figure 1 and Figure 2 that after 10 days of salt stress treatment, TaRPM1-1A the plant height, fresh weight and dry weight of the overexpression wheat lines were significantly higher than those of the wild type Fielder wheat, and the leaf relative conductivity was significantly lower than that of the wild type Fielder wheat.

[0099] After 10 days of salt stress treatment, the leaves of wheat were taken to measure the following physiological indexes: superoxide dismutase activity, peroxidase activity, catalase activity, malondialdehyde content, proline content, and soluble sugar content, and the results are shown in Figure 3 . Among them, superoxide dismutase is denoted as POD, catalase is denoted as SOD, peroxidase is denoted as CAT, and malondialdehyde is denoted as MDA.

[0100] It can be seen from Figure 3 that after salt stress treatment, the superoxide dismutase activity, peroxidase activity, catalase activity, proline content, and soluble sugar content of OE1-TaRPM1-1A, OE2-TaRPM1-1A and OE3-TaRPM1-1A were higher than those of the wild type Fielder wheat, and the malondialdehyde content was significantly lower than that of the wild type Fielder wheat, so it can be seen that TaRPM1-1A the gene has certain stress resistance to salt stress.

[0101] Example 5: TaRPM1-1A Application of the gene in wheat salt tolerance genetic improvement breeding

[0102] In the production practice, the above-mentioned genes can also be used to enhance the efficiency and accuracy of breeding objectives by the method of molecular marker assisted selection breeding. For example, the objective gene is associated with the salt tolerance trait of wheat by using molecular markers, and the objective trait is selected by detecting the presence of the objective gene.

[0103] In the present application, it is found that TaRPM1-1A The function of the gene in regulating plant salt tolerance and the specific application provide a new gene resource for wheat salt tolerance breeding, and lay a foundation for further analyzing TaRPM1-1A The molecular mechanism of regulating plant salt tolerance.

[0104] Although the preferred embodiments of the present application have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic inventive concept. Obviously, those skilled in the art can make various modifications and variations to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application belong to the scope of equivalent technologies of the present application, the present application also intends to include these modifications and variations.

Claims

1. Application of the wheat TaRPM1-1A gene in improving wheat salt tolerance, wherein the nucleotide sequence of the TaRPM1-1A gene is shown in SEQ ID NO:

1.

2. The application of the wheat TaRPM1-1A gene overexpression vector as described in claim 1 in improving wheat salt tolerance.

3. The application of engineered bacteria containing the overexpression vector of claim 2 in improving the salt tolerance of wheat.

4. A method for improving the salt tolerance of wheat, characterized in that, The overexpression vector of claim 2 or the engineered bacteria of claim 3, through genetic engineering methods, mediate plant genetic transformation to obtain transgenic wheat, thereby improving the salt tolerance of wheat.

Images