Pretreatment method for panda excrement DNA extraction and application
By rapidly freezing, crushing, freezing and sieving giant panda feces, the problem of extracting high-quality DNA from old feces is solved, the success rate of microsatellite classification is improved, and it is suitable for DNA extraction of fresh and old feces, achieving long-term preservation and space efficiency of samples.
Patent Information
- Application Number
- CN202510695131.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-28
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2045-05-28
AI Technical Summary
The prior art is difficult to effectively extract high-quality DNA from old feces of giant pandas, resulting in a decrease in the success rate of microsatellite classification, and pollution and humidity in the wild environment make DNA easy to degrade.
A pretreatment method is adopted, which includes quickly freezing, crushing, freezing, sieving the feces, sealing the treated samples in a glass test tube and freezing them in an ultra-low temperature refrigerator. This method does not require peeling off the mucosal layer on the surface of the feces, and can enrich DNA and improve sample stability.
This method can effectively enrich the DNA in giant panda feces, improve the success rate of microsatellite classification, and is suitable for DNA extraction of fresh and old feces. The treated samples can be stored for a long time, reducing storage space requirements.
Smart Images

Figure CN120210328A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a pretreatment method and application for extracting DNA from giant panda feces. Background Art
[0002] As a flagship species unique to China, the population protection and genetic research of the giant panda are important topics in biodiversity conservation. Due to its non-invasive sampling characteristics, feces are widely used in the individual identification and sex determination of giant pandas. The microsatellite genotyping technology based on the genomic DNA of the giant panda has become an important technical means for individual identification, kinship identification, and population genetic structure research of the giant panda. In the fourth national giant panda survey, the DNA microsatellite genotyping method for giant pandas was introduced for the first time. The application of this technology has significantly improved the accuracy of the assessment of the wild giant panda population size and realized the analysis of the genetic diversity of the wild population. Since the feces of giant pandas are different from those of ordinary mammals, the DNA in giant panda feces is mainly enriched in the surface mucosal layer, and only trace amounts of DNA are contained in the feces, while the DNA of ordinary mammals is mainly enriched in the feces. Therefore, this identification method requires directly stripping the surface mucosal layer of the feces for DNA extraction. However, the distribution area of wild giant pandas is wide, and it is difficult to obtain fresh feces. Moreover, the pretreatment technology for extracting DNA from old giant panda feces has the following disadvantages: 1. When conducting field surveys of giant pandas, the whole feces collected are usually stored frozen as a whole. Due to the large volume of giant panda feces, the space occupied is extremely large.
[0003] 2. It is difficult to obtain the intestinal epithelial exfoliated cells existing inside the giant panda feces: The feces of giant pandas are mainly composed of incompletely digested bamboo poles and bamboo leaves, and are wrapped with a layer of mucosa on the outside. In addition to the intestinal epithelial exfoliated cells existing in the surface mucosal layer of giant panda feces, a large number of intestinal epithelial exfoliated cells are also carried on the incompletely digested bamboo poles and bamboo leaves in the giant panda feces. However, the amount of intestinal epithelial exfoliated cells contained in each gram of giant panda feces is small, and it needs to be concentrated by pretreatment before extraction.
[0004] 3. At the same time, with the increase of the exposure time in the wild, due to reasons such as air drying and degradation, the surface mucosal layer of old feces becomes unclear, and sometimes it is difficult to observe with the naked eye. Some mucosal layers have been broken and are difficult to strip and utilize. Therefore, compared with fresh giant panda feces, the DNA concentration and quality obtained from old feces exposed in the wild are reduced, resulting in a significant decrease in the microsatellite genotyping success rate, which seriously restricts the practical application value of the microsatellite genotyping technology of fecal DNA in complex field environments. Moreover, the humidity of the wild environment where giant panda feces are located is relatively high, and there are various pollution sources, and the genomic DNA of giant pandas in feces is easily degraded.
[0005] In summary, obtaining a relatively high concentration of giant panda genomic DNA from aged feces as much as possible is one of the key issues to be solved to improve the success rate of microsatellite genotyping. Summary of the Invention
[0006] The object of the present invention is to provide a pretreatment method and application for extracting DNA from giant panda feces. The pretreatment method is efficient and simple, and the treated samples can be stored for a long time and can be used for microsatellite genotyping identification experiments.
