Cultivation method of early-flowering non-transgenic poplar with herbicide tolerance

Through the use of co-editing strategies and base editors, non-transgenic editing of ALS and CEN genes was successfully achieved in poplar trees, solving the problem of gene editing in poplar trees, achieving the effects of early flowering and herbicide tolerance, and significantly improving breeding efficiency.

CN120210281APending Publication Date: 2025-06-27NANJING FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510298478.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

The prior art is difficult to effectively remove CRISPR/Cas elements in poplars, and the juvenile period of poplars is relatively long, limiting the field release and promotion of gene editing.

Method used

Using a co-editing strategy, the ALS and CEN genes in poplars were knocked out using a base editor, and non-transgenic gene editing was achieved by designing specific sgRNAs and constructing pCAMBIA1300-35S::CBE vectors.

Benefits of technology

The successful acquisition of non-GMO poplar plants that are prematurely flowering and tolerant to sulfonylurea herbicides has significantly accelerated the breeding cycle, improved the efficiency of gene editing, and avoided the policy restrictions brought about by traditional GMO strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210281A_ABST
    Figure CN120210281A_ABST
Patent Text Reader

Abstract

The invention discloses a cultivation method of a non-transgenic poplar which blooms early and has herbicide tolerance, and relates to the technical field of plant genetic engineering. The invention discloses a cultivation method of an early-flowering non-transgenic poplar with herbicide tolerance, which comprises the following steps: knocking out four genes PdbALS1, PdbALS2, PdbCEN1 and PdbCEN2 in the poplar at the same time by using a base editor, and screening by using a herbicide to obtain a poplar non-transgenic edited plant with early flowering time. According to the method, the breeding period is remarkably shortened, the editing efficiency is improved, a co-editing method of ALS and target genes is optimized, policy limitation caused by a traditional transgenic strategy is avoided, and powerful support is provided for rapid genetic improvement and industrial application of poplar trees. Under the condition that co-culture is prolonged for 20 days, the appearance frequency of chlorsulfuron-methyl resistant buds is 3-4 times that of a traditional two-day co-culture method.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and more specifically, relates to a method for cultivating non-transgenic poplar trees with early flowering and herbicide tolerance. Background Art

[0002] Populus spp. is one of the important fast-growing industrial timber tree species and afforestation tree species in China, with characteristics such as fast growth, high quality, high resistance, and strong adaptability. Poplar has a wide distribution range, grows rapidly, has a straight and round trunk, and can be cut and utilized within a short period, making it the main tree species planted in fast-growing forests globally.

[0003] With the development of gene editing technology, the CRISPR / Cas system has become a powerful tool for improving the agronomic traits of poplar. However, gene editing in poplar usually requires the stable integration of CRISPR / Cas elements, which not only increases the complexity of biosafety supervision but also poses challenges in removing these elements. In annual crops, a common method for removing integrated CRISPR / Cas elements is to generate offspring segregation populations through self-crossing or hybridization and screen for non-transgenic but target gene-edited progeny among them. However, poplar is a strictly outcrossing plant with inbreeding depression and a relatively long juvenile period. This means that the above method is difficult to implement in poplar, thus limiting the field release and promotion of gene-edited poplar.

[0004] In recent years, a co-editing strategy has been applied in crops such as tomatoes, tobacco, potatoes, and citrus. This method utilizes the Agrobacterium-mediated transient expression of two CRISPR elements to obtain non-transgenic and gene-edited plants. Specifically, this strategy uses a cytosine base editor (CBE) to edit the endogenous acetolactate synthase (ALS) gene, making the plants resistant to sulfonylurea herbicides; at the same time, Cas12a is used to target the target gene, inducing double-strand breaks, thereby causing mutations in the target gene. Under the screening pressure of sulfonylurea herbicides, the regenerated plants that can survive usually have a relatively high proportion of successfully edited target genes. This method enables the acquisition of non-transgenic target gene-edited plants in the T0 generation, providing a feasible solution for the genetic improvement of perennial plants such as poplar.

