Molecular identification method for early-stage high-quality pen material wool type Yangtze River Delta white goats

By extracting RNA from the skin tissue of the neck and back of white goats in the Yangtze River Delta and analyzing the expression levels of the circCOL1A1 and linearCOL1A1 genes, the problem that the existing technology cannot identify high-quality pen hairs in early is solved, and early identification and establishment of high-quality groups have been achieved.

CN120210378APending Publication Date: 2025-06-27YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510209383.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-25
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

The existing technology cannot identify the Yangtze River Delta white goats that can produce high-quality pen hairs in the early stage, resulting in increased difficulties in subsequent breeding.

Method used

By extracting RNA from the skin tissue of the neck and back of the white goat in the Yangtze River Delta, cDNA was reversely transcribed and synthesized, and the expression levels of the circCOL1A1 and linearCOL1A1 genes were analyzed by semi-quantitative PCR and agarose electrophoresis to determine whether they were high-quality pen hair type.

Benefits of technology

The identification of individuals with high-quality brush hairs in the Yangtze River Delta was achieved in the early stage, which shortened the identification time, helped to establish a group of high-quality brush hairs, and facilitated targeted cultivation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210378A_ABST
    Figure CN120210378A_ABST
Patent Text Reader

Abstract

The invention provides a molecular identification method for early-stage high-quality pen material wool type Yangtze River Delta white goats, which comprises the following steps of: extracting RNA (Ribonucleic Acid) by utilizing skin tissues of neck and spine parts of to-be-detected Yangtze River Delta white goats, reversely transcribing into cDNA (Complementary Deoxyribonucleic Acid), and then carrying out semi-quantitative PCR (Polymerase Chain Reaction) and agarose gel electrophoresis; and judging whether the expression level of circCOL1A1 is extremely obviously lower than the expression level of LearCOL1A1 or not through independent sample T inspection, if so, determining that the goat is a high-quality pen material wool type Yangtze River Delta white goat, and otherwise, determining that the goat is not the high-quality pen material wool type Yangtze River Delta white goat. Therefore, the limitation that only apparent identification is used currently can be broken through, identification of the Yangtze River Delta white goats (high-quality pen material hair types) is completed in the early stage, establishment of high-quality pen material hair groups is facilitated, and directional breeding is facilitated. The characteristics of the marrow-free hair can be directly observed through scanning electron microscope detection of the high-quality pen material hair identified by the method disclosed by the invention, and a scientific basis can be provided for establishing a high-quality breeding group.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a molecular identification method for an early high-quality brush-hair type Yangtze River Delta white goat. Background Art

[0002] There are three types of brush hair: inferior hair (class I), ordinary hair (class II) and high-quality hair (class III). The value increases gradually, with class III being the best. High-quality brush hair is also called class III hair. It is characterized by having both the characteristics of non-medullated hair (fine hair) and medullary hair (coarse hair). The medullary cavity of the upper part has no medulla, the middle part has discontinuous dot-shaped medulla, and the medullary cavity of the lower part is full of medulla. In addition, high-quality brush hair also has the characteristics of "sharp hair peak, white hair color, rich elasticity", etc. It is a unique material for making high-end brushes and one of the most valuable coats of goats. The high-quality brush hair produced by the white goats in the Yangtze River Delta is expensive (15,000-20,000 yuan / kg), but the output of high-quality brush hair is relatively low, with an annual output of only 4,000-5,000kg, which cannot meet the needs of the domestic and international markets.

[0003] At present, the main method for identifying whether the Yangtze River Delta white goats can produce high-quality brush hair is phenotypic identification. Phenotypic identification refers to the appearance of high-quality brush hair in some male lambs at the age of 5-8 months. This hair can be identified on-site by professionals and is quite different from other hair. Although high-quality brush hair can be accurately identified, only individuals that have shown this phenotype can be identified. It is necessary to wait until 5-8 months of age to identify it. It is impossible to identify the Yangtze River Delta white goats that can produce high-quality brush hair at an early stage, which increases the difficulty of breeding new strains of Yangtze River Delta white goats with brush hair. At present, there are no reports on the research of molecular markers for identifying Yangtze River Delta white goats that can produce high-quality brush hair at home and abroad. Therefore, finding a method that can be used to identify Yangtze River Delta white goats that can produce high-quality brush hair at an early stage has become an urgent problem to be solved. Summary of the invention

[0004] Technical problem to be solved: In view of the defect that the existing phenotypic identification method cannot complete the identification of individuals of Yangtze River Delta white goats that can produce high-quality brush material hair at an early stage, the present invention provides a molecular identification method for early high-quality brush material hair type Yangtze River Delta white goats, which can complete the identification of individuals of Yangtze River Delta white goats that can produce high-quality brush material hair at an early stage, help to establish a high-quality brush material hair population, and facilitate targeted breeding.