[0007] In order to solve the problems existing in the prior art, the technical solutions adopted by the present invention are as follows: In the first aspect, the present invention provides a pretreatment method for extracting DNA from giant panda feces, including the following steps: Put the newly collected feces into a sterile sampling bag, quickly and completely freeze the sample until it is hard, then crush the feces, freeze-dry and sieve it. The powder under the sieve is placed in a glass test tube, and then sealed and stored in an ultra-low temperature freezer. The freeze-drying includes pre-freezing and analytical drying.
[0008] Furthermore, use an ultra-low temperature freezer to quickly and completely freeze the sample at -72 ± 1°C within 24 hours.
[0009] Furthermore, the pre-freezing temperature is -50 ± 1°C and stays for 6 ± 1 hours; the analytical drying starts from -50 ± 1°C and increases by 10 ± 1°C each time, stays for 63 ± 1 hours until 20 ± 1°C, and keeps warm for 3 ± 1 hours.
[0010] Furthermore, it also includes the following steps: The freeze-dried giant panda feces are sieved using a sieve mesh with a pore size of 30 - 40 meshes, preferably 35 meshes.
[0011] Preferably, the freeze-drying is carried out under vacuum conditions.
[0012] Furthermore, the storage temperature is -72°C to -60°C.
[0013] In the second aspect, the present invention provides a sample for extracting DNA from giant panda feces, which is processed by the method described in the first aspect above.
[0014] In the third aspect, the present invention provides a method for extracting DNA from giant panda feces. The method uses the extraction sample described in the second aspect above and extracts DNA using the QIAamp FAST DNA Stool Mini Kit (51604). The QIAamp FAST DNA Stool Mini Kit (51604) contains InhibitEX Buffer. The solid-liquid ratio of the extraction sample to InhibitEX Buffer is (0.05 - 0.12) g : (1 - 1.8) ml, preferably (0.08 - 0.10) g : (1.3 - 1.5) ml.
[0015] In the fourth aspect, the present invention provides the application of the DNA obtained by the extraction method described in the third aspect above in the microsatellite genotyping identification of giant panda feces.
[0016] In the fifth aspect, the present invention provides the application of the DNA obtained by the extraction method described in the third aspect above in the sex identification of giant pandas.
[0017] The advantages and beneficial effects of the present invention are as follows: The present invention uses a pretreatment method for giant panda feces that first rapidly freezes completely, then crushes, freeze-dries, and sieves. This method can enrich the DNA in the surface mucosal layer and trace DNA in the feces, without the need to strip the surface mucosal layer, saving time and effort. The pretreatment operation is simple and does not require the use of any reagents. The pretreated feces are small in volume, good in stability, easy to store, can be stored in the refrigerator for a long time for later use, and require little storage space. It can extend the effective storage period and service life of the sample, and provide technical support for the molecular and genetic research of giant pandas.
[0018] The method of the present invention is applicable to both fresh and aged feces for microsatellite genotyping identification. Compared with the traditional method of directly stripping the surface mucosal layer of feces for DNA extraction, the application effect of the method of the present invention in the microsatellite genotyping identification of aged feces DNA is better, and the genotyping success rate is higher.