[0005] In addition, the CEN1 (CENTRORADIALIS) gene plays a key role in the flower development of poplar. It inhibits flower formation by antagonizing the FT and LFY genes. Research has shown that knocking out the CEN1 gene can significantly shorten the juvenile period of poplar, enabling it to flower within 4 months. Poplar with only the CEN1 gene knocked out exhibits an early-flowering phenotype similar to that of CEN1 / CEN2 double knockout, further confirming that CEN1 is the main flowering inhibitor in poplar. Therefore, obtaining CEN1 gene knockout poplar through non-transgenic methods has better application prospects in rapid forest tree breeding and promotion. Summary of the Invention

[0006] Aiming at the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide a method for cultivating non-transgenic poplar with early flowering and herbicide tolerance, which is used to edit the ALS and CEN genes without introducing exogenous DNA, and cultivate non-transgenic poplar with early flowering and herbicide tolerance.

[0007] To solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0008] A method for cultivating non-transgenic poplar with early flowering and herbicide tolerance, which is to design PdbALS-sgRNA and PdbCEN-sgRNA, and use a base editor to knock out four genes, namely PdbALS1, PdbALS2, PdbCEN1, and PdbCEN2 in poplar, to obtain non-transgenic edited plants of Populus davidiana×Populus bolleana with advanced flowering time.

[0009] The specific steps of the cultivation method are as follows:

[0010] 1) Select the conserved regions of PdbALS1 and PdbALS2 as targets to design PdbALS-sgRNA targeting the two PdbALS genes; for the first exon of the PdbCEN1 and PdbCEN2 genes, design PdbCEN-sgRNA targeting the two PdbCEN genes;

[0011] 2) Construct a base editor, namely the pCAMBIA1300-35S::CBE vector;

[0012] 3) Construct the AtU3d::PdbALS and AtU3d::PdbCEN expression cassettes with PdbALS-sgRNA and PdbCEN-sgRNA, and at the same time connect them to the pCAMBIA1300-35S::CBE vector to obtain the pCAMBIA1300-AtU3b::ALS-AtU3b::CEN-35S::CBE vector;

[0013] 4) Transfer the pCAMBIA1300-AtU3b::ALS-AtU3b::CEN-35S::CBE vector into Agrobacterium, and then transform the leaves of Populus davidiana × Populus bolleana;

[0014] 5) Cultivate the transformed leaves of Populus davidiana × Populus bolleana and screen them with herbicides to obtain non-transgenic edited plants of Populus davidiana × Populus bolleana with earlier flowering time and herbicide tolerance.

[0015] The PdbALS-sgRNA sequence is: CAGGTTCCGCGGCGAATGAT,

[0016] The PdbCEN-sgRNA sequence is: AACTCAAAAACCTAAAGTTG.

[0017] The Agrobacterium is EHA105metA-.

[0018] The construction method of the pCAMBIA1300-35S::CBE vector is to ligate the APOBEC3A Y130F-xten fragment, linker-µgI-linker-NLS fragment and Cas9(D10A)-NLS fragment, and replace the aminoglycoside phosphotransferase HygR gene in the pCambia1300 vector to obtain the pCAMBIA1300-35S::CBE vector;

[0019] The nucleotide sequence of the APOBEC3A Y130F-xten fragment is as shown in SEQ ID NO.5;

[0020] The nucleotide sequence of the linker-µgI-linker-NLS fragment is as shown in SEQ ID NO.6;

[0021] The nucleotide sequence of the Cas9(D10A)-NLS fragment is as shown in SEQ ID NO.7.

[0022] A method for cultivating non-transgenic poplar with herbicide tolerance, design PdbALS-sgRNA, use the base editor based on CRISPR / Cas to knockout the PdbALS1 and PdbALS2 genes in poplar, and obtain non-transgenic edited plants of Populus davidiana × Populus bolleana with herbicide tolerance.

[0023] The specific steps of the cultivation method are as follows:

[0024] 1) Select the conserved regions of PdbALS1 and PdbALS2 as targets to design PdbALS-sgRNA targeting the two PdbALS genes;

[0025] 2) Construct a base editor, namely the pCAMBIA1300-35S::CBE vector;

[0026] 3) Insert the AtU3d::PdbALS expression cassette constructed with PdbALS-sgRNA into the pCAMBIA1300-35S::CBE vector to obtain the pCAMBIA1300-AtU3b::ALS-35S::CBE vector;

[0027] 4) Transfer the pCAMBIA1300-AtU3b::ALS-35S::CBE vector into Agrobacterium, and then transform the leaves of Populus davidiana × P. bolleana;

[0028] 5) Cultivate the transformed Populus davidiana × P. bolleana leaves and screen them with herbicides to obtain non-transgenic edited Populus davidiana × P. bolleana plants with herbicide tolerance.