[0005] Technical solution: A molecular identification method for early high-quality pen-hair type Yangtze River Delta white goats, the steps are as follows:

[0006] Step 1: Grind the skin tissue sample from the nape of the neck of the Yangtze River Delta white goats to be detected into powder, add lysis buffer for lysis, extract RNA, and reverse transcribe the extracted RNA into cDNA.

[0007] Step 2: Obtain the electrophoresis images of circCOL1A1 and linearCOL1A1 genes by semi - quantitative PCR method and agarose electrophoresis method, and determine their expression levels through gray value analysis. The detection for each single goat is repeated at least 4 times. Use independent - sample T - test to determine whether the expression level of circCOL1A1 is extremely significantly (P value less than 0.0001) lower than that of linearCOL1A1. If so, it is identified as high - quality pen - wool - type Yangtze River Delta white goats; otherwise, it is not. The sequence of the circCOL1A1 gene is shown in SEQ ID No: 1. Due to space limitations, the sequence of the linearCOL1A1 gene is the sequence spliced from SEQ ID No: 2 + SEQ ID No: 3. SEQ ID No: 1, SEQ ID No: 2, and SEQ ID No: 3 are shown in the sequence listing.

[0008] Preferably, the skin tissue sample of the Yangtze River Delta white goats to be detected in Step 1 is the skin tissue from the nape of the neck of male lambs of the Yangtze River Delta white goats.

[0009] Preferably, the skin tissue sample of the Yangtze River Delta white goats to be detected in Step 1 is pretreated before being ground into powder, specifically as follows: After collection, it is rinsed 3 times with 0.9% normal saline and 1× phosphate - buffered saline respectively, and then stored frozen.

[0010] Preferably, the lysis buffer in Step 1 is RNAiso plus reagent, the lysis condition is lysis at 4°C for 15 min, and the RNA extraction uses the chloroform extraction method.

[0011] Preferably, in step one, lysis is carried out by adding lysis buffer for RNA extraction. The specific steps are as follows: Grind the Yangtze River Delta white goat tissue sample to be detected into powder with a mortar pre-treated with DEPC in advance, put it into an enzyme-free tube, add 1 ml of RNAiso plus reagent, let it stand at 4 °C for 15 min to fully lyse; Take the supernatant and add it to a 1.5 ml enzyme-free tube, add 200 μl of chloroform, mix well, let it stand on ice for 5 min, then centrifuge at 4 °C and 10,000 g for 15 min; Collect 400 μl of the upper aqueous phase, add 400 μl of isopropanol, gently mix well, and let it stand at room temperature for 10 min; Centrifuge at 4 °C and 10,000 g for 10 min to collect the precipitate; Add 1 mL of pre-cooled 75% ethanol, gently mix well to suspend the precipitate; Centrifuge at 4 °C and 10,000 g for 5 min, open the tube cap and let it stand for 10 min to evaporate the ethanol completely; Add 40 μl of RNase-free water, use NanoDrop 1000 to measure the quality and concentration of RNA, and transfer it to an ultra-low temperature refrigerator for storage after labeling.

[0012] Preferably, the reverse transcription in step one is as follows:

[0013] S1. Remove genomic DNA. Premix the following reagents in an enzyme-free tube: 1 μl of gDNA Eraser, 2 μl of 5×gDNA Eraser Buffer, 1 μg of RNA template, and RNase-free ddH2O up to 10 μl. Gently pipette and mix well, and incubate at 42 °C for 2 min;

[0014] S2. Prepare the reverse transcription reaction system. Add reverse transcription reagents to the product of step S1 as follows: 10 μl of the reaction solution from step S1, 1 μl of PrimeScript RT Enzyme Mix I, 1 μl of RT Primer Mix, 4 μl of 5×PrimeScript Buffer, and 4 μl of RNase Free Water. Gently pipette and mix well, incubate at 37 °C for 15 min, and then at 85 °C for 5 s. After reverse transcription, it can be stored temporarily at -20 °C.