[0019] The method of the present invention is applicable to the sex identification of giant pandas using aged giant panda feces. In combination with the method of the present invention, loci suitable for microsatellite genotyping identification of aged wild giant panda feces are screened, improving the efficiency of subsequent work. Description of the Drawings
[0020] Figure 1 PCR amplification of microsatellite locus gpz-47 for the DNA of giant panda FF feces (exposed for 3 days) extracted by the method described in Example 3, and the fluorescence capillary electrophoresis detection result map of the PCR product; Figure 2PCR amplification of the microsatellite locus gpz-06 using the DNA extracted from the FF feces of giant pandas (on the 3rd day of exposure) by the method described in Example 3, and the fluorescence capillary electrophoresis detection result diagram of the PCR product; Figure 3 PCR amplification of the microsatellite locus gpz-51 using the DNA extracted from the FF feces of giant pandas (on the 3rd day of exposure) by the method described in Example 3, and the fluorescence capillary electrophoresis detection result diagram of the PCR product; Figure 4 PCR amplification of the microsatellite locus gpz-20 using the DNA extracted from the FF feces of giant pandas (on the 3rd day of exposure) by the method described in Example 3, and the fluorescence capillary electrophoresis detection result diagram of the PCR product; Figure 5 PCR amplification of the microsatellite locus GPL-60 using the DNA extracted from the FF feces of giant pandas (on the 3rd day of exposure) by the method described in Example 3, and the fluorescence capillary electrophoresis detection result diagram of the PCR product; Figure 6 PCR amplification of the microsatellite locus GPL-08 using the DNA extracted from the FF feces of giant pandas (on the 3rd day of exposure) by the method described in Example 3, and the fluorescence capillary electrophoresis detection result diagram of the PCR product; Figure 7 PCR amplification of the microsatellite locus GPL-44 using the DNA extracted from the FF feces of giant pandas (on the 3rd day of exposure) by the method described in Example 3, and the fluorescence capillary electrophoresis detection result diagram of the PCR product; Figure 8 PCR amplification of the microsatellite locus gpy-05 using the DNA extracted from the FF feces of giant pandas (on the 3rd day of exposure) by the method described in Example 3, and the fluorescence capillary electrophoresis detection result diagram of the PCR product; Figure 9 PCR amplification of the microsatellite locus gpy-20 using the DNA extracted from the FF feces of giant pandas (on the 3rd day of exposure) by the method described in Example 3, and the fluorescence capillary electrophoresis detection result diagram of the PCR product; Figure 10 PCR amplification of the microsatellite locus GPL-31 using the DNA extracted from the FF feces of giant pandas (on the 3rd day of exposure) by the method described in Example 3, and the fluorescence capillary electrophoresis detection result diagram of the PCR product; Figure 11 The number of successfully genotyped microsatellite loci in the fecal samples of experimental group 1 and control group 3 of two pandas at different exposure times. In the figure: a is the exposure days of sample FF; b is the exposure days of sample DL; Figure 12This is a graph of SYR gene electrophoresis detection; in the graph: Marker: DL2000; Lane 1: male control; Lane 2: DL; Lane 3: FF; Lane 4: LL; Lane 5: JM; Lane 6: XL; Lane 7: HZ; Lane 8: female control; Figure 13 The typing success rate of different microsatellite loci in the fecal DNA of 30 wild giant pandas; Figure 14 Fresh manure for enclosure; Figure 15 For old feces in the wild; Figure 16 This is the feces sample after pretreatment in Example 1. DETAILED DESCRIPTION
[0021] The following will be combined with the drawings in the embodiments of the present application to clearly describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments in the present application belong to the scope of protection of this application.
[0022] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0023] Example 1 This embodiment provides a pretreatment method for extracting DNA from old giant panda feces, comprising the following steps: ①Put the newly collected old giant panda feces into a sterile sampling bag, place it in an ultra-low temperature refrigerator, and quickly and completely freeze the sample at -72℃ within 24 hours.
[0024] ②Then use a hammer to knock the feces into pieces through the sterile bag.
[0025] ③ Freeze-dry the fragments under vacuum conditions using freeze-drying equipment. Freeze-drying includes pre-freezing and analytical drying. The temperature in the pre-freezing stage is -50°C and stays for 6 hours. The analytical drying stage starts from -50°C and increases by 10°C each time, stays for 63 hours, until it reaches 20°C and is kept warm for 3 hours. The entire processing time is about 72 hours.