[0029] The PdbALS-sgRNA sequence is: CAGGTTCCGCGGCGAATGAT.

[0030] The Agrobacterium is EHA105metA-.

[0031] The construction method of the pCAMBIA1300-35S::CBE vector is to ligate the APOBEC3A Y130F-xten fragment, the linker-µgI-linker-NLS fragment and the Cas9(D10A)-NLS fragment, and replace the aminoglycoside phosphotransferase HygR gene in the pCambia1300 vector to obtain the pCAMBIA1300-35S::CBE vector;

[0032] The nucleotide sequence of the APOBEC3A Y130F-xten fragment is as shown in SEQ ID NO.5;

[0033] The nucleotide sequence of the linker-µgI-linker-NLS fragment is as shown in SEQ ID NO.6;

[0034] The nucleotide sequence of the Cas9(D10A)-NLS fragment is as shown in SEQ ID NO.7.

[0035] Compared with the prior art, the beneficial effects of the present invention are:

[0036] 1) The present invention only relies on a single base editor (CBE) to achieve the co-editing of the ALS gene and the target gene, reducing the complexity of the gene editing system and improving the operability of the experiment.

[0037] 2) The present invention uses a nutritional mutant Agrobacterium (EHA105metA-), prolongs the co-cultivation time, enables the gene editing tool to be continuously expressed in poplar cells. Under the condition of prolonging the co-cultivation for 20 days, the emergence frequency of chlorsulfuron-resistant buds is 3-4 times that of the traditional 2-day co-cultivation method. It overcomes the problem of low transient expression efficiency, greatly improves the gene editing efficiency in the non-transgenic manner, and enables more plants to successfully obtain gene improvement without relying on the integration of exogenous DNA.

[0038] 3) The present invention successfully obtains CEN1-knockout poplars by a non-transgenic method. The edited plants show morphological characteristics such as multiple branches, small round leaves at the branch tips, and flower bud structures appear in the leaf axils and at the stem tips, and can bloom within 1 month. At the same time, various morphological poplar flower structures are observed under the microscope; after treatment with chlorsulfuron, the edited plants show obvious resistance to sulfonylurea herbicides. It significantly shortens the breeding cycle compared with the traditional method, not only improves the editing efficiency, but also optimizes the co-editing method of ALS and the target gene, and at the same time avoids the policy restrictions brought by the traditional transgenic strategy, providing strong support for the rapid genetic improvement and industrial application of poplars. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Schematic diagram of sgRNA design for PdbALS gene;

[0040] Figure 2 Schematic diagram of sgRNA design for PdbCEN gene;

[0041] Figure 3 Binary vector diagram for base editing in poplar;

[0042] Figure 4 GUS staining map of Populus davidiana×Populus bolleana leaves;

[0043] Figure 5 Comparison diagram of chlorsulfuron-resistant adventitious bud formation under 20-day and 2-day co-cultivation conditions (left figure is 20 days, right figure is 2 days);

[0044] Figure 6 Sequencing analysis map of PdbALS1 and PdbALS2 targets in L4-ALS strain;

[0045] Figure 7 Sequencing analysis map of PdbCEN1 and PdbCEN2 targets in L8-ALS / CEN strain;

[0046] Figure 8 PCR electrophoresis analysis map of non-transgenic strains (WT is wild-type control, L1, L3, L4, L6, L7, L10 are transgenic edited plants, L2, L5, L8, L9 are non-transgenic edited plants);

[0047] Figure 9 Phenotype diagram of early flowering plants of non - transgenic lines

[0048] Figure 10 Flower structure diagram under a stereomicroscope

[0049] Figure 11 Growth status diagram of non - chimeric edited lines regenerated on a medium containing 15 μg / L chlorsulfuron (+ indicates that 15 μg / L chlorsulfuron was added to the medium, - represents that no chlorsulfuron was added to the medium). Detailed implementation manners

[0050] To make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified in detail, the technical means used are all conventional means well known to those skilled in the art.