[0015] Preferably, when obtaining the electrophoresis images of circCOL1A1 and linearCOL1A1 genes by semi-quantitative PCR and agarose gel electrophoresis in step two, the primer pair for the circCOL1A1 gene is:

[0016] Primer F: 5’TATCCTCCACTCCACTCACA 3’(SEQ ID No: 4),

[0017] Primer R: 5’CTTGAATACCAGTGGGACCAG 3’ (SEQ ID No: 5);

[0018] The primer pair for the linear COL1A1 gene is:

[0019] Primer F: 5’GGGGAAGAAGGAAAGCGAGG 3’ (SEQ ID No: 6),

[0020] Primer R: 5’CTCACCAGCAGGACCCTTG 3’ (SEQ ID No: 7).

[0021] Preferably, the PCR system for semi - quantitative PCR in step two is as follows: 5 μl of PCR Mix, 3 μl of RNase - Free Water, 0.5 μl of 10 μM Primer F, 0.5 μl of 10 μM Primer R, and 1 μl of cDNA.

[0022] Preferably, the PCR program for semi - quantitative PCR in step two is as follows: pre - denaturation at 95°C for 3 min; successively at 95°C for 15 s, 60°C for 15 s, 72°C for 15 s, for 30 - 35 cycles; and finally extension at 72°C for 5 min.

[0023] Preferably, in step two, GAPDH is used as an internal reference for normalization analysis, and the independent samples T - test is used to determine whether the expression level of circCOL1A1 is extremely significantly lower than that of linear COL1A1.

[0024] Beneficial effects: (1) The present invention provides a molecular identification method for early high - quality pen - making wool - type Yangtze River Delta white goats. RNA is extracted from the skin tissue of the neck and back of Yangtze River Delta white goats and reverse - transcribed into cDNA, and then semi - quantitative PCR and agarose gel electrophoresis are carried out. When the expression level of circCOL1A1 is extremely significantly lower than that of linear COL1A1, it is a Yangtze River Delta white goat that can produce high - quality pen - making wool. In this way, the limitation of only using apparent identification can be broken, and the identification of Yangtze River Delta white goats (high - quality pen - making wool - type) can be completed at an early stage without waiting until 5 - 8 months old, which helps to establish a high - quality pen - making wool population and is conducive to directional breeding.

[0025] (2) For the high - quality pen - making wool that meets the requirements identified by the method of the present invention, scanning electron microscopy detection can directly observe the characteristics of medulla - less wool, which can provide a scientific basis for the establishment of a high - quality breeding population.

[0026] (3) By using the method provided by the present invention, early selection of the quality of white goat pen hair can be achieved, directly judging the quality of pen hair after the lambs are born. Compared with the traditional phenotypic identification method, it can effectively shorten the identification time. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is a q-PCR detection chart of the expression level of circCOL1A1 in individuals that can produce high-quality and non-high-quality pen hair distinguished by phenotypic identification. In the figure, A-T are respectively groups randomly paired with 20 superior-quality individuals and 20 normal-quality individuals randomly selected. ns indicates p>0.05; * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, **** indicates p<0.0001;

[0028] Figure 2 It is a q-PCR detection chart of the expression level of LinearCOL1A1 in individuals that can produce high-quality and non-high-quality pen hair distinguished by phenotypic identification. In the figure, A-T are respectively groups randomly paired with 20 superior-quality individuals and 20 normal-quality individuals randomly selected. ns indicates p>0.05; * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, **** indicates p<0.0001;

[0029] Figure 3 It is a characterization chart of 2 individuals that can produce high-quality pen hair identified by the method of the present invention. In the figure, A is the electrophoresis image of the skin tissue of the neck ridge of individual 0217 and the analysis chart of the expression levels of circCOL1A1 and LinearCOL1A1; B is the electron microscope image of the skin hair of the neck ridge of individual 0217 after showing the phenotype; C is the electrophoresis image of the skin tissue of the neck ridge of individual 2563 and the analysis chart of the expression levels of circCOL1A1 and LinearCOL1A1; D is the electron microscope image of the skin hair of the neck ridge of individual 2563 after showing the phenotype;

[0030] Figure 4 It is an analysis chart of the expression levels of circCOL1A1 and LinearCOL1A1 of 12 individuals that can produce non-high-quality pen hair identified by the method of the present invention. In the figure, A-L respectively represent individuals 0227, 0229, 0237, 0133, 2267, 0281, 0305, 0335, 0355, 0231, 3129 and 3144. On the left side of each figure is the electrophoresis image, and on the right side is the analysis chart of the expression levels of circCOL1A1 and LinearCOL1A1. DETAILED DESCRIPTION OF THE INVENTION