[0026] The freeze-drying equipment used in this embodiment is the LGJ-100FG ordinary in-situ silicone oil freeze dryer of Beijing Yaxing Yike Technology Development Co., Ltd. The technical parameters are as follows: Freeze-drying area: 1.04㎡; Cold trap temperature: -75℃ (no load); Shelf temperature range: -50℃ to +70℃, temperature control accuracy ±1℃; Ultimate vacuum degree: ≤5Pa (no load); Water capture capacity: 15Kg / 24h (ordinary type) or 15Kg (some parameters do not mark the time unit); Cooling method: air cooling (room temperature ≤25℃); Power supply: 380V / 50Hz; Total machine power: 6500W; Overall dimensions: 1150×830×1620mm; Divider parameters: layer spacing 70mm, number of divider layers 61, divider size 480×360mm.
[0027] ④Sieve the freeze-dried fragments through a 35-mesh aperture sieve, place the sieved powder in a glass test tube and seal it, and store it in a ultra-low temperature refrigerator at -72℃. The obtained giant panda fecal powder is as Figure 16 shown, and this powder can be used as a sample for extracting giant panda fecal DNA.
[0028] Example 2 This embodiment provides a pretreatment method for extracting DNA from fresh giant panda feces. The difference between this embodiment and Example 1 is only that it pre-treats fresh giant panda feces, and the rest are the same as in Example 1.
[0029] Comparative Example 1 This comparative example provides a pretreatment method for extracting DNA from old giant panda feces, including the following steps: ①Put the newly collected old giant panda feces into a sterile sampling bag, place it in a ultra-low temperature refrigerator, and quickly and completely freeze the sample within 24 hours at -72℃.
[0030] ②Then use a hammer to crush the feces through the sterile bag; ③Put the crushed feces into a glass test tube and seal it, and store it in a ultra-low temperature refrigerator at -72℃.
[0031] Example 3 This embodiment provides a method for extracting giant panda fecal DNA, including the following steps: Using the fecal powder obtained in Example 1 as a sample, adopt the QIAamp FAST DNA Stool Mini Kit (51604) kit for DNA extraction. In this embodiment, the usage amount of the fecal sample in step 1 and the usage amount of InhibitEX Buffer in step 2 of the kit instructions are improved. The usage amount of the fecal sample in step 1 of this embodiment is 0.1g, and the usage amount of InhibitEX Buffer in step 2 is 1.5ml. The rest of the steps are carried out according to the kit instructions.
[0032] Example 4 This example provides a method for extracting DNA from giant panda feces. The difference between this example and Example 3 is only that the amount of the extraction sample is 0.08 g, and the rest is the same as in Example 3.
[0033] Example 5 This example provides a method for extracting DNA from giant panda feces. The difference between this example and Example 3 is only that the amount of the extraction sample is 0.11 g, and the rest is the same as in Example 3.
[0034] Example 6 This example provides a method for extracting DNA from giant panda feces. The difference between this example and Example 3 is only that the powder obtained in Example 2 is used as the sample, and the rest is the same as in Example 3.
[0035] Comparative Example 2 This comparative example provides a method for extracting DNA from giant panda feces. The difference between this comparative example and Example 3 is only that the fecal sample obtained in Comparative Example 1 is used as the sample for extraction, and the rest is the same as in Example 3.
[0036] Comparative Example 3 This comparative example provides a method for extracting DNA from giant panda feces. The difference between this comparative example and Example 3 is only that this comparative example operates completely according to the instructions of the QIAamp FAST DNA Stool Mini Kit (51604). The amount of the fecal sample is 0.18 g, and the amount of InhibitEX Buffer is 1.0 ml.
[0037] Comparative Example 4 Using the SDS-CTAB method, the fecal sample obtained in Example 1 is used as the sample for extraction. The steps are as follows: Take 0.1 g of freeze-dried feces, add 950 ul of TE, 50 ul of 10% SDS, and 50 uL of 20 mg / ml proteinase K. After mixing, incubate at 37 °C for 1 h. Then add 150 ul of 5 mol / L NaCl and 150 ul of CTAB. After mixing, incubate at 65 °C for 20 min.
[0038] ② Add an equal volume of chloroform-isoamyl alcohol (volume ratio 24:1), gently invert and mix for 10 minutes. Centrifuge (12000×g, 10 min, 4 °C), and transfer the supernatant to a clean centrifuge tube.
[0039] ③ Add 1 volume of isopropanol, gently invert and mix, and let stand at -20 °C for 30 minutes. Centrifuge (12000×g, 15 min, 4 °C), discard the supernatant, and retain the DNA precipitate.
[0040] ④ Wash the precipitate twice with 1 mL of 70% ethanol by mass concentration, dry it after centrifugation. Dissolve it in 50 - 100 μL of TE buffer after drying.
[0041] Comparative Example 5 This comparative example provides a method for extracting DNA from giant panda feces, including the following steps: Place the whole fresh giant panda feces in a sterile box, strip the epidermal mucosa of the fresh giant panda feces with sterile forceps, place the stripped epidermal mucosa of the feces in a 2 ml ep tube, and then use the QIAamp FAST DNA Stool Mini Kit (51604) kit to extract DNA with the stripped epidermal mucosa of the feces as the sample. The dosage of the epidermal mucosa in this comparative example is 0.2 g, and the dosage of InhibitEX Buffer is 1.5 ml. The remaining steps are the same as those in Example 6.
[0042] Experimental Example 1 The influence of different pretreatment methods on the success rate of microsatellite genotyping identification of giant panda feces is as follows: (I) Experimental method The experimental site is the Dujiangyan Base of China Conservation and Research Center for the Giant Panda. Collect fecal samples from 2 adult captive giant pandas (FF: female, DL: male) respectively, place the samples in the bamboo forest (temperature 5.5℃ - 11.6℃, humidity 58.7 - 69.2%) to simulate the wild fecal environment, and collect fecal samples at 0, 3, 7, 14, 21, and 28 days respectively. As Figure 14 shown, the feces collected within 2 hours after defecation on the 0th day of the giant panda are captive fresh feces. As Figure 15 shown, the feces placed in the simulated wild fecal environment for 3 - 28 days are all stale feces. Divide the fresh fecal samples of the two pandas collected on the 0th day into 2 equal parts respectively. One part is used to extract DNA according to the method described in Example 6; one part is used to extract DNA according to the method described in Comparative Example 5; divide the stale feces of the two pandas collected on the 3rd, 7th, 14th, 21st, and 28th days into 6 equal parts respectively. One part is used to extract DNA according to the method described in Comparative Example 2; the remaining 5 parts are used to extract DNA according to the methods of Examples 3 - 5 and Comparative Examples 3 - 4 respectively. The specific experimental grouping is as follows: Experimental grouping: Experimental Group 1: Extract DNA from giant panda feces according to the method described in Example 3. Experimental Group 2: Extract DNA from giant panda feces according to the method described in Example 4. Experimental Group 3: Extract DNA from giant panda feces according to the method described in Example 5. Experimental group 4: Extract DNA from giant panda feces according to the method described in Example 6; Control group 1: Extract DNA from giant panda feces according to the method described in Comparative Example 3; Control group 2: Extract DNA from giant panda feces according to the method described in Comparative Example 4; Control group 3: Extract DNA from giant panda feces according to the method described in Comparative Example 5; Control group 4: Extract DNA from giant panda feces according to the method described in Comparative Example 2.
[0043] Since the DNA extracted from blood samples has good stability and the results obtained from subsequent microsatellite genotyping identification are highly accurate. Therefore, the DNA samples extracted from the blood samples of 2 giant pandas are subjected to microsatellite genotyping identification in the same batch as the fecal samples. The microsatellite genotyping results obtained from the blood DNA are used as the standard values to judge whether the microsatellite genotyping results of the fecal DNA samples are correct.
[0044] Using the obtained DNA samples as templates, PCR amplification is carried out with multiple groups of microsatellite primers. The PCR amplification system is: Premix Taq (TaKaRa Taq Verison 2.0 plus dye) 12.5ul, 1ul of each upstream and downstream primer, 2ul of DNA template, and 9.5ul of ddH2O. The PCR reaction program is: 95°C for 10 min; 95°C for 30 s, annealing temperature for 30 s, 72°C for 30 s, for a total of 37 cycles; 72°C extension for 10 min. Each sample is subjected to PCR testing three times. If the three results are inconsistent, the result is judged invalid. The obtained PCR products are sent to Tsingke Biotechnology Co., Ltd. for genotyping, and the software GeneMapper 4.0 and the internal molecular standard ROX-500 are used to determine the number of alleles and the allele size of the samples respectively. The microsatellite primers and annealing temperatures are shown in Table 1: Table 1 Information on microsatellite primers of giant pandas
[0045] (2) Results: The microsatellite locus typing results of the feces of two giant pandas are shown in Tables 2 and 3: Table 2
[0046]
[0047]
[0048] Note: " / " indicates no result.
