Application of GhEB1C gene in verticillium wilt resistance of plants

Abstract

The invention provides an application of a GhEB1C gene in plant verticillium wilt resistance, and particularly provides an application of the GhEB1C gene in regulation and control of plant verticillium wilt resistance. When the GhEB1C gene in the plant is over-expressed, the verticillium wilt resistance of the plant is enhanced, and when the expression quantity of the GhEB1C gene in the plant is low or the GhEB1C gene in the plant is not expressed, the verticillium wilt resistance of the plant is weakened. The new research finds that not only is the understanding of the plant immune system enriched, but also the development of more effective disease-resistant measures and strategies is facilitated, and a more prospective and sustainable solution can be provided for plant protection and agricultural production by deeply researching the correlation between the terminal binding protein and the plant verticillium wilt resistance.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to the application of the GhEB1C gene in plant resistance to Verticillium wilt. Background Art

[0002] Cotton, as one of the most important economic crops globally, is a major source of income for farmers worldwide due to its wide range of applications. However, cotton production has been plagued by a serious problem, namely cotton Verticillium wilt. This disease is caused by a microorganism called Verticillium dahliae (V. dahliae), which is mainly transmitted through the soil. In field cultivation, the incidence of cotton Verticillium wilt is very high, and the severity of the disease is worrying, which has caused great harm to cotton yield and fiber quality. Research has shown that cotton responds to V. dahliae infection through various physiological and biochemical reactions, including changes in tissue structure, accumulation of antifungal substances, reactive oxygen species (ROS) homeostasis, calcium ion (Ca 2+ )-induced signal transduction, mitogen-activated protein kinase (MAPK) cascade, hormone signal transduction, and microbe-associated molecular pattern-triggered immunity (PTI / ETI), which provides strong guidance for finding new disease-resistant genes and breeding.

[0003] Plants have unique microtubules (MTs), cortical MTs, mitotic spindles, and phragmoplasts during evolution. These MT arrays control the direction of cell division and expansion and are crucial for plant morphogenesis and development. The EB1 protein family, as microtubule plus-end tracking proteins, belongs to the MT arrays and plays an important role in cell biological processes. End-binding protein 1C (EB1C) is a microtubule plus-end tracking protein that plays a key role in plant cells. Microtubules, as components of the cytoskeleton, are involved in multiple key processes of cells, including cell shape maintenance, cell division, cell polarity, and intracellular material transport, but there has been no research on plant disease resistance. Summary of the Invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art to some extent.

[0005] To explore the relationship between the end-binding protein and plant resistance to Verticillium wilt, the inventors identified and phylogenetically analyzed the members of the end-binding protein 1 family related to Verticillium wilt resistance, screened GhEB1C through transcriptome, and experimentally characterized the role of the GhEB1C gene in cotton against V. dahliae. The research results showed that GhEB1C was most highly expressed in leaves and its expression level increased significantly after infection with V. dahliae. Overexpression of the GhEB1C gene in tobacco showed that these transgenic plants had enhanced disease resistance to V. dahliae. Conversely, silencing the GhEB1C gene in cotton by VIGS reduced the resistance to V. dahliae. Generally speaking, the present invention reveals the relationship between the GhEB1C gene and cotton resistance to V. dahliae, providing important clues and information for further studying the adaptation mechanism of plants when resisting pathogen invasion.

[0006] Therefore, in the first aspect of the present invention, the present invention proposes the use of the GhEB1C gene in regulating plant resistance to Verticillium wilt. Through a large number of experiments, the inventors found that there is a special relationship between the GhEB1C gene and plant resistance to Verticillium wilt, that is, when the expression level of the GhEB1C gene in plants is relatively high, the role of plant resistance to Verticillium wilt is enhanced, and when the expression level of the GhEB1C gene in plants is relatively low or not expressed, the role of plant resistance to Verticillium wilt is weakened. This new research finding not only enriches the understanding of the plant immune system, but also provides more forward-looking and sustainable solutions for plant protection by deeply studying the association between the end-binding protein and plant resistance to Verticillium wilt.

[0007] According to an embodiment of the present invention, the use may further include at least one of the following additional technical features:

[0008] According to an embodiment of the present invention, the protein expressed by the GhEB1C gene has the amino acid sequence shown in SEQ ID NO: 1.

[0009] According to an embodiment of the present invention, the plant is selected from cotton, Arabidopsis thaliana, rice, corn, wheat, sorghum, barley, oats, rye, soybeans, tobacco, rapeseed, tomatoes.

[0010] In the second aspect of the present invention, the present invention proposes the use of a reagent in enhancing plant resistance to Verticillium wilt, and the reagent is used to enhance the activity or expression level of the GhEB1C gene. As mentioned above, overexpression of the GhEB1C gene can enhance the role of plant resistance to Verticillium wilt, so a reagent that can enhance the activity or expression level of the GhEB1C gene also has the effect of enhancing plant resistance to Verticillium wilt.

[0011] According to an embodiment of the present invention, the use may further include at least one of the following additional technical features:

[0012] According to an embodiment of the present invention, the reagent includes salicylic acid or a plasmid for overexpressing the GhEB1C gene.

[0013] According to an embodiment of the present invention, the salicylic acid is selected from methyl salicylate.

[0014] According to an embodiment of the present invention, the plasmid has the nucleotide sequence shown in SEQ ID NO:2.

[0015] In the third aspect of the present invention, the present invention proposes the use of a reagent in reducing the resistance of plants to Verticillium wilt, and the reagent is used to reduce the activity or expression level of the GhEB1C gene. As described above, reducing the expression level of the GhEB1C gene in plants can reduce the resistance of plants to Verticillium wilt. Therefore, a reagent that can reduce the activity or expression level of the GhEB1C gene can also reduce the resistance of plants to Verticillium wilt.

[0016] According to an embodiment of the present invention, the use may further include at least one of the following additional technical features:

[0017] According to an embodiment of the present invention, the reagent includes jasmonic acid or a plasmid for silencing or knocking out the GhEB1C gene.