[0031] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0032] Example 1

[0033] A molecular identification method for early high-quality penstock-type Yangtze River Delta white goats in this example is as follows:

[0034] 1) Main reagents

[0035] RNAiso plus and DL500 are products of Dalian Takara Co., Ltd., chloroform is a product of Sinopharm Chemical Reagent Co., Ltd., isopropanol is a product of Merck Co., Ltd., Tris, boric acid, EDTA, and DEPC reagents are products of ABI Co., Ltd., absolute ethanol is a product of Sinopharm Chemical Reagent Co., Ltd., G-Red nucleic acid dye is a product of Bioteke Corporation, sterile and enzyme-free water is a product of Beijing Solarbio Science & Technology Co., Ltd., and 2×RapidTaq Master Mix is a product of Nanjing Novoprotein Co., Ltd.

[0036] 2) Sample collection

[0037] In this example, the experimental samples are provided by the Yangtze River Delta White Goat Conservation and Breeding Research Institute in Haimen District, Nantong City, Jiangsu Province. A total of 14 neck and back skin tissue samples (2 cm × 2 cm) of 2-month-old male lambs of Yangtze River Delta white goats are collected as test group samples (numbered 0217, 2563, 0227, 0229, 0237, 0133, 2267, 0281, 0305, 0335, 0355, 0231, 3129, 3144). At the same time, 20 neck and back skin tissue samples (2 cm × 2 cm) of male lambs of Yangtze River Delta white goats with high-quality individuals and non-high-quality individuals after phenotypic identification are randomly selected as verification group samples (the numbers of high-quality individuals are 3217, 2945, 0253, 3140, 0479, 3136, 2951, 2947, 0369, 0405, 2946, 0317, 0385, 0356, 3146, 3138, 2483, 0513, 0245, 3238; the numbers of non-high-quality individuals are 0117, 0225, 0233, 0241, 0247, 0255, 0285, 0301, 0339, 0343, 0361, 0381, 0383, 0401, 0427, 0455, 0477, 0519, 0533, 3117). After the skin tissue is collected, it is rinsed 3 times with 0.9% normal saline and 1× phosphate buffer. After the excised tissue samples are cleaned, they are placed in labeled sterile and enzyme-free cryotubes, quickly frozen in a liquid nitrogen tank and taken back to the laboratory, and stored in a -80°C ultra-low temperature refrigerator for a long time.

[0038] 3) RNA Extraction from the Skin Tissue of the Neck and Spinal Region of the White Goats in the Yangtze River Delta

[0039] Extract RNA from the skin tissue samples collected in step 2) according to the following steps:

[0040] ① Treat the utensils to be used with DEPC, dry them for later use. After grinding the skin tissue into powder in a mortar, put it into an enzyme-free tube, add 1 ml of RNAiso plus reagent, and let it stand at 4°C for 15 min to fully lyse it;

[0041] ② Take the supernatant and add it to a 1.5 ml enzyme-free tube, add 200 μl of chloroform, mix well, let it stand on ice for 5 min, and then centrifuge at 4°C, 10000 g for 15 min;

[0042] ③ Collect 400 μl of the upper aqueous phase, add 400 μl of isopropanol, gently mix well, and let it stand at room temperature for 10 min;

[0043] ④ Centrifuge at 4°C, 10000 g for 10 min to collect the precipitate;

[0044] ⑤ Add 1 mL of pre-cooled 75% ethanol, gently mix well to suspend the precipitate;

[0045] ⑥ Centrifuge at 4°C, 10000 g for 5 min, open the tube cap and let it stand for 10 min to evaporate the ethanol completely;

[0046] ⑦ Add 40 μl of RNase-free water, use NanoDrop 1000 to measure the quality and concentration of RNA. After labeling, transfer it to an ultra-low temperature refrigerator for storage.

[0047] 4) Synthesis of cDNA

[0048] Perform reverse transcription according to the following steps:

[0049] ① Remove genomic DNA

[0050] Premix the following reagents in an enzyme-free tube as shown in the following table.

[0051]

[0052] Gently pipette and mix well, incubate at 42°C for 2 min.

[0053] ② Prepare the reverse transcription reaction system, add reverse transcription reagents to the product of step one as shown in the following table.

[0054]

[0055] Gently pipette and mix well, incubate at 37°C for 15 min, then at 85°C for 5 s. After reverse transcription is completed, it can be stored temporarily at -20°C. The product can be diluted for quantitative tests or stored in an ultra-low temperature freezer for long-term preservation.

[0056] 5) Detection by PCR

[0057] ① Use the cDNA synthesized in step 4) as the template for the PCR experiment;

[0058] ② Perform PCR according to the following system:

[0059]

[0060] The PCR program used is as follows:

[0061]

[0062] The primers used are as shown in the following table:

[0063]

[0064] Note: The sequence of the circCOL1A1 gene is shown in SEQ ID No: 1. Due to space limitations, the sequence of the linearCOL1A1 gene is the sequence obtained by splicing SEQ ID No: 2 + SEQ ID No: 3. SEQ ID No: 1, SEQ ID No: 2, and SEQ ID No: 3 are shown in the sequence listing.

[0065] ③ Use agarose gel electrophoresis to separate the bands, analyze the band gray values using Image J, perform normalization analysis with GAPDH as the internal reference. Each sheep sample is detected 4 times, and the independent samples T-test is used to determine whether the expression level of circCOL1A1 in the experimental group samples is extremely significantly lower than that of linearCOL1A1. If so, it is identified as a high-quality pen-making wool type Yangtze River Delta white goat; otherwise, it is not.

[0066] Figure 1-2 To verify the expression levels of circCOL1A1 and LinearCOL1A1 in individuals that can produce high-quality and non-high-quality pen-making wool distinguished by phenotypic identification for the verification group samples. From Figure 1It can be seen that: (A) The expression level of circCOL1A1 in non-high-quality individual 0117 is significantly higher than that in high-quality individual 3217; (B) The expression level of circCOL1A1 in non-high-quality individual 0225 is higher than that in high-quality individual 2945; (C) The expression level of circCOL1A1 in non-high-quality individual 0233 is extremely significantly higher than that in high-quality individual 0253; (D) The expression level of circCOL1A1 in non-high-quality individual 0241 is significantly higher than that in high-quality individual 3140; (E) The expression level of circCOL1A1 in non-high-quality individual 0247 is extremely significantly higher than that in high-quality individual 0479; (F) The expression level of circCOL1A1 in non-high-quality individual 0255 is higher than that in high-quality individual 3136; (G) The expression level of circCOL1A1 in non-high-quality individual 0285 is significantly higher than that in high-quality individual 2951; (H) The expression level of circCOL1A1 in non-high-quality individual 0301 is extremely significantly higher than that in high-quality individual 2947; (I) The expression level of circCOL1A1 in non-high-quality individual 0339 is higher than that in high-quality individual 0369; (J) The expression level of circCOL1A1 in non-high-quality individual 0343 is higher than that in high-quality individual 0405; (K) The expression level of circCOL1A1 in non-high-quality individual 0361 is significantly higher than that in high-quality individual 2946; (L) The expression level of circCOL1A1 in non-high-quality individual 0381 is extremely significantly higher than that in high-quality individual 0317; (M) The expression level of circCOL1A1 in non-high-quality individual 0383 is extremely significantly higher than that in high-quality individual 0385; (N) The expression level of circCOL1A1 in non-high-quality individual 0401 is higher than that in high-quality individual 0356; (O) The expression level of circCOL1A1 in non-high-quality individual 0427 is higher than that in high-quality individual 3146; (P) The expression level of circCOL1A1 in non-high-quality individual 0455 is higher than that in high-quality individual 3138; (Q) The expression level of circCOL1A1 in non-high-quality individual 0477 is higher than that in high-quality individual 2483; (R) The expression level of circCOL1A1 in non-high-quality individual 0519 is extremely significantly higher than that in high-quality individual 0513; (S) The expression level of circCOL1A1 in non-high-quality individual 0533 is extremely significantly higher than that in high-quality individual 0245; (T) The expression level of circCOL1A1 in non-high-quality individual 3117 is higher than that in high-quality individual 3238.

[0067] From Figure 2It can be seen that: (A) The expression level of circCOL1A1 in non-high-quality individual 0117 is extremely significantly lower than that in high-quality individual 3217; (B) The expression level of circCOL1A1 in non-high-quality individual 0225 is significantly lower than that in high-quality individual 2945; (C) The expression level of circCOL1A1 in non-high-quality individual 0233 is extremely significantly lower than that in high-quality individual 0253; (D) The expression level of circCOL1A1 in non-high-quality individual 0241 is extremely significantly lower than that in high-quality individual 3140; (E) The expression level of circCOL1A1 in non-high-quality individual 0247 is extremely significantly lower than that in high-quality individual 0479; (F) The expression level of circCOL1A1 in non-high-quality individual 0255 is significantly lower than that in high-quality individual 3136; (G) The expression level of circCOL1A1 in non-high-quality individual 0285 is lower than that in high-quality individual 2951; (H) The expression level of circCOL1A1 in non-high-quality individual 0301 is extremely significantly lower than that in high-quality individual 2947; (I) The expression level of circCOL1A1 in non-high-quality individual 0339 is extremely significantly lower than that in high-quality individual 0369; (J) The expression level of circCOL1A1 in non-high-quality individual 0343 is extremely significantly lower than that in high-quality individual 0405; (K) The expression level of circCOL1A1 in non-high-quality individual 0361 is extremely significantly lower than that in high-quality individual 2946; (L) The expression level of circCOL1A1 in non-high-quality individual 0381 is extremely significantly lower than that in high-quality individual 0317; (M) The expression level of circCOL1A1 in non-high-quality individual 0383 is extremely significantly lower than that in high-quality individual 0385; (N) The expression level of circCOL1A1 in non-high-quality individual 0401 is significantly lower than that in high-quality individual 0356; (O) The expression level of circCOL1A1 in non-high-quality individual 0427 is significantly lower than that in high-quality individual 3146; (P) The expression level of circCOL1A1 in non-high-quality individual 0455 is extremely significantly lower than that in high-quality individual 3138; (Q) The expression level of circCOL1A1 in non-high-quality individual 0477 is lower than that in high-quality individual 2483; (R) The expression level of circCOL1A1 in non-high-quality individual 0519 is lower than that in high-quality individual 0513; (S) The expression level of circCOL1A1 in non-high-quality individual 0533 is extremely significantly lower than that in high-quality individual 0245; (T) The expression level of circCOL1A1 in non-high-quality individual 3117 is extremely significantly lower than that in high-quality individual 3238.

[0068] Therefore, from Figure 1-2 it can be seen that the expression level of circCOL1A1 in high-quality individuals is lower, and the expression level of linearCOL1A1 is higher.

[0069] Figure 3-4The expression levels of circCOL1A1 and LinearCOL1A1 in some individuals of the test group samples were identified by the semi - quantitative method of the present invention. Figure 3 Among them: (A) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 0217 was extremely significantly lower than that of linearCOL1A1; (B) Electron microscope picture of the hair on the cervical spinal skin of individual 0217 after the phenotype appeared; (C) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 2563 was extremely significantly lower than that of linearCOL1A1; (D) Electron microscope picture of the hair on the cervical spinal skin of individual 2563 after the phenotype appeared.

[0070] Figure 4 Among them: The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 0227 was lower than that of linearCOL1A1; (B) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 0229 was lower than that of linearCOL1A1; (C) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 0237 was lower than that of linearCOL1A1; (D) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 0133 was extremely significantly higher than that of linearCOL1A1; (E) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 2267 was lower than that of linearCOL1A1; (F) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 0281 was lower than that of linearCOL1A1; (G) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 0305 was extremely significantly higher than that of linearCOL1A1; (H) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 0335 was lower than that of linearCOL1A1; (I) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 0355 was higher than that of linearCOL1A1; (J) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 0231 was extremely significantly higher than that of linearCOL1A1; (K) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 3129 was higher than that of linearCOL1A1; (L) The expression level of circCOL1A1 in the cervical spinal skin tissue of individual 3144 was higher than that of linearCOL1A1.

[0071] It can be seen that Figure 3 Among them, two individuals met the condition that the expression level of circCOL1A1 was significantly lower than that of linearCOL1A1. After the trait appeared and was identified by scanning electron microscopy, it was found that they had less hair medulla, so they were identified as individuals that could produce high - quality pen - making hair; while Figure 4Among the 12 individuals, the expression levels vary, and after normalization with GAPDH, there is no significant difference in the expression levels between the two, or the expression level of circCOL1A1 is significantly higher than that of linearCOL1A1.

[0072] In summary, through the analysis of Figure 1 and Figure 2 it was found that the expression level of circCOL1A1 in the neck and spine skin group of high-quality individuals was generally lower than that of non-high-quality individuals, while the expression level of linearCOL1A1 in the neck and spine skin group of high-quality individuals was generally higher than that of non-high-quality individuals. These results together indicate that the expression levels of circCOL1A1 and linearCOL1A1 are strongly correlated with whether the neck and spine skin of individuals can produce three types of hair. And Figure 3 and Figure 4 re-selected 14 two-month-old individuals, detected the expression levels of circCