Application of ZmNAC49 gene in enhancing salt tolerance of plants

Abstract

The invention belongs to the technical field of biology, and particularly provides application of a ZmNAC49 gene in enhancing salt tolerance of plants. The invention provides the gene ZmNAC49 capable of regulating the salt tolerance function of the corn, the gene ZmNAC49 is transformed into the corn by utilizing an agrobacterium-mediated method, and a result shows that the ZmNAC49 can promote root growth, reduce Na < + > accumulation in roots and enhance the salt tolerance of the corn. The invention provides a gene resource for researching the salt tolerance of plants, and has important theoretical significance and application value.

Description

I. Technical Field

[0001] The present invention belongs to the field of biotechnology, specifically the application of the ZmNAC49 gene in enhancing plant salt tolerance. II. Background Art

[0002] Soil salinization seriously affects agricultural production. According to statistics, salinization has affected more than 10% of the land worldwide, causing a large amount of economic losses every year. Soil salinization will lead to excessive accumulation of Na + , Cl- and other ions in the soil, destroying the soil structure, hindering crop growth, and seriously reducing land productivity. It is of great practical significance to fully explore the production potential of saline-alkali land.

[0003] Maize (Zea mays L.) is the largest food crop and also an important feed and industrial raw material. Maize is a C4 plant of the Gramineae family and belongs to moderately salt-sensitive crops. The negative impact of soil salinization on maize production is increasing, bringing new challenges to maize production. Cultivating salt-tolerant maize varieties can reduce the adverse effects brought by soil salinization. Before cultivation, it is necessary to fully understand the physiological and molecular mechanisms of maize adapting to salt stress.

[0004] Salt stress will cause osmotic stress and ion toxicity, leading to oxidative stress and nutrient stress, etc., seriously affecting crop growth and reducing crop yield. The root system is the main organ for plants to absorb nutrients and adapt to soil adversity. Salt stress will increase the ion content in the plant root system and further cause root ion toxicity. III. Summary of the Invention

[0005] The present invention uses maize as the research material, clones the ZmNAC49 gene, constructs ZmNAC49 overexpression and knockdown maize materials, and determines its role in enhancing maize salt tolerance. It is further found that it can promote the growth of maize roots and reduce the accumulation of Na + in the roots, laying a foundation for the exploration of maize salt-tolerance-related genes and maize salt-tolerance breeding.

[0006] The present invention provides a ZmNAC49 coding sequence derived from maize and the protein encoded thereby, and proves its role in promoting root growth and enhancing maize salt tolerance, providing guidance for salt-tolerant maize breeding.

[0007] First, the present invention provides that the nucleotide sequence of the ZmNAC49 gene is as shown in SEQ ID NO.1, with a total length of 939 nucleotides.

[0008] Second, the present invention provides that the amino acid sequence of the ZmNAC49 protein is as shown in SEQ ID NO.2, with a total length of 312 amino acids.

[0009] In a third aspect, the present invention provides the application of the ZmNAC49 gene, protein or the biological material in the preparation of transgenic plants.

[0010] The application includes: designing and cloning primers according to the ZmNAC49 gene, performing PCR amplification using the nucleotide sequence shown in SEQ ID NO.1 as a template, ligating the cloned product with an expression vector, and after correct sequencing, transforming the expression vector into plant cells by an Agrobacterium-mediated method to obtain transgenic plants.

[0011] In a fourth aspect, the present invention provides the application of the ZmNAC49 gene, protein or the biological material in regulating plant salt tolerance.

[0012] The plant is maize.

[0013] In a fifth aspect, the present invention provides a method for regulating plant salt tolerance, including promoting the expression of the ZmNAC49 gene or protein in plants by means of genetic engineering.

[0014] The genetic engineering means includes: introducing an expression vector carrying a target gene into plant cells by using a Ti plasmid, a plant virus vector, direct DNA transformation, microinjection, or electroporation technology.

[0015] Beneficial effects: The present invention provides a gene ZmNAC49 that regulates the salt tolerance function of maize. Transforming maize by an Agrobacterium-mediated method, the results show that the NAC transcription factor ZmNAC49 can promote root growth and reduce the accumulation of Na in roots, enhancing the salt tolerance of maize. The present invention provides gene resources for studying plant salt tolerance and has important theoretical significance and application value. + accumulation, enhancing the salt tolerance of maize. The present invention provides gene resources for studying plant salt tolerance and has important theoretical significance and application value. IV. DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Detection of the expression level of the ZmNAC49 gene in ZmNAC49 overexpressing and knockdown maize plants;

[0017] In the figure, A: Schematic diagram of the T-DNA of the ZmNAC49 overexpression vector; B: Schematic diagram of the T-DNA of the ZmNAC49 knockdown vector; C: Expression level of the ZmNAC49 gene in ZmNAC49 overexpressing transgenic maize; D: Expression level of the ZmNAC49 gene in ZmNAC49 knockdown transgenic maize.

[0018] Figure 2 Phenotypic analysis of ZmNAC49 enhancing maize salt tolerance;

[0019] In the figure, A: Salt tolerance phenotype analysis, control treated with 200 mM NaCl (maize plants transformed with empty vector), ZmNAC49 overexpressing and knockdown maize plants; B: Fresh weight; C: Dry weight.

[0020] Figure 3 ZmNAC49 promotes the root growth of maize under salt stress;

[0021] In the figure, A: Maize root under salt stress; B: Root length; C: Root diameter; D: Root activity.

[0022] Figure 4 ZmNAC49 reduces the accumulation of Na in roots + and increases the content of K in roots + ;

[0023] In the figure, A: Na content in the above-ground part; B: K content in the above-ground part; C: Na content in the root part; D: K content in the root part. + content; B: K content in the above-ground part + content; C: Na content in the root part + content; D: K content in the root part + content. V. Specific implementation manners

[0024] Example 1: Cloning of ZmNAC49 gene and construction of expression vector

[0025] (1) Extraction of total RNA from maize and synthesis of cDNA

[0026] To obtain the complete nucleotide fragment encoded by the ZmNAC49 gene, TRIzon Reagent (ComWin Biotech Co., Ltd., Cat.#CW0580) was used in this invention, and the specific operation steps were carried out according to the instructions to extract the total RNA from young maize leaves. According to the instructions of the 5×All-in-One RT MasterMix reverse transcription kit (5×All-in-One RT MasterMix, abm company, Cat.#G492), maize cDNA was synthesized.

[0027] (2) Cloning of ZmNAC49 gene

[0028] The forward and reverse specific primers were designed using the NCBI Primeer-BLAST online website. The primer names are ZmNAC49-F and ZmNAC49-R, and the primer sequences are as follows:

[0029] ZmNAC49-F: ATGGGTCTGCCGATGAGG

[0030] ZmNAC49-R: TCAGAACTGTCCCAACCCGG

[0031] Using maize cDNA as a template, specific primers ZmNAC49-F and ZmNAC49-R were used for amplification. The coding region (CDS sequence) of the ZmNAC49 gene was isolated and cloned by PCR method (the sequence is shown in SEQ ID NO.1), and its protein sequence is shown in SEQ ID NO.2.

[0032] ZmNAC49 nucleotide sequence SEQ ID NO.1

[0033]

[0034]

[0035] ZmNAC49 amino acid sequence SEQ ID NO.2

[0036]

[0037] (3) Construction of ZmNAC49 overexpression and knockdown vectors

[0038] Using the ZmNAC49 gene as a template, the following specific primers were used for amplification.

[0039] Table 1

[0040]

[0041]

[0042] The overexpression vector uses plasmid pCUN-NHF as the vector and is double digested with HindIII and Kpn I. The knockdown vector uses plasmid pCUN-RNAi as the crop vector and is double digested with Smal and KpnI. Subsequently, homologous recombinase is used to ligate the PCR amplification product and the double-digested product. The 10 μL ligation system is as follows: 2×CE II Buffer: 2 μL; Exnase II: 1 μL; double-digested vector: 3 μL; PCR amplification product: 2 μL; ddH2O: 2 μL. After reacting at 37 °C for 30 min, it is cooled to 4 °C or immediately placed on ice. Thaw the DH5α competent cells on ice, add the above 5 μL of the recombinant product to 100 μL of the competent cells, gently flick the tube wall to mix evenly, and let it stand on ice for 30 min. After heat shock in a 42 °C water bath for 45 s, immediately place it on ice and cool for 2 - 3 min. Add 900 μL of LB medium without antibiotics, and shake the bacteria at 200 rpm at 37 °C for 1 h. Preheat the LB solid medium plate containing kanamycin resistance in a 37 °C incubator. Centrifuge at 5000 rpm for 5 min and discard the supernatant. Resuspend the bacteria, and gently spread them evenly on the plate containing kanamycin resistance with a sterile spreading rod. Incubate upside down in a 37 °C incubator for 12 h. Inoculate the colonies identified as positive by colony PCR into liquid LB medium containing kanamycin and culture overnight, extract the plasmid, and sequence it.

[0043] Example 2: Detection of the expression level of the ZmNAC49 gene in ZmNAC49 transgenic maize materials

[0044] (1) Agrobacterium transformation of the plant binary expression vector

[0045] The above plant binary expression vector is transformed into the Agrobacterium LBA4404 competent strain by the liquid nitrogen freezing method, and plated and cultured on YEP + 50 mg·L -1 kanamycin + 50 mg·L -1 rifampicin solid medium. The culture conditions are 28 °C and 48 h. Pick a single colony and culture it in YEP + 50 mg·L -1 kanamycin + 50 mg·L -1 rifampicin liquid medium with shaking. The culture conditions are 28 °C and 12 h, and the shaking speed is 200 r·min -1 . The plasmid is extracted by the alkaline lysis method [the extraction steps refer to the instruction manual of the Kangwei Century plasmid mini kit (Cat.#CW0500)] and PCR detection is carried out. After verification, the Agrobacterium bacterial solution containing the recombinant plasmid can be used for the next step. Add glycerol with a final concentration of 20% (volume ratio) to the Agrobacterium bacterial solution and store it at -80 °C for a long time.

[0046] Take out the Agrobacterium bacterial solution stored at -80 °C and thaw it on ice. In a sterile laminar flow hood, on YEP + 50 mg·L -1Kanamycin + 50mg·L -1 Plate culture on rifampicin solid medium, and the culture conditions are 28 °C and 48 h. In a sterile laminar flow hood, use an inoculation loop to pick up a small amount of activated Agrobacterium strains and evenly streak them on YEP + 50mg·L -1 Kanamycin + 50mg·L -1 Rifampicin solid medium, and the culture conditions are 28 °C and 48 h.

[0047] (2) Agrobacterium-mediated genetic transformation of maize shoot tips

[0048] Refer to the previous method of Xiang et al. [Xiang Yang, Sun Xiujuan, Bian Xiangli, et al. The transcription factor ZmNAC49 reduces stomatal density and improves drought tolerance in maize. Journal of Experimental Botany, 2021, 72(4): 1399-1410] to complete Agrobacterium-mediated genetic transformation of maize shoot tips and obtain transgenic plants. When the maize plants grow to the 3-4 leaf stage, take the new leaves of the maize plants and extract genomic DNA using the CTAB method (Gao Junfeng, Experimental Guidance for Plant Physiology, Higher Education Press, 2006, 151-152). Design specific reaction primers bar-F (forward primer) and bar-R (reverse primer) according to the sequence of the phosphinothricin acetyltransferase gene bar.

[0049] bar-F: 5′-ATCGAGACAAGCACGGTCAAC-3′

[0050] bar-R: 5′-AAACCCACGTCATGCCAGTTC-3′

[0051] Using the DNA of wild-type and transformed maize plants as templates and bar-F and bar-R as primers, perform PCR amplification.

[0052] Amplification system (15 μL):

[0053] 2×M5 HiPer Taq PCR mix 10 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, DNA template 4 μL, ddH2O 5 μL.

[0054] Amplification program:

[0055] 95°C for 3 min; 94°C for 30 s, 52°C for 25 s, 72°C for 25 s, 32 cycles; 72°C for 5 min. Store at 4°C.

[0056] The results of PCR identification showed that no bands were amplified in wild-type maize plants, while a clear band was amplified at 404 bp in transgenic maize plants. The amplified product was analyzed by sequencing and was shown to be identical to the nucleotide sequence of the phosphinothricin acetyltransferase gene bar, demonstrating that the foreign gene had been transferred into the maize genomic DNA.

[0057] After identification, the seedlings were acclimatized and transplanted to a suitable environment for growth, with conventional fertilization and watering management, and the T0 generation of maize seeds were harvested. The T0, T1, and T2 generation of maize seeds from the transgenic plants were planted in the substrate, the leaves were cut, and genomic DNA was extracted using the CTAB method. Using bar-F and bar-R as primers, PCR amplification was performed, and transgenic homozygous maize plants were successfully obtained.

[0058] (3) Detection of the expression level of the ZmNAC49 gene in ZmNAC49 overexpressing and knockdown maize plants

[0059] Take maize leaves from the control (Vector), ZmNAC49 overexpressing and knockdown maize plants, extract total RNA and reverse transcribe to obtain cDNA, and perform RT-qPCR using cDNA as a template. The ZmActin gene was used as an internal reference gene to detect the relative expression level of the ZmNAC49 gene.

[0060] Design specific primers, and the primer sequences are as follows:

[0061] ZmNAC49-RT-F: 5′-TTGGATGACTGGGTGCTGTG-3′

[0062] ZmNAC49-RT-R: 5′-ACGAGTGCGAGTGTGATTGG-3′

[0063] The primer sequences used to detect the ZmActin gene are as follows:

[0064] ZmActin-RT-F: 5′-GCCATCCATGATCGGTATGG-3′

[0065] ZmActin-RT-R: 5′-GTCGCACTTCATGATGGAGTTG-3′

[0066] Add the template and primers according to the instructions of ABM's EvaGreen 2×qPCR MasterMix; then use the Bio-Rad CFX96 real-time PCR system to perform RT-qPCR analysis on the target gene according to the reaction program, using ZmActin as the internal reference gene, and calculate the relative gene expression by the 2 -ΔΔCt method. The reaction system and reaction program are as follows:

[0067] Reaction system (10 μL):

[0068] EvaGreen 2×qPCR MasterMix 5 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, template 1 μL, ddH2O to 10 μL.

[0069] Reaction program:

[0070] 95°C for 10 min; 95°C for 15 s, 60°C for 60 s, 30 - 35 cycles; store at 4°C.

[0071] The results showed that the gene expression of ZmNAC49 increased by about 4-fold in ZmNAC49 overexpressing maize plants, while the gene expression decreased by more than 60% in ZmNAC49 knockdown maize plants ( Figure 1 ).

[0072] Example 3: Salt tolerance phenotype analysis of ZmNAC49 overexpressing and knockdown transgenic maize

[0073] Select plump and uniform maize seeds, soak them at 25°C for 12 h, then sow the control (Vector), ZmNAC49 overexpressing (OE-ZmNAC49) and knockdown (RNAi-ZmNAC49) maize seeds into the nutrient soil matrix containing 200 mM NaCl, grow for 14 d, and sample for subsequent experiments. The fresh weight and dry weight of the whole plant were measured by weighing method. For dry weight measurement, the maize plants were placed in an oven at 105°C for 30 min to inactivate enzymes, and then placed in an oven at 80°C to dry to a constant weight. The results showed that under normal growth conditions, there was no significant difference in the growth status among the control, ZmNAC49 overexpressing and knockdown maize plants. Under salt stress conditions, the growth status of these maize plants was significantly inhibited. Compared with the control maize plants, the growth of ZmNAC49 overexpressing maize plants was less inhibited, while the growth of ZmNAC49 knockdown maize plants was more inhibited ( Figure 2 A). Further found that compared with the control maize plants, the fresh weight and dry weight of ZmNAC49 overexpressing maize plants were significantly higher under salt stress conditions, while the ZmNAC49 knockdown transgenic plants were significantly reduced ( Figure 2 B - C). These results indicate that ZmNAC49 positively regulates the salt tolerance of maize.

[0074] Example 4: Analysis of Root Morphology and Physiological Activity of ZmNAC49 Overexpressing and Knockdown Transgenic Maize

[0075] To investigate the effects of salt stress on maize roots, the root morphology of the control, ZmNAC49 overexpressing, and knockdown maize under salt stress was further analyzed. The main root length and root diameter were measured using a vernier caliper, and the root activity was determined using the triphenyltetrazolium chloride (TTC) method (refer to the Experimental Guide of Plant Physiology, Higher Education Press, 2006, 151 - 152). The results showed that there were no significant differences in root growth among the control, ZmNAC49 overexpressing, and knockdown maize plants under normal growth conditions. Under salt stress conditions, the root growth of these maize plants was significantly inhibited. Compared with the control maize plants, the root growth of ZmNAC49 overexpressing maize plants was significantly less inhibited, while that of ZmNAC49 knockdown maize plants was significantly more inhibited ( Figure 3 A). Further findings showed that compared with the control maize plants, the root length, root diameter, root activity, and dry weight of ZmNAC49 overexpressing maize plants were higher under salt stress conditions, while those of ZmNAC49 knockdown maize plants were significantly reduced ( Figure 3 B - D).

[0076] Example 5: Determination of Na + , K + Contents in ZmNAC49 Overexpressing and Knockdown Transgenic Maize

[0077] Take the above - ground parts and root parts dried in Example 3, weigh 0.02 g of the dried materials, transfer them to a 2 - mL centrifuge tube, add 800 μL of concentrated nitric acid, first digest at 90 °C for 1 h, and then digest at 80 °C for 10 h. During this period, gently shake the centrifuge tube to fully decompose the samples; after cooling, filter the samples, take 80 μL of the filtered samples, and dilute them to 8 mL with 5% dilute nitric acid; use an inductively coupled plasma optical emission spectrometer to determine the Na + and K + contents. The results showed that under normal growth conditions, there were no significant differences in the Na + and K + contents in the above - ground parts and root parts of the control, ZmNAC49 overexpressing, and knockdown maize plants. After salt stress treatment, there were no significant differences in the Na + and K + contents in the above - ground parts of the control, ZmNAC49 overexpressing, and knockdown maize plants. Compared with the root parts of the control plants, the Na + content of ZmNAC49 overexpressing maize plants was significantly lower (p < 0.05), and the K +content was significantly higher (p < 0.05), and the Na content in the ZmNAC49 knockdown maize plants was higher (p < 0.05), while the K content was lower (p < 0.05) ( + A - D). This indicates that ZmNAC49 can improve the salt tolerance of maize by promoting root growth, reducing Na accumulation in roots, and increasing the K content. + A - D). This indicates that ZmNAC49 can improve the salt tolerance of maize by promoting root growth, reducing Na accumulation in roots, and increasing the K content. Figure 4 A - D). This indicates that ZmNAC49 can improve the salt tolerance of maize by promoting root growth, reducing Na accumulation in roots, and increasing the K content. + accumulation and increasing the K + content, thereby enhancing the salt tolerance of maize.

Claims

1. Application of ZmNAC49 gene in enhancing plant salt tolerance.

2. The use according to claim 1, characterized in that: The plants include corn.

3. The use according to claim 1 or 2, characterized in that: The nucleotide sequence of the ZmNAC49 gene is shown in SEQ ID NO.

1.

4. The use according to claim 1 or 2, characterized in that: The amino acid sequence of the ZmNAC49 protein encoded by the ZmNAC49 gene is shown in SEQ ID NO.

2.

5. The use according to claim 1 or 2, characterized in that: The method comprises preparing biological materials containing the ZmNAC49 gene or the protein encoded by the gene, wherein the biological materials comprise recombinant DNA, expression cassette, transposon, plasmid vector, virus vector, engineering bacteria or non-renewable plant cells or tissues.

6. The use according to claim 1 or 2, characterized in that: The ZmNAC49 gene reduces Na in the root system. + Accumulate and increase K in the root system + content.

7. The use according to claim 1 or 2, characterized in that: The ZmNAC49 gene promotes the growth of corn roots.

8. A method for regulating plant salt tolerance, characterized in that: The method comprises utilizing genetic engineering means to promote the expression of the ZmNAC49 gene or protein in plants.

9. The method for regulating plant salt tolerance according to claim 8, characterized in that: The genetic engineering means include: introducing an expression vector carrying a target gene into plant cells by using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, or electroporation technology.

Images