[0018] According to an embodiment of the present invention, the plasmid includes, but is not limited to, siRNA, shRNA or Cas-sgRNA targeting the GhEB1C gene, and the VIGS (Virus-Induced Gene Silencing) technology can also be used to silence the GhEB1C gene.

[0019] According to an embodiment of the present invention, the jasmonic acid is selected from methyl jasmonate.

[0020] In the fourth aspect of the present invention, the present invention proposes the use of salicylic acid in increasing the expression level of the GhEB1C gene in plants. The inventors found in experiments that by exogenously applying salicylic acid, the expression level of the GhEB1C gene in plants can be significantly increased, thereby effectively enhancing the resistance of plants to Verticillium wilt. This discovery provides a more effective and sustainable solution for developing new plant Verticillium wilt control approaches.

[0021] In the fifth aspect of the present invention, the present invention proposes the use of jasmonic acid in reducing the expression level of the GhEB1C gene in plants.

[0022] In the sixth aspect of the present invention, the present invention provides a method for preparing transgenic plants. According to an embodiment of the present invention, the method includes: transforming the plant to be constructed with Agrobacterium carrying the GhEB1C gene. By adopting the method of the present invention, transgenic plants with high disease resistance can be successfully obtained, providing a new approach for improving the resistance of plants to Verticillium wilt. By introducing the GhEB1C gene into transgenic plants, the defense ability of plants against Verticillium wilt pathogens is effectively enhanced, providing new prospects and hopes for solving important disease problems such as Verticillium wilt.

[0023] According to an embodiment of the present invention, the method for preparing transgenic plants may further include at least one of the following additional technical features:

[0024] According to an embodiment of the present invention, the method further includes: culturing the transformed plant to be constructed to obtain the transgenic plant.

[0025] According to an embodiment of the present invention, the Agrobacterium carrying the GhEB1C gene is obtained by introducing a plasmid carrying the GhEB1C gene into the Agrobacterium to be transfected.

[0026] According to an embodiment of the present invention, the plasmid has the nucleotide sequence shown in SEQ ID NO:2.

[0027] According to an embodiment of the present invention, the plant is selected from cotton, Arabidopsis thaliana, rice, corn, wheat, sorghum, barley, oats, rye, soybeans, tobacco, rapeseed, tomatoes.

[0028] In the seventh aspect of the present invention, the present invention provides a method for improving the resistance of plants to Verticillium wilt. According to an embodiment of the present invention, the method includes: increasing the expression level of the GhEB1C gene in the plant. As described above, overexpression of the GhEB1C gene helps to improve the resistance of plants to Verticillium wilt. Therefore, by adopting the method of the present invention, the defense ability of plants against Verticillium wilt pathogens can be effectively enhanced, providing new prospects and hopes for solving important disease problems such as Verticillium wilt.

[0029] According to an embodiment of the present invention, the method for preparing to improve the resistance of plants to Verticillium wilt may further include at least one of the following additional technical features:

[0030] According to an embodiment of the present invention, the increase in the expression level of the GhEB1C gene in the plant is carried out in the following manner: transforming the plant to be treated with Agrobacterium carrying the GhEB1C gene; or spraying salicylic acid on the plant.

[0031] According to an embodiment of the present invention, the method further includes: culturing the processed plant to be transformed to obtain the transgenic plant, thereby increasing the expression level of the GhEB1C gene in the plant.

[0032] According to an embodiment of the present invention, the Agrobacterium carrying the GhEB1C gene is obtained by introducing a plasmid carrying the GhEB1C gene into the Agrobacterium to be transfected.

[0033] According to an embodiment of the present invention, the plasmid has the nucleotide sequence shown in SEQ ID NO:2.

[0034] According to an embodiment of the present invention, the salicylic acid is methyl salicylic acid.

[0035] According to an embodiment of the present invention, the plant is selected from cotton, Arabidopsis thaliana, rice, corn, wheat, sorghum, barley, oats, rye, soybean, tobacco, rape, tomato.

[0036] Additional aspects and advantages of the present invention will be given in part in the following description, become apparent in part from the following description, or be learned through the practice of the present invention. Brief Description of the Drawings

[0037] The above and / or additional aspects and advantages of the present invention will become apparent and be readily understood from the description of the embodiments in conjunction with the following drawings, wherein:

[0038] Figure 1 is a phylogenetic tree diagram of GhEB1C according to an embodiment of the present invention;

[0039] Figure 2 is a promoter cis-element analysis diagram according to an embodiment of the present invention;

[0040] Figure 3 is an expression level diagram of GhEB1C in cotton and a subcellular localization diagram of GhEB1C according to an embodiment of the present invention, wherein:

[0041] Figure 3 A is an expression level diagram of GhEB1C in the roots, stems and leaves of cotton;

[0042] Figure 3 B is an expression level diagram of GhEB1C at 0h, 3h, 6h, 12h, 24h, 72h, 120h after infecting with V. dahliae;

[0043] Figure 3 C is the subcellular localization of GhEB1C in transiently transformed Arabidopsis mesophyll protoplasts, and images are taken using bright field, fluorescence and merged, with a scale bar of 5μm;

[0044] Figure 4It is a result graph showing that overexpression of GhEB1C according to an embodiment of the present invention increases the resistance of tobacco to Verticillium dahliae, where:

[0045] Figure 4 A is the transformation process of tobacco after inoculating 20-day-old tobacco with Verticillium dahliae Vd592;

[0046] Figure 4 B is the result graph of verifying transgenic lines by PCR;

[0047] Figure 4 C is the phenotypic graph of transgenic tobacco 15 days after inoculation;

[0048] Figure 4 D is the expression level graph of GhEB1C in transgenic lines and wild type verified by RT-qPCR;

[0049] Figure 4 E is the disease index of transgenic tobacco 15 days after inoculation;

[0050] Figure 5 It is a result graph showing that silencing GhEB1C in cotton according to an embodiment of the present invention reduces the resistance of plants to Verticillium dahliae, where:

[0051] Figure 5 A is the albino phenotype graph of TRV:GhCLA 1 15 days after VIGS;

[0052] Figure 5 B is the graph of detecting the silencing efficiency of GhEB1C by RT-qPCR;

[0053] Figure 5 C is the Verticillium wilt phenotype graph of TRV:00 plants and TRV:GhEB1C plants 25 days after inoculation;

[0054] Figure 5 D is the disease index graph of different varieties 25 days after inoculation;

[0055] Figure 5 E is the isolation graph of Verticillium dahliae from TRV:00 plants and TRV:GhEB1C plants;

[0056] Figure 5 F is the trypan blue staining graph of the first true leaves of TRV:00 plants and TRV:GhEB1C plants;

[0057] Figure 5 G is the longitudinal section graph of the stem segments of TRV:00 plants and TRV:GhEB1C plants;

[0058] Figure 6 It is a graph for verifying differential genes in transcriptomics analysis according to an embodiment of the present invention;

[0059] Figure 7 It is a GO enrichment map of transcriptomics analysis according to an embodiment of the present invention;

[0060] Figure 8 It is a KEGG enrichment map of transcriptomics analysis according to an embodiment of the present invention;

[0061] Figure 9 It is a diagram of the analysis of the expression levels of disease-resistant related genes in the transcriptome according to an embodiment of the present invention;

[0062] Figure 10 It is a result diagram of the influence of GhEB1C on SA and JA signaling pathways according to an embodiment of the present invention, wherein:

[0063] Figure 10 A is the expression levels of the GhEB1C gene at 0, 6, 12, and 48 h after treatment with MeSA and MeJA;

[0064] Figure 10 B is the contents of JA and SA in the leaves of TRV:00 plants and TRV:GhEB1C plants at 48 h after infection with V. dahliae;

[0065] The values are the mean and standard deviation (SD). Error bars represent the SD of three biological replicates. Asterisks indicate significant correlation at the 0.01 level (two-tailed). All experiments were repeated at least three times. Detailed implementation manners

[0066] The embodiments of the present invention are described in detail below. The following described embodiments are exemplary and are only used to explain the present invention, and should not be construed as a limitation to the present invention.

[0067] It should be noted that the terms "first" and "second" are only used for descriptive purposes and cannot be construed as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. Thus, the features defined with "first" and "second" may explicitly or implicitly include one or more of such features. Further, in the description of the present invention, unless otherwise stated, the meaning of "a plurality" is two or more.

[0068] In this article, the term "containing", "comprising" or "including" is an open expression, that is, it includes the content specified by the present invention, but does not exclude other aspects of the content.

[0069] In this article, the terms "optionally", "optional" or "option" generally mean that the subsequent described event or condition may or may not occur, and this description includes the situation where the event or condition occurs, and the situation where the event or condition does not occur.

[0070] The present invention provides the use of the GhEB1C gene in regulating the Verticillium wilt resistance of plants, the use of a reagent in enhancing / reducing the Verticillium wilt resistance of plants, the use of salicylic acid / jasmonic acid in increasing / decreasing the expression level of the GhEB1C gene in plants, a method for preparing transgenic plants, and a method for enhancing the Verticillium wilt resistance of plants, which will be described in detail below respectively.

[0071] Use

[0072] The present invention provides the use of the GhEB1C gene in regulating the Verticillium wilt resistance of plants. Through a large number of experiments, the inventors found that there is a special relationship between the GhEB1C gene and the Verticillium wilt resistance of plants, that is, when the expression level of the GhEB1C gene in plants is relatively high, the Verticillium wilt resistance of plants is enhanced, and when the expression level of the GhEB1C gene in plants is relatively low, the Verticillium wilt resistance of plants is weakened. This new research finding not only enriches the understanding of the plant immune system, but also helps to develop more effective disease resistance measures and strategies. By deeply studying the association between the end-binding protein and the Verticillium wilt resistance of plants, more forward-looking and sustainable solutions can be provided for plant protection.

[0073] It should be noted that the "regulation" described in the present invention can refer to either enhancement or reduction. When the GhEB1C gene is overexpressed in plants, the Verticillium wilt resistance of plants can be enhanced; when the GhEB1C gene is silenced in plants, the Verticillium wilt resistance of plants can be reduced.

[0074] According to the embodiments of the present invention, the use may further include at least one of the following additional technical features:

[0075] According to the embodiments of the present invention, the protein expressed by the GhEB1C gene has the amino acid sequence shown in SEQ ID NO:1.

[0076] MATNIGMMDGAYFVGRSEILAWINTTLHLNLSKVEEACSGAVHCQLMDSVHPGMVPMHKVNFDAKSEYEMIQNYKVLQDVFNKLKITKHIEVSKLVKGRPLDNLEFMQWMKRYCDSVNGGGLHSYNPVERREASKGGKEASKKSAPQPSSTKGSTAAPRPTSSHARRNSNDVPSSVNPSNQPAKAPSKPSTSVAAYDEQITELKLSVDSLEKERDFYFAKLRDIEILCQTPEIEDSPIVAAIKRILYATDGDASVVTEAQAMLSLDPKEAEALSPIAEASEEKSGSETQKRKNILNTDVDAAGIITLSPRQRLTDASDVHCSGSPLMTY(SEQ ID NO:1)

[0077] The present invention provides the use of a reagent in enhancing the Verticillium wilt resistance of plants, and the reagent is used to enhance the activity or expression level of the GhEB1C gene. As described above, overexpression of the GhEB1C gene can enhance the Verticillium wilt resistance of plants. Therefore, a reagent that can enhance the activity or expression level of the GhEB1C gene can also enhance the Verticillium wilt resistance of plants.

[0078] According to the embodiments of the present invention, the use may further include at least one of the following additional technical features:

[0079] According to the embodiments of the present invention, the reagent includes salicylic acid or a plasmid for overexpressing the GhEB1C gene.

[0080] According to the embodiments of the present invention, the salicylic acid is selected from, but not limited to, methyl salicylic acid.

[0081] According to the embodiments of the present invention, the plasmid has the nucleotide sequence shown in SEQ ID NO:2.

[0082] ATGGCGACGAACATCGGAATGATGGACGGTGCTTATTTCGTCGGCAGATCTGAGATCCTTGCTTGGATCAACACCACTCTCCATCTCAATCTCTCCAAAGTAGAAGAGGCATGTTCTGGTGCCGTTCACTGTCAGTTGATGGATTCGGTTCATCCAGGGATGGTGCCGATGCACAAAGTCAATTTCGATGCCAAGAGCGAATACGAGATGATCCAGAATTACAAAGTGCTTCAAGATGTCTTTAACAAACTCAAAATCACCAAGCATATTGAGGTGAGCAAGCTGGTGAAAGGAAGACCGCTTGATAATCTGGAGTTCATGCAATGGATGAAAAGATACTGTGATTCGGTTAATGGAGGCGGTCTTCATAGTTACAATCCAGTAGAAAGGAGAGAAGCTTCTAAGGGAGGAAAAGAAGCAAGCAAGAAATCAGCACCACAACCATCCTCAACCAAGGGTTCAACTGCTGCTCCTAGACCTACATCTTCCCATGCTCGAAGGAACAGCAACGATGTTCCTTCATCCGTGAACCCTTCTAATCAACCAGCAAAGGCACCATCCAAACCATCTACATCAGTGGCTGCGTATGATGAACAGATTACTGAGTTGAAGCTATCTGTGGATAGTCTTGAGAAAGAGAGGGATTTTTACTTTGCAAAATTGAGAGACATTGAGATTCTCTGCCAGACACCCGAAATCGAAGACTCCCCGATTGTTGCAGCTATCAAAAGAATTTTATATGCTACAGATGGCGACGCATCGGTAGTGACTGAAGCTCAAGCCATGCTGTCACTTGACCCCAAGGAAGCAGAGGCATTGAGTCCAATTGCTGAGGCATCGGAAGAGAAATCTGGTTCTGAGACCCAGAAGAGGAAAAACATTTTGAACACTGATGTAGATGCTGCCGGAATCATAACCTTGTCTCCAAGGCAAAGGCTTACTGATGCTTCTGATGTTCACTGCAGTGGGTCACCTCTAATGACTTATTAA(SEQ IDNO:2)

[0083] The present invention provides the use of a reagent in reducing the resistance of plants to Verticillium wilt, and the reagent is used to reduce the activity or expression level of the GhEB1C gene. As described above, reducing the expression level of the GhEB1C gene in plants can reduce the resistance of plants to Verticillium wilt. Therefore, a reagent that can reduce the activity or expression level of the GhEB1C gene can also reduce the resistance of plants to Verticillium wilt.

[0084] According to an embodiment of the present invention, the use may further include at least one of the following additional technical features:

[0085] According to an embodiment of the present invention, the reagent includes jasmonic acid or a plasmid for silencing or knocking out the GhEB1C gene.

[0086] According to an embodiment of the present invention, the plasmid includes, but is not limited to, siRNA, shRNA, or Cas-sgRNA targeting the GhEB1C gene, and the VIGS (Virus-Induced Gene Silencing) technology can also be used to silence the GhEB1C gene.

[0087] According to an embodiment of the present invention, the jasmonic acid is selected from, but not limited to, methyl jasmonate.

[0088] The "silencing" as used in the present invention refers to the phenomenon that cells inhibit the expression of a certain gene through various gene expression regulation mechanisms. The mechanisms include DNA methylation, position effect, genomic imprinting, gene conversion, repeat-induced point mutation, paramutation, RNA silencing (including RNA interference, gene suppression, and meiosis silencing mediated by unpaired DNA, etc., guided by small RNAs such as miRNA, siRNA, piRNA, and rasiRNA), and mRNA degradation. For example, the 3' untranslated region (3'UTR) of many mRNAs can bind to miRNA to reduce the translation of mRNA to achieve gene silencing.

[0089] The "knocking out" as used in the present invention refers to an exogenous DNA introduction technology in which a DNA fragment containing a certain known sequence undergoes homologous recombination with a gene having the same or similar sequence in the genome of the recipient cell, is integrated into the genome of the recipient cell, and is expressed. It is directed at a sequence with known sequence but unknown function, changes the genetic genes of an organism, makes the function of a specific gene lose its effect, thereby shielding some functions, and can further affect the organism, and then infer the biological function of the gene.

[0090] The present invention provides the use of salicylic acid in increasing the expression level of the GhEB1C gene in plants. The inventors found in experiments that by exogenously applying salicylic acid, the expression level of the GhEB1C gene in plants can be significantly increased, thereby effectively enhancing the resistance of plants to Verticillium wilt. This discovery provides a more effective and sustainable solution for developing new approaches to control plant Verticillium wilt.

[0091] According to an embodiment of the present invention, the salicylic acid is selected from, but not limited to, methyl salicylate.

[0092] The present invention provides the use of jasmonic acid in decreasing the expression level of the GhEB1C gene in plants.

[0093] According to an embodiment of the present invention, the jasmonic acid is selected from, but not limited to, methyl jasmonate.

[0094] Method

[0095] The present invention provides a method for preparing transgenic plants. According to an embodiment of the present invention, the method includes: introducing a plasmid carrying the GhEB1C gene into Agrobacterium to be transfected, transforming the Agrobacterium into the plant to be constructed, and culturing the transformed plant to be constructed to obtain the transgenic plant. Wherein, the plasmid has the nucleotide sequence shown in SEQ ID NO:2.

[0096] By using the method of the present invention, transgenic plants with high disease resistance can be successfully obtained, providing a new approach for improving the resistance of plants to Verticillium wilt. By introducing the GhEB1C gene into transgenic plants, the defense ability of plants against Verticillium wilt pathogens is effectively enhanced, providing new prospects and hope for solving important disease problems such as Verticillium wilt.

[0097] The present invention provides a method for improving the Verticillium wilt resistance of plants. According to an embodiment of the present invention, the method includes the following two ways: 1) introducing a plasmid carrying the GhEB1C gene (the plasmid has the nucleotide sequence shown in SEQ ID NO:2) into Agrobacterium to be transfected, using the Agrobacterium to transform the plant to be treated, and culturing the transformed plant to be treated to obtain the transgenic plant, thereby increasing the expression level of the GhEB1C gene in the plant; or 2) spraying salicylic acid (which can be selected from, but not limited to, methyl salicylate) on the plant, thereby increasing the expression level of the GhEB1C gene in the plant.

[0098] As described above, overexpressing the GhEB1C gene helps to improve the Verticillium wilt resistance of plants. Therefore, using the method of the present invention can effectively enhance the defense ability of plants against Verticillium wilt pathogens, providing new prospects and hope for solving important disease problems such as Verticillium wilt.

[0099] Embodiments of the present invention will be described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as a limitation of the present invention. For those not specifying specific technologies or conditions in the embodiments, the technologies or conditions described in the literature in this field or according to the product specifications are followed. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0100] Example 1: Cultivation of plant growth and test strains

[0101] Select seeds of the disease-resistant control material Zhongzhimian No. 2 (ZM2) and the disease-susceptible control material Xinluzao No. 36 (XL36) with plump grains, disinfect them with 10% sodium hypochlorite solution for 30 min, rinse them repeatedly 4 times with distilled water, soak them in sterile water until they show white tips, spread them on filter paper and culture them in an incubator at 37 °C for 12 h to germinate. Select seeds with consistent growth vigor and plant them in a culture medium of vermiculite and nutrient soil (1:2). Place 20 10×10 seedling boxes in each tray, and plant 3 - 4 seeds in each box. Cultivate under the conditions of a temperature of 25 °C, a light of 16 h / darkness of 8 h, and a light intensity of 120 μmol m -2s-1 . When the cotton seedlings grow to the stage where the cotyledons are fully unfolded, perform VIGS injection. When the true leaves of the cotton seedlings unfold, select root, stem, and leaf tissues with consistent growth vigor as test materials, take 3 biological replicates for each sample and store them frozen at -80 °C in a refrigerator for tissue expression characteristic analysis. Select cotton seedlings with consistent growth conditions for inoculation treatment.

[0102] Use NC 89 for transgenic tobacco. The wild type WT and transgenic tobacco are cultured in a mixture of vermiculite and nutrient soil (1:2) at a temperature of 25 °C, a light of 16 h / darkness of 8 h, and a light intensity of 120 μmol m -2s-1 . Maintain the relative humidity at about 70%, and perform inoculation treatment when growing to 5 - 6 leaves.

[0103] The test strains are Verticillium dahliae (V. dahliae) Vd592 (deposit number: CGMCC: 3.3758). The Vd592 strain is the dominant strain of cotton Verticillium wilt in Xinjiang and belongs to the defoliating type strain with strong pathogenicity. Streak the Verticillium wilt pathogen 'V592' stored in a -80 °C refrigerator on a PDA medium and culture it at 25 °C for 5 - 7 d. Then pick single colonies into a Czapek liquid medium, culture at 25 °C, 200 rpm, in the dark for 5 d. Filter with 4 layers of gauze. Count the number of spores in the cultured bacterial liquid with a hemocytometer. Finally, suspend the spores of the Verticillium wilt pathogen bacterial liquid in sterilized ddH2O to a final concentration of 1.0×10 7mL was used for inoculation treatment. The roots of the cleaned cotton seedlings were placed in the 'V592' spore suspension, and sterilized ddH2O was used as the control treatment. Root tissues of cotton plants with 3 biological replicates were taken at different time points. The collected materials were quickly frozen and stored in liquid nitrogen for expression analysis after inoculation.

[0104] Example 2: Cloning and sequence analysis of the GhEB1C gene

[0105] Through transcriptome analysis of cotton resistant and susceptible varieties at the budding stage 72 h after infection with Verticillium dahliae (V. dahliae), some differentially expressed genes (DEGs) related to disease resistance were obtained. During this process, it was found that the expression level of the gene GhEB1C increased significantly in the resistant variety after V. dahliae infection. Therefore, in-depth research on the GhEB1C gene was carried out. Using the cDNA of ZM2 as a template, primers were designed to amplify the open reading frame (ORF). The PCR products were transferred into T vectors, and the positive clones were sequenced.

[0106] The cotton EB1 family sequences were downloaded from the CottonFGD website (https: / / cottonfgd.net / ). The identified EB1 family sequences of Arabidopsis thaliana, Medicago sativa, and Zea mays were downloaded from NCBI (https: / / www.ncbi.nlm.nih.gov / ). Multiple sequence alignment of EB1 proteins was performed using MUSCLE with default parameters in MEGA X. The phylogenetic tree of EB1 family members in cotton, Medicago sativa, Zea mays, and Arabidopsis thaliana was constructed using the Neighbour-joining model in MEGA11 software. The phylogenetic tree was beautified in Evolview (https: / / www.evolgenius.info / ).

[0107] The elements in the promoter fragment of the GhEB1C gene (the 2000 bp region upstream of the start codon "ATG" of GhEB1C) were identified using the online program PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ). The GhEB1C promoter with a specific expression pattern was called the target sequence. Homer was used to identify the specific cis-elements in the target sequence.

[0108] The amino acid sequence of the protein expressed by the GhEB1C gene is shown in SEQ ID NO:1. Analysis shows that this gene has a high homology with the AT5G67270 gene. The open reading frame (ORF) of the GhEB1C gene is 990bp, encoding 323 amino acid residues. A phylogenetic tree was constructed to clarify the position of GhEB1C in the EB1 family. The results show that GhEB1C and AT5G67270 belong to Group III ( Figure 1 ). In addition, the promoter region of the EB1 family in each cotton variety contains at least two cis-acting elements of plant hormones ( Figure 2 ). Among them, MYB cis-response elements, MeJA cis-response elements and SA cis-response elements were found in the promoter regions of most genes. The above results indicate that the GhEB1C gene is regulated by multiple hormones in cotton and participates in different types of hormone responses.

[0109] MATNIGMMDGAYFVGRSEILAWINTTLHLNLSKVEEACSGAVHCQLMDSVHPGMVPMHKVNFDAKSEYEMIQNYKVLQDVFNKLKITKHIEVSKLVKGRPLDNLEFMQWMKRYCDSVNGGGLHSYNPVERREASKGGKEASKKSAPQPSSTKGSTAAPRPTSSHARRNSNDVPSSVNPSNQPAKAPSKPSTSVAAYDEQITELKLSVDSLEKERDFYFAKLRDIEILCQTPEIEDSPIVAAIKRILYATDGDASVVTEAQAMLSLDPKEAEALSPIAEASEEKSGSETQKRKNILNTDVDAAGIITLSPRQRLTDASDVHCSGSPLMTY(SEQ ID NO:1)

[0110] Example 3: Analysis of GhEB1C expression pattern and subcellular localization

[0111] At the two-leaf stage, the expression levels of the GhEB1C gene in the root, stem and leaf tissues of ZM2 and XL36 were analyzed, as well as the expression pattern of the GhEB1C gene after infection with Verticillium dahliae. The open reading frame of the GhEB1C gene was inserted into the pCAMBIA1302 vector. The stop codon of this gene was removed and expressed together with the enhanced green fluorescent protein EGFP. The vector was introduced into Agrobacterium tumefaciens EHA105 (PSoup), transformed into cotton protoplasts, and transformed according to the optimal concentration and time. Confocal microscopy (LSM980 laser confocal super-resolution microscope) was used to perform bright-field and fluorescence imaging analysis on the protoplasts.

[0112] The experimental results are asFigure 3 As shown, where from Figure 3 A, it can be seen that the GhEB1C gene is expressed in the roots, stems and leaves of ZM2 and XL36 materials, with the highest expression in the leaves, and the expression in the disease-resistant material ZM2 is much higher than that in the susceptible material XL36; from Figure 3 B, it can be seen that after V. dahliae infection, the GhEB1C gene is expressed in different periods of ZM2 and XL36 materials, with the highest expression at 3 h and then decreasing at 6 h. And the expression in the disease-resistant material ZM2 is higher than that in the susceptible material XL36, indicating that the GhEB1C gene responds to V. dahliae in a short time; the subcellular localization results are as Figure 3 C shows that it can be seen that the GhEB1C-GFP fusion protein is transiently co-expressed with the plasma membrane marker mCherry, and it is found that GhEB1C is localized in the cytoplasm.

[0113] Example 4: Overexpression of GhEB1C enhances the resistance of tobacco to V. dahliae

[0114] To explore the role of the GhEB1C gene in the process of plants resisting Verticillium dahliae, a plant expression vector CaMV35s:GhEB1C was constructed and transformed into tobacco. Specific primer fragments were designed according to the CDS sequence of the GhEB1C gene, and the full-length CDS sequence was obtained by PCR amplification. The target fragment on the recombinant vector and the linearized plasmid pCAMBIA2300 were recovered, and the target fragment and the linear plasmid were ligated with the seamless ligase of Vazyme Company (Nanjing). Tobacco was transformed by the Agrobacterium-mediated method (for the specific method, refer to LI-MING Q, YAN W, YU W, et al. Establishment of high efficient tobacco genetic transformation system for functional genes[J]. Journal of Xinjiang University (Natural Science Edition), 2008.).

[0115] The experimental results are as Figure 4 shown, where Figure 4 A is the process of transforming wild-type WT sterile seedlings into transgenic seedlings, and T0 generation plants of transgenic GhEB1C gene tobacco were obtained, a total of 10 plants ( Figure 4 as shown in B). RT-qPCR was performed on the GhEB1C gene in 10 transgenic tobacco lines, and the results are as Figure 4 C shows that the tobacco lines OE2, OE3, and OE6 are stably expressed and have relatively high expression levels. Therefore, OE2, OE3, and OE6 were selected for the propagation of the T2 generation. At a concentration of 1×107 The tobacco seedlings of WT, OE2, OE3, and OE6 at 20 days old were treated by dipping their roots in the Vd592 spore suspension at a concentration of Figure 4 per mL. As shown in Figure 4 E, the symptoms such as necrosis and chlorosis of the transgenic leaves were significantly alleviated compared with the wild type, and the disease index at 18 days after inoculation was also significantly lower than that of the wild-type tobacco plants (

[0116] Shown in

[0117] D). These results indicate that the overexpression of GhEB1C increases the resistance of tobacco to V. dahliae.

[0118] To study the role of the GhEB1C gene in cotton resistance to V. dahliae, the GhEB1C gene was silenced by VIGS. The specific steps are as follows:

[0119] The steps of the trypan blue staining experiment are as follows: Immerse the leaves in 5 ml of lactophenol trypan blue solution (250 μg / ml). Trypan blue, 25% (w / v) lactic acid, 25% water-saturated phenol, 25% glycerol, H2O, slowly release and infiltrate under vacuum for 5 minutes, and then infiltrate for another 5 minutes. Then heat the sample in boiling water for 2 minutes and cool it, and then use chloral hydrate solution (dissolved 25 g in 10 ml of water) for decolorization. After exchanging the chloral hydrate solution multiple times, balance the sample in 70% glycerol for several hours.

[0120] The experimental results are as Figure 5 shown, Figure 5 A shows the albino phenotype of TRV:GhCLA1 15 days after VIGS silencing; Figure 5 B shows the silencing efficiency of GhEB1C detected by RT-qPCR, and the results prove that TRV:GhEB1C cotton is effectively silenced; when inoculating the experimental group cotton and the negative control cotton with Vd592, the results are as Figure 5 shown in C, indicating leaf abscission, chlorosis, and wilting, and this phenomenon is more obvious in TRV:GhEB1C; compared with the negative control (TRV:00) plants, the disease index of TRV:GhEB1C is higher in both susceptible and resistant varieties than that of the negative control (TRV:00) ( Figure 5 shown in D); similarly, the results of the fungal recovery experiment are shown in Figure 5 E, indicating that fungal biomass colonization is more extensive in TRV:GhEB1C; compared with TRV:00, the cell death area in the cotton leaves of TRV:GhEB1C is larger ( Figure 5 shown in F), and the longitudinal section of the cotton stem segment of TRV:GhEB1C plants shows a higher degree of browning ( Figure 5 shown in G); these results indicate that knocking down TRV:GhEB1C reduces the resistance of Gossypium hirsutum to V. dahliae.

[0121] Example 6: Transcriptome analysis of the disease resistance mechanism of GhEB1C

[0122] To identify the affected signaling pathways in TRV:GhEB1C plants after infection, the inventors studied WT and TRV:GhEB1C cotton plants after infection with V. dahliae and harvested samples at 72 h for whole transcriptome sequencing (RNA-seq) analysis. The specific steps are as follows: Samples of treated cotton leaves were taken and RNA was extracted. Library construction and sequencing were carried out according to the standard experimental procedures provided by the Illumina 2000 system. Differentially expressed genes (DEGs) were identified using DESeq 2 by the following method: |fold change| ≥ 1. The resulting p-values were adjusted using the Benjamini and Hochberg method. Genes with an adjusted p-value < 0.05 as determined by DESeq 2 were designated as differentially expressed. EggNOG-mapper v2 was used for gene annotation. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of DEGs was performed using the clusterProfiler R package. Principal component analysis (PCA) was performed on the data after database sequencing was completed. The PCA analysis showed good clustering between the datasets of wild type (WT) and TRV:GhEB1C. In this analysis, a total of 31,774 genes were upregulated and 28,129 genes were downregulated. To further verify the accuracy of the transcriptome data, the inventors randomly selected four upregulated genes (Gh_A09G141300, Gh_A07G017800, Gh_A10G213700, and Gh_A09G180700) and four downregulated genes (Gh_D04G164400, Gh_A02G168900, Gh_D13G056700, and Gh_A04G124600) for RT-qPCR analysis. The results are as Figure 6 shown. The expression trends of these two groups of genes were consistent, further confirming the accuracy of the transcriptome results.

[0123] Fold change and p-values were used to screen for differentially expressed genes (DEGs), and differentially expressed genes were selected from the screened WT and TRV:GhEB1C genes for GO and KEGG enrichment analysis. The results of the GO enrichment analysis are shown as Figure 7As shown, these differentially expressed genes are mainly involved in oxidoreductase activity. Oxidoreductase activity regulates the redox process within cells, contributing to maintaining the intracellular redox balance. The plant secondary metabolite synthesis pathway plays an important role in the resistance of plant secondary metabolites to Verticillium wilt. Especially the processes of hemiterpene synthase and flavonoid biosynthesis. It plays a key role in resisting pathogen invasion, predators, and environmental stresses. The terpenoid active pathway, lactate decomposition process, multicellular organism development, lactoylglutathione lyase activity, biosynthesis process, flavonoid biosynthesis process, proline biosynthesis process, hyperosmotic salt response, transferase activity. These are highly related to the plant immune response. Additionally, the programmed cell death regulatory pathway was also enriched. When a plant is invaded by pathogens, it activates an immune response by sensing pathogen-associated molecules (such as proteins, polysaccharides, and nucleic acids). These sensing processes trigger a series of signal transduction pathways, including the programmed cell death pathway. Programmed cell death regulation can cause the death of cells at the infection site, thereby limiting the spread of pathogens. This is a defense mechanism against pathogen invasion. It helps eliminate aging or damaged cells to maintain the health of tissues and organs.

[0124] KEGG enrichment analysis showed that, as Figure 8 shown, the biosynthesis of terpenoids and triterpenoids, acetone metabolism, ubiquitin-mediated protein-related pathways, and the synthesis pathway of lysine. Lysine is an important precursor for the synthesis of plant defense substances, such as antimicrobial peptides and plant antimicrobial proteins. These defense substances can be synthesized after the plant senses pathogen invasion to enhance the immune response. Additionally, there are also plant hormone signaling pathways and MAPK signaling pathways related. Plant hormones play an important role in plant disease resistance. They are internal signal molecules in plants that can regulate various growth and development processes and are also involved in the plant's disease resistance defense mechanism. The activation of MAPK can trigger a series of defense responses, constituting a comprehensive disease resistance mechanism. This includes the production of alkaloids, the accumulation of antioxidant substances, strengthening cell wall reinforcement, and inducing apoptosis and other responses. These defense responses work synergistically to assist the plant in effectively preventing pathogen invasion and spread. Referring to previous transcriptome studies, differentially expressed genes (DEGs) are mainly involved in several key aspects. In cell wall biosynthesis, glucan metabolism process, polysaccharide biosynthesis, membrane-anchored components, plasma membrane-anchored components, microtubules, and microtubule-related complexes and kinesin complexes. This suggests that microtubules and cell membranes play important roles in resisting pathogen invasion and intracellular signal transduction. In addition, KEGG enrichment analysis showed that DEGs were involved in multiple pathways, including ubiquitin biosynthesis, pyruvate metabolism, glutathione metabolism, fructose and mannose metabolism, flavonoid biosynthesis, fatty acid metabolism, and cysteine and methionine metabolism. These enriched pathways emphasize the importance of secondary metabolite synthesis and signal transduction in disease resistance.

[0125] In summary, the silencing of the GhEB1C gene mainly affects microtubules, microtubule-associated complexes, and kinesins, activating the plant secondary metabolism synthesis pathway. These proteins are responsible for multiple key aspects such as cell morphology maintenance, signal transduction, intracellular transport, cell division, and cell proliferation. These effects may directly or indirectly affect the resistance of cotton to pathogens. Compared with uninfected WT, most genes involved in plant cell disease resistance regulation are downregulated in TRV:GhEB1C (as shown by the green squares in Figure 9 ). These genes mainly encode transcription factors and hormone biosynthesis signal transduction genes. Considering the GO and KEGG enrichment results and the promoter cis-elements of GhEB1C, it is speculated that GhEB1C may affect the SA and JA signal pathways.

[0126] Example 6: Effects of GhEB1C on SA and JA signal pathways

[0127] The upstream promoter sequence of GhEB1C contains cis-acting elements of MeJA and SA, and hormone biosynthesis signal transduction genes are downregulated in the transcriptome, suggesting that GhEB1C may be involved in disease resistance related to hormone responses, and SA and JA play key roles in plant disease resistance. Therefore, using the disease-resistant upland cotton variety ZM2 as the material, the effects of hormone treatment on gene expression were studied. At the two-leaf stage, seedlings were sprayed with 100 μM methyl jasmonate (MeJA) and 2 mM methyl salicylic acid (MeSA), and the changes in the expression levels of the GhEB1C gene in the leaves of ZM2 after MeSA and MeJA treatments were detected. Cotton leaves were collected at 0, 6, 12, and 48 h after treatment and frozen in liquid nitrogen before RNA extraction. SA and JA levels were measured in the leaves of TRV:00 and TRV:GhEB1C plants 48 h after inoculation with V. dahliae. High-performance liquid chromatography was used, and three biological replicates were set up for the experiment.

[0128] The experimental results are as shown in Figure 10 shown. Figure 10 A shows that the expression levels of the GhEB1C gene were significantly upregulated at 6, 12, and 48 hours after MeSA treatment in ZM2, and the expression levels of the GhEB1C gene in ZM2 after MeJA treatment showed a downward trend first. These results indicate that MeSA and MeJA have specific regulatory effects on the expression of GhEB1C. SA and JA levels were measured in the leaves of TRV:00 and TRV:GhEB1C plants 48 h after infection with V. dahliae, as shown in Figure 10As shown in B, it was found that the content of SA was higher than that of TRV:GhEB1C at 0 h TRV:00, while the content of SA in TRV:00 increased significantly 48 h after inoculation. Combined with the significant expression of the GhEB1C gene after MeSA spraying treatment, SA plays a role in cotton resistance to Verticillium dahliae after cotton is infected with V. dahliae, and the content of SA decreases after GhEB1C is silenced, indicating that GhEB1C positively regulates the SA pathway, a disease-resistant hormone in cotton. The content of JA was lower in 0 h TRV:00 than in TRV:GhEB1C. However, the content of TRV:GhEB1C increased significantly relative to TRV:00 48 h after inoculation. Hormone pathway regulation is a complex network. Combined with the enrichment of the JA hormone pathway in KEGG after silencing GhEB1C, and the expression level of the GhEB1C gene first decreased and then increased after spraying MeJA, it is speculated that GhEB1C may play a role in the later stage of immune signal transduction downstream of JA.

[0129] In the description of this specification, the description with reference to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0130] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. Use of the GhEB1C gene in regulating plant resistance to Verticillium wilt.

2. The use according to claim 1, characterized in that, The protein expressed by the GhEB1C gene has the amino acid sequence shown in SEQ ID NO: 1; Optionally, the plant is selected from cotton, Arabidopsis thaliana, rice, corn, wheat, sorghum, barley, oats, rye, soybean, tobacco, rape, tomato.

3. Use of a reagent in enhancing plant resistance to Verticillium wilt, wherein the reagent is used to enhance the activity or expression level of the GhEB1C gene.

4. The use according to claim 3, characterized in that, The reagent includes salicylic acid or a plasmid for overexpressing the GhEB1C gene; Optionally, the salicylic acid is selected from methyl salicylic acid; Optionally, the plasmid has the nucleotide sequence shown in SEQ ID NO:

2.

5. Use of a reagent in reducing plant resistance to Verticillium wilt, wherein the reagent is used to reduce the activity or expression level of the GhEB1C gene.

6. The use according to claim 5, characterized in that, The reagent includes jasmonic acid or a plasmid for silencing or knocking out the GhEB1C gene; Optionally, the plasmid includes siRNA, Cas-sgRNA or shRNA targeting the GhEB1C gene; Optionally, the jasmonic acid is selected from methyl jasmonate.

7. Use of salicylic acid in increasing the expression level of the GhEB1C gene in plants.

8. Use of jasmonic acid in decreasing the expression level of the GhEB1C gene in plants.

9. A method for preparing a transgenic plant, characterized in that, Includes: Transforming the plant to be constructed with Agrobacterium carrying the GhEB1C gene.

10. A method for improving the Verticillium wilt resistance of plants, characterized in that, Includes: Increasing the expression level of the GhEB1C gene in the plant.

11. The method according to claim 10, characterized in that, The increasing of the expression level of the GhEB1C gene in the plant is carried out by the following methods: Transforming the plant to be treated with Agrobacterium carrying the GhEB1C gene; or Spraying salicylic acid on the plant.

12. The method according to claim 9 or 11, characterized in that Further includes: Culturing the transformed plant to be constructed or the plant to be treated to obtain the transgenic plant; Optionally, the Agrobacterium carrying the GhEB1C gene is obtained by introducing a plasmid carrying the GhEB1C gene into the Agrobacterium to be transfected; Optionally, the plasmid has the nucleotide sequence shown in SEQ ID NO:

2.

13. The method according to claim 11, wherein The salicylic acid is methyl salicylic acid.

14. The method according to any one of claims 9 to 11, characterized in that The plant is selected from cotton, Arabidopsis thaliana, rice, corn, wheat, sorghum, barley, oats, rye, soybean, tobacco, rape, tomato.

Images