[0051] Example 1 Gene editing

[0052] In this example, base editing technology was used to edit the PdbALS1, PdbALS2, PdbCEN1 and PdbCEN2 genes in Populus davidiana × Populus bolleana to obtain non - transgenic mutants. The specific steps are as follows:

[0053] 1. Design of sgRNA for ALS gene

[0054] Design principle: The conserved regions of PdbALS1 and PdbALS2 were selected as targets (the nucleotide sequences of the PdbALS1 gene and PdbALS2 gene covering the target regions are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively). PdbALS - sgRNA (CAGGTTCCGCGGCGAATGAT) targeting the two PdbALS genes was designed. The specific cytosine (C) in the targeting sequence undergoes C - to - T conversion after CBE editing. If C7 or C8 mutates, it will lead to the amino acid substitution of P177S or P177L, thereby conferring resistance of the plant to sulfonylurea herbicides ( Figure 1 )

[0055] The target sequence primers are as follows:

[0056] PdbALS1 - P1: 5’ - GTCACAGGTTCCGCGGCGAATGAT - 3’,

[0057] PdbALS1 - P2: 5’ - AAACATCATTCGCCGCGGAACCTG - 3’;

[0058] PdbALS2-P1: 5'-GTCACAGGTTCCGCGGCGAATGAT-3',

[0059] PdbALS2-P2: 5'-AAACATCATTCGCCGCGGAACCTG-3'.

[0060] 2. sgRNA Design of CEN Gene

[0061] Design principle: For the first exons of PdbCEN1 and PdbCEN2 (the nucleotide sequences of the PdbCEN1 gene and PdbCEN2 gene covering the target regions are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively), design PdbCEN-sgRNA (AACTCAAAAACCTAAAGTTG) targeting the two PdbCEN genes. The C-to-T conversion will introduce a premature termination codon in this region, thereby inactivating the CEN1 / CEN2 genes and promoting the plants to flower earlier ( Figure 2 )

[0062] The target sequence primers are as follows:

[0063] PdbCEN1-P1: 5'-GTCAACTCAAAAACCTAAAGTTG-3',

[0064] PdbCEN1-P2: 5'-AAACCAACTTTAGGTTTTTGAGT-3';

[0065] PdbCEN2-P1: 5'-GTCAACTCAAAAACCTAAAGTTG-3',

[0066] PdbCEN2-P2: 5'-AAACCAACTTTAGGTTTTTGAGT-3'.

[0067] 3. Vector Construction

[0068] 1) Construct the pCAMBIA1300-35S::CBE plasmid

[0069] First, the APOBEC3A Y130F-xten (SEQ ID NO.5) and linker-µgI-linker-NLS (SEQ ID NO.6) fragments were optimized according to the codon preference of Populus alba. In addition, the Cas9(D10A)-NLS fragment (SEQ ID NO.7) was obtained from the commonly used Cas9 gene by site-directed mutagenesis. Then, these three DNA fragments were amplified using Phanta Flash MasterMix. After recovery, they were recombined using the ClonExpress Ultra One Step Cloning Kit, and the above three DNA fragments were combined together to replace the aminoglycoside phosphotransferase (HygR) gene in the pCambia1300 vector, and finally the pCAMBIA1300-35S::CBE vector, that is, the base editor used in this application, was obtained ( Figure 3 ).

[0070] The sequences of the amplification primers are as follows:

[0071] APOBEC3A Y130F-xten-P1:

[0072] 5’-ctctctacaaatctatctctATGGAAGCATCTCCTGCTTCAG-3’,

[0073] APOBEC3A Y130F-xten-P2:

[0074] 5’-cttgtcCTTAAGCTCTGGAGTAGCGGACTC-3’;

[0075] linker-µgI-linker-NLS-P1:

[0076] 5’-gaagACTAGAGATTCTGGTGGTTCTACTAATCTT-3’,

[0077] linker-µgI-linker-NLS-P2:

[0078] 5’-acagatccggtcggcatctaAACCTTTCTTTTCTTCTTTGGTGAA-3’;

[0079] Cas9(D10A)-NLS-P1:

[0080] 5’-ctccagagcttaagGACAAGAAGTACTCCATCGGCC-3’,

[0081] Cas9(D10A)-NLS-P2:

[0082] 5’-caccagaatctctagtCTTCTTTTTCTTAGCCTGTCCGG-3’.

[0083] 2) Construction of pCAMBIA1300-AtU3b::ALS-AtU3b::CEN-35S::CBE plasmid

[0084] First, insert PdbALS-sgRNA and PdbCEN-sgRNA into the BsaI site of pYLsgRNA-AtU3d plasmid respectively to construct AtU3d::PdbALS and AtU3d::PdbCEN expression cassettes. Amplify the AtU3d::PdbALS expression cassette using PdbALS cassette-P1 and PdbALS cassette-P2 primers, and amplify the AtU3d::PdbCEN expression cassette using PdbCEN cassette-P1 and PdbCEN cassette-P2 primers, and perform double digestion with XbaI + BsaI and EcoRI + BsaI respectively. Subsequently, ligate the two digested expression cassette fragments into the XbaI and EcoRI sites of pCAMBIA1300-35S::CBE vector. Finally, construct the pCAMBIA1300-AtU3b::ALS-AtU3b::CEN-35S::CBE vector that can target four genes, namely PdbALS1, PdbALS2, PdbCEN1, and PdbCEN2.

[0085] 3) Construction of pCAMBIA1300-AtU3b::ALS-35S::CBE plasmid

[0086] First, insert PdbALS-sgRNA into the BsaI site of pYLsgRNA-AtU3d plasmid to construct the AtU3d::PdbALS expression cassette. Subsequently, amplify the AtU3d::ALS expression cassette and insert it into the XbaI and EcoRI sites of pCAMBIA1300-35S::CBE vector. Finally, construct the pCAMBIA1300-AtU3b::ALS-35S::CBE vector that can target two genes, namely PdbALS1 and PdbALS2.

[0087] The sequences of amplification primers are as follows:

[0088] PdbALS cassette-P1:

[0089] 5’-gctctagaATCGGCAGCAAAGGA-3’,

[0090] PdbALS cassette - P2:

[0091] 5’ - agcgtgggtctcgtcagTCCATCCACTCCAAGCTC - 3’;

[0092] PdbCEN cassette - P1:

[0093] 5’ - ttcagaggtctctctgaATCGGCAGCAAAGGA - 3’,

[0094] PdbCEN cassette - P2:

[0095] 5’ - cggaattcTCCATCCACTCCAAG - 3’.

[0096] Example 2 Agrobacterium - mediated transient expression

[0097] Use EHA105metA - (purchased from Intact Genomics) carrying pCAMBIA1305 - GUS to transform the leaf discs of Populus davidiana × Populus bolleana, and the specific steps are as follows:

[0098] 1. Bacterial culture and induction

[0099] Culture EHA105metA - in LB liquid medium containing 50 mg / L kanamycin until OD 600 ≈1.0. Wash and resuspend the bacteria with MS liquid medium, and induce for 12 hours after adding acetosyringone (AS, 20 mg / L) and methionine (200 mg / L).

[0100] 2. Leaf disc pretreatment

[0101] Take leaf discs of Populus davidiana × Populus bolleana at 4 - 6 weeks old (with an area of about 1.5 cm²), soak them in the bacterial suspension for 10 minutes, and then blot the surface liquid dry with sterilized blotting paper.

[0102] 3. Co - culture and primary culture

[0103] Transfer the leaf discs to the differentiation medium (MS, 6 - BA 0.4 mg / L, NAA 0.1 mg / L, TDZ 0.01 mg / L, pH 5.8, supplemented with AS 20 mg / L and methionine 200 mg / L), and co - culture in the dark for 48 hours (23 °C).

[0104] 4. Extended co - culture

[0105] Subsequently, the leaf discs were transferred to a differentiation medium containing 10 mg / L methionine and cultured for another 18 days under the condition of 16 h light / 8 h dark. During this process, a control of the conventional transformation method was set: the control group was transferred to a differentiation medium containing 200 mg / L ticarcillin after 48 h of dark culture.

[0106] 5. Staining

[0107] The leaf discs were stained by histochemistry to monitor the transient expression efficiency of GUS mediated by the two methods.

[0108] The results were as Figure 4 shown. The method of prolonging co-culture maintained GUS activity up to 20 days; while using the conventional transformation method, GUS activity decreased rapidly after adding ticarcillin to inhibit bacteria.

[0109] Example 3 Genetic transformation of Populus davidiana × P. bolleana

[0110] 1. Electrotransformation and resuscitation culture of Agrobacterium competent cells

[0111] Inoculate a single colony of EHA105metA- into 5 mL of LB medium and culture it overnight at 28 °C with shaking at 220 rpm. The next day, take an appropriate amount of the bacterial solution (0.5–1 mL) and inoculate it into 50 mL of medium, and continue to culture until the OD 600 reaches 0.5–0.8 to ensure that the cells are in the logarithmic growth phase. Centrifuge the culture solution at 6000 rpm for 10 minutes at 4 °C, and discard the supernatant. Resuspend the cells with ice-cold 10% glycerol and repeat the centrifugation and washing 2–3 times. This step helps to remove the ions in the medium and reduce the damage to the cells during electroporation. Finally, suspend the cells in a small amount (0.5–1 mL) of ice-cold 10% glycerol, aliquot and quickly freeze and store at -80 °C.

[0112] The electroporation cuvette, competent cells and plasmid DNA need to be pre-cooled on ice in advance. In an ice-cold centrifuge tube, take about 100 µL of competent cells and add 1–2 µL of high-purity plasmid DNA (pCAMBIA1300-AtU3b::ALS-AtU3b::CEN-35S::CBE and pCAMBIA1300-35S::CBE vector plasmids) (50–100 ng). Gently mix well, avoiding violent oscillation to generate bubbles. Transfer the mixture to a pre-cooled electroporation cuvette, ensuring that there are no bubbles in the liquid, otherwise it may cause electric breakdown or reduce the transformation efficiency. Common parameters: voltage 2.2–2.5 kV, 200 Ω resistance, 25 µF capacitance, and the pulse duration is usually about 5 milliseconds. There will be an instantaneous discharge during electroporation, and the next step should be carried out immediately after completion.

[0113] Immediately after the electroporation is completed, add approximately 1 mL of liquid LB medium without antibiotics to the electroporation cup and gently pipette to mix well. Transfer the mixture to a centrifuge tube or petri dish and incubate it with shaking at 28 °C for 2 - 3 hours to allow the Agrobacterium to repair the damaged cell membrane during electroporation and start expressing the resistance gene.

[0114] 2. Screening and identification of transformed bacteria

[0115] Appropriately spread the resuscitated bacterial solution on an LB plate containing appropriate selective antibiotics (kanamycin and rifampicin). Keep the culture temperature at 28 °C. After 2 - 3 days, pick well - growing single colonies and inoculate them into a liquid medium for amplification culture.

[0116] 3. Pretreatment of leaf discs

[0117] Take leaf discs of 4 - 6 - week - old Deutzia crenata (with an area of approximately 1.5 cm²), soak them in the bacterial suspension for 10 minutes, and then blot the surface liquid dry with sterilized blotting paper.

[0118] 4. Co - culture and primary culture

[0119] Transfer the leaf discs to a differentiation medium (MS, 6 - BA 0.4 mg / L, NAA 0.1 mg / L, TDZ 0.01 mg / L, pH 5.8, supplemented with AS 20 mg / L and methionine 200 mg / L), and co - culture them at 23 °C in the dark for 48 hours (2 days).

[0120] 5. Extended co - culture

[0121] Subsequently, transfer the leaf discs to a differentiation medium containing 10 mg / L methionine and continue to co - culture them for 20 days under the condition of 16 - hour light / 8 - hour dark; then transfer the leaf discs to a differentiation medium containing 15 μg / L chlorsulfuron and continue to culture for 1 month to produce resistant buds.

[0122] The results are as Figure 5 shown. Under the condition of extended co - culture for 20 days, the emergence frequency of chlorsulfuron - resistant buds is 3 - 4 times that of the traditional 2 - day co - culture method.

[0123] Example 4 Identification of gene - edited plants

[0124] 1. Target site sequencing

[0125] Specific primers were designed for the PdbALS1, PdbALS2 editing regions and the PdbCEN1, PdbCEN2 editing regions of the regenerated Populus davidiana × Populus bolleana plants after genetic transformation, and the PdbALS1, PdbALS2, PdbCEN1, and PdbCEN2 fragments were amplified by PCR. The PCR amplification products were gel recovered and directly sequenced to confirm the editing of ALS and CEN. The primer sequences are shown below:

[0126] PdbALS1-F: 5'-ACAGTGAGATAGCGTCCCAATAGTGG-3',

[0127] PdbALS1-R: 5'-GCCAATCTCGACAAATAACCAGGCAA-3';

[0128] PdbALS2-F: 5'-GGCTACTCTCACAAGATCTAATAAAA-3',

[0129] PdbALS2-R: 5'-CTTGTAATTATGTTTGGTAATGGACC-3';

[0130] PdbCEN1-F: 5'-ATCACGTATCGATCATTTCACTGCAA-3',

[0131] PdbCEN1-R: 5'-CGATGTAAGAAAAAATACAAACATGT-3';

[0132] PdbCEN2-F: 5'-ATCACGAATTGATTATTTCACTCCAA-3',

[0133] PdbCEN2-R: 5'-CGATGTAAGTAACAGGAAATTACAAA-3'.

[0134] It should be noted that heterozygotes or chimeras of genome editing will show double peaks during gel cutting and sequencing, which cannot be directly distinguished. At this time, cloning and sequencing are required, and at least 10 independent clones are subjected to Sanger sequencing.

[0135] The results are as Figure 6 and Figure 7 shown. C-to-T base substitutions were detected in both the PdbALS gene and the PdbCEN gene in the transgenic line L4-ALS and the non-transgenic line L8-ALS / CEN.

[0136] 2. Non-transgenic detection

[0137] Design primer pairs for amplifying the nCas9 and sgRNA cassette on the T-DNA, and detect whether the transferred vector fragment exists in the edited plants. If there is a band amplified, it represents a transgenic plant; if there is no amplified band, it represents a non-transgenic plant. The primer sequences are as follows:

[0138] nCas9-F: 5'-GACAAGAAGTACTCCATCGGCC-3',

[0139] nCas9-R: 5'-CGAGGAGGTTGTCGAGATCA-3';

[0140] sgRNA-F: 5'-GTCACAGGTTCCGCGGCGAATGAT-3',

[0141] sgRNA-R: 5'-AAACCAACTTTAGGTTTTTGAGT-3'.

[0142] The results are as Figure 8 shown. Among the edited plants tested, WT is the wild-type control, L1, L3, L4, L6, L7, L10 are transgenic edited plants, and L2, L5, L8, L9 are non-transgenic edited plants.

[0143] 3. Phenotype observation

[0144] The non-transgenic edited plants were grown on the rooting medium for another 1 month and then transplanted to the greenhouse for growth observation.

[0145] The results are as Figures 9 - 11 shown. The edited plants showed morphological characteristics of multi-branching and small round leaves at the branch tips, and flower bud structures appeared in the leaf axils and at the stem tips, and they could flower within 1 month ( Figure 9 ), and at the same time, various morphological poplar flower structures were observed under the microscope ( Figure 10 ); after treatment with chlorsulfuron, the edited plants showed obvious resistance to sulfonylurea herbicides.

[0146] The above is only illustrative rather than restrictive for the present invention. Those of ordinary skill in the art understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all of them will fall within the protection scope of the present invention.

Claims

1. A method for cultivating early-flowering, herbicide-tolerant non-transgenic poplars, characterized in that: PdbALS-sgRNA and PdbCEN-sgRNA were designed, and base editors were used to knock out the four genes PdbALS1, PdbALS2, PdbCEN1 and PdbCEN2 in poplar trees to obtain non-transgenic edited Populus shanxin with early flowering time and herbicide tolerance.

2. The cultivation method according to claim 1, characterized in that The specific steps are: 1) Select the conserved regions of PdbALS1 and PdbALS2 as targets to design PdbALS-sgRNA targeting the two PdbALS genes; design PdbCEN-sgRNA targeting the first exons of PdbCEN1 and PdbCEN2 genes; 2) Optimize the poplar base editor, i.e., the pCAMBIA1300-35S::CBE vector; 3) PdbALS-sgRNA and PdbCEN-sgRNA were used to construct AtU3d::PdbALS and AtU3d::PdbCEN expression cassettes, and connected to the pCAMBIA1300-35S::CBE vector to obtain the pCAMBIA1300-AtU3b::ALS-AtU3b::CEN-35S::CBE vector; 4) The pCAMBIA1300-AtU3b::ALS-AtU3b::CEN-35S::CBE vector was transferred into Agrobacterium, and then transformed into Populus shanxin leaves; 5) The transformed Populus shanxin leaves were cultivated and screened with herbicides to obtain non-transgenic edited Populus shanxin plants with early flowering time and herbicide tolerance.

3. The cultivation method according to claim 2, characterized in that The PdbALS-sgRNA sequence is: CAGGTTCCGCGGCGAATGAT, The PdbCEN-sgRNA sequence is: AACTCAAAAACCTAAAGTTG.

4. The cultivation method according to claim 2, characterized in that: The Agrobacterium is EHA105metA-.

5. The cultivation method according to claim 2, characterized in that: The pCAMBIA1300-35S::CBE vector is constructed by connecting the APOBEC3A Y130F-xten fragment, the linker-µgI-linker-NLS fragment and the Cas9(D10A)-NLS fragment, and replacing the aminoglycoside phosphotransferase HygR gene in the pCambia1300 vector to obtain the pCAMBIA1300-35S::CBE vector; The nucleotide sequence of the APOBEC3A Y130F-xten fragment is shown in SEQ ID NO.5; The nucleotide sequence of the linker-µgI-linker-NLS fragment is shown in SEQ ID NO.6; The nucleotide sequence of the Cas9(D10A)-NLS fragment is shown in SEQ ID NO.

7.

6. A method for cultivating non-transgenic poplars with herbicide tolerance, characterized in that: PdbALS-sgRNA was designed, and the PdbALS1 and PdbALS2 genes in poplar were knocked out using CRISPR / Cas-based base editors to obtain non-transgenic edited plants of Populus shanxin with herbicide tolerance.

7. The cultivation method according to claim 6, characterized in that: The specific steps are: 1) Select the conserved regions of PdbALS1 and PdbALS2 as targets to design PdbALS-sgRNA targeting the two PdbALS genes; 2) Construction of base editor, i.e., pCAMBIA1300-35S::CBE vector; 3) The PdbALS-sgRNA constructed AtU3d::PdbALS expression cassette was inserted into the pCAMBIA1300-35S::CBE vector to obtain the pCAMBIA1300-AtU3b::ALS-35S::CBE vector; 4) The pCAMBIA1300-AtU3b::ALS-35S::CBE vector was transferred into Agrobacterium, and then transformed into Populus shanxin leaves; 5) The transformed Populus shanxin leaves were cultivated and screened with herbicides to obtain non-transgenic edited Populus shanxin plants with herbicide tolerance.

8. The cultivation method according to claim 6, characterized in that: The PdbALS-sgRNA sequence is: CAGGTTCCGCGGCGAATGAT.

9. The cultivation method according to claim 7, characterized in that: The Agrobacterium is EHA105metA-.

10. The cultivation method according to claim 7, characterized in that: The pCAMBIA1300-35S::CBE vector is constructed by connecting the APOBEC3A Y130F-xten fragment, the linker-µgI-linker-NLS fragment and the Cas9(D10A)-NLS fragment, and replacing the aminoglycoside phosphotransferase HygR gene in the pCambia1300 vector to obtain the pCAMBIA1300-35S::CBE vector; The nucleotide sequence of the APOBEC3A Y130F-xten fragment is shown in SEQ ID NO.5; The nucleotide sequence of the linker-µgI-linker-NLS fragment is shown in SEQ ID NO.6; The nucleotide sequence of the Cas9(D10A)-NLS fragment is shown in SEQ ID NO.7.