[0049] Table 3
[0050]
[0051] Note: " / " indicates no result.
[0052] As can be seen from Tables 2 and 3, the DNA samples extracted from the blood of two giant pandas have the same genotyping results for all detected microsatellite loci as the samples collected on Day 0 of Experimental Group 4 and Control Group 3, indicating that the giant panda fecal DNA extracted by the method of the present invention is suitable for microsatellite locus genotyping identification. That is, the method of the present invention is also applicable to the microsatellite genotyping identification of DNA in fresh giant panda feces.
[0053] As Figures 1 to 10 shown, microsatellite PCR amplification was performed on the DNA of the giant panda FF feces (exposed for 3 days) extracted from Experimental Group 1. The PCR products had clear genotyping bands by capillary electrophoresis, few heterozygous peaks, and high result accuracy. Figures 1 to 10 Among them are microsatellite loci (A) gpz-47, (B) gpz-06, (C) gpz-51, (D) gpz-20, (E) GPL-60 (F) GPL-08 (G) GPL-44 (H) gpy-05 (I) gpy-20 (J) GPL-31.
[0054] As Figure 11 shown, analysis of the number of successfully genotyped microsatellite loci in the fecal samples of Experimental Group 1 and Control Group 3 of two giant pandas at different exposure times found that in both cases, as the exposure time increased, the number of successfully genotyped loci decreased.
[0055] As Figure 11 shown in a, for the giant panda FF fecal samples in Experimental Group 1 at exposure times of 3, 7, 14, 21, and 28 days, the number of microsatellite loci that could be successfully detected in the experimental group samples were 10, 8, 6, 4, and 3 respectively, and the number of microsatellite loci that could be successfully detected in the Control Group 3 samples were 8, 4, 2, 1, and 0 respectively.
[0056] As Figure 11 shown in b, for the giant panda DL fecal samples in Experimental Group 1 at exposure times of 3, 7, 14, 21, and 28 days, the number of microsatellite loci that could be successfully detected in the experimental group samples were 10, 10, 8, 7, and 5 respectively, and the number of microsatellite loci that could be successfully detected in the Control Group 3 samples were 8, 8, 6, 2, and 2 respectively.
[0057] The above results show that at the same exposure days, the number of successfully detected microsatellite loci in Experimental Group 1 using the present invention is greater than that in Control Group 3, indicating that the present invention can improve the microsatellite genotyping success rate of DNA samples extracted from aged feces.
[0058] For experimental groups 1, 2, and 3, DNA was extracted using different aged fecal samples. For all the aged fecal samples of giant pandas FF and DL in experimental groups 2 and 3, 2 - 3 loci could not be successfully detected. For giant pandas FF and DL in experimental group 1, all loci could be successfully detected on the 3rd day of exposure. In control groups 1, 2, and 4, 5, 10, and 5 loci respectively could not be successfully detected, indicating that the DNA extraction method of the present invention can improve the success rate of microsatellite genotyping of DNA samples.
[0059] For experimental group 4, DNA was extracted using fresh fecal samples of giant pandas FF and DL, and 10 loci were successfully detected. While for control group 3, when DNA was extracted using fresh fecal samples of giant pandas FF and DL, 1 locus could not be successfully detected. This shows that by using the method of the present invention, whether it is fresh feces or aged feces, the success rate of microsatellite genotyping of DNA samples can be improved. When the dosage of "0.1 g of fecal sample and 1.5 ml of InhibitEX Buffer" is used, the success rate of microsatellite genotyping of NA samples can be effectively improved.
[0060] Experimental Example 2 The pretreatment method for extracting DNA from aged giant panda feces and the application of the extracted DNA in the sex identification of giant pandas are as follows: 1. Experimental animals Six different individual captive giant panda aged feces (3 days after field exposure) were selected for DNA extraction respectively. The sample information of the above six giant pandas is shown in Table 4: Table 4
[0061] 2. Experimental grouping and methods: Experimental group 1: DNA was extracted from the feces of the above six adult captive giant pandas (3 days after field exposure) according to the method described in Example 3; Control group 1: DNA was extracted from the aged feces of the above six giant pandas (3 days after field exposure) respectively according to the following method: The collected aged feces of giant pandas were directly stored as a whole in an ultra - low temperature refrigerator for more than 6 months. Before DNA extraction, it was placed at room temperature for thawing. The epidermal mucosa of the feces was peeled off with sterile forceps, and then DNA was extracted using the QIAamp FAST DNAStool Mini Kit (51604). The dosage of the epidermal mucosa of the feces in this control group was 0.2 g, and the dosage of InhibitEX Buffer was 1.5 ml. The remaining steps were all carried out according to the kit instructions.
[0062] Based on the sex-determining genes SYR SRY-F (SEQ ID NO.21: TGGTCTCGTGATCAAAGGCG), SRY-R (SEQ ID NO.22: GCCATTTTTCGGCTTCCGTAAG), and SRY-R1 (SEQ ID NO.23: GCCATTTTTCGGCTTCtGTAAG), the SYR gene (specific to males, approximately 120 bp) was amplified using PCR technology, and male and female control DNA samples were set up. The PCR amplification system was as follows: Premix Taq (TaKaRa Taq Verison 2.0 plus dye) 12.5 ul, 1 ul of each primer, 2 ul of DNA template, and 9.5 ul of ddH2O. The PCR reaction program was: 95°C for 5 min; 95°C for 5 s, 59°C for 90 s, for a total of 30 cycles; extension at 60°C for 30 min.
[0063] The samples were detected by 1.5% agarose gel electrophoresis. According to the electrophoresis results, sex determination was performed based on whether the SRY gene was amplified, that is, the presence of a band indicated male, and the absence of a band indicated female.
[0064] 3. Experimental results: Experimental group 1: As Figure 12 shown, lanes 1, 2, 4, and 6 corresponded to male samples, which were male control, sample DL, sample LL, and sample XL, respectively. Bands were detected by electrophoresis, indicating successful completion of sex identification detection. Lanes 3, 5, 7, and 8 corresponded to female samples, which were sample FF, JM, HZ, and female control, respectively. No bands were detected by electrophoresis, indicating successful completion of sex identification detection. Control group 1: No bands were detected in males, and sex identification was not successfully completed.
[0065] The results showed that DNA extracted from samples obtained using the fecal pretreatment method of the present invention all successfully completed sex identification. This indicates that the method of the present invention can be used for sex identification of giant pandas.
[0066] Experimental example 3 Based on the 10 microsatellite loci commonly used for giant panda microsatellite identification in Example 1, loci with higher success rates for DNA typing and identification of aged wild giant panda feces were screened.
[0067] The experimental method is as follows: (1) In this study, 30 wild giant panda fecal samples collected from different geographical locations were collected. Based on experience, the exposure time of the above feces in the wild was judged to be 3 - 15 days. The fecal samples were pretreated according to the method described in Example 1, and then DNA was extracted from the fecal samples according to the method described in Example 3.
[0068] (2) Using the obtained DNA sample as a template, PCR amplification was performed with 10 sets of microsatellite primers, namely gpz-47, gpz-06, gpz-51, gpz-20, GPL-60, GPL-08, GPL-44, gpy-05, gpy-20, and GPL-31. The PCR amplification system was as follows: Premix Taq (TaKaRa Taq Verison 2.0 plus dye) 12.5 ul, 1 ul of each upstream and downstream primer, 2 ul of DNA template, and 9.5 ul of ddH2O. The PCR reaction program was: 95°C for 10 min; 95°C for 30 s, annealing temperature for 30 s, 72°C for 30 s, for a total of 37 cycles; 72°C for extension for 10 min. Each sample was subjected to PCR testing three times. If the three results were inconsistent, the result was determined to be invalid.
[0069] (3) The obtained PCR products were sent to Tsingke Biotechnology Co., Ltd. for genotyping. The software GeneMapper4.0 and the internal molecular standard ROX-500 were used to determine the number of sample alleles and allele sizes, respectively.
[0070] 2. Experimental results: (1) Thirty wild giant panda fecal DNA samples were genotyped using 10 microsatellite primers. The number of giant panda samples with successfully amplified microsatellite loci of 1, 2, 3, 4, 5, and 6 was 3, 4, 7, 8, 4, and 4, respectively. This indicates that the method of the present invention can be used for microsatellite detection of wild giant panda feces and is suitable for individual identification research of wild giant pandas.
[0071] (2) As Figure 13 shown, the typing success rates of different microsatellite loci were analyzed. The results showed that among all samples, 6 loci could perform microsatellite genotyping identification in a large number of samples (more than 40%). The typing success rates of 2 loci, GPY-05 and GPZ-51, were the highest in the samples. No typing results could be obtained for 2 loci, GPL-60 and GPZ-47, indicating that these two loci are not suitable for microsatellite genotyping analysis of wild giant panda fecal samples.
[0072] The embodiments of the present application have been described above in conjunction with the accompanying drawings. However, the present application is not limited to the above specific embodiments. The above specific embodiments are merely illustrative and not restrictive. Under the inspiration of the present application, those of ordinary skill in the art can also make many forms without departing from the purpose of the present application and the scope protected by the claims, and all belong to the protection scope of the present application.
Claims
1. A pretreatment method for extracting DNA from giant panda feces, characterized in that, It includes the following steps: Put the newly collected feces into a sterile sampling bag, quickly and completely freeze the sample hard, then crush the feces, freeze-dry and sieve it, and then seal and store it frozen. The freeze-drying includes pre-freezing and analytical drying.
2. The pretreatment method for extracting DNA from giant panda feces according to claim 1, wherein Use an ultra-low temperature refrigerator to quickly and completely freeze the sample hard at -72 ± 1 °C within 24 hours.
3. The pretreatment method for extracting DNA from giant panda feces according to claim 1, characterized in that The pre-freezing temperature is -50 ± 1 °C and it stays for 6 ± 1 hours; the analytical drying starts from -50 ± 1 °C and increases by 10 ± 1 °C each time, stays for 63 ± 1 hours until 20 ± 1 °C, and keeps warm for 3 ± 1 hours.
4. The pretreatment method for extracting DNA from giant panda feces according to claim 1, wherein It also includes the following steps: Sieve the freeze-dried giant panda feces using a sieve with a pore size of 30 - 40 mesh.
5. The pretreatment method for extracting DNA from giant panda feces according to claim 1, characterized in that The freeze-drying is carried out under vacuum conditions.
6. The pretreatment method for DNA extraction from giant panda feces according to claim 1, wherein The storage temperature is -72 °C to -60 °C.
7. A DNA extraction sample from giant panda feces, characterized in that, It is processed by the method described in any one of claims 1 - 6.
8. A method for extracting DNA from giant panda feces, characterized in that, Using the extraction sample described in claim 7, use the QIAamp FAST DNA Stool Mini Kit (51604) kit for DNA extraction. The QIAamp FAST DNA Stool Mini Kit (51604) kit contains InhibitEX Buffer. The solid-liquid ratio of the extraction sample to InhibitEX Buffer is (0.05 - 0.12) g : (1–1.8) ml.
9. Application of the DNA obtained by the extraction method described in claim 8 in microsatellite genotyping identification of giant panda feces.
10. Application of the DNA obtained by the extraction method described in claim 8 in gender identification of giant pandas.
Citation Information
Patent Citations
Method for acquiring microsatellite marker in panda excrement and application of microsatellite marker
CN117965686A
Method for extracting hologenome of giant panda
CN1198439A
Method of lyophilization of a sample of faecal microbiota
US20180369147A1
Storage method of feces
US20210040438A1
Cited By
Golden-nosed monkey excrement storage management system and method based on environment evaluation
CN122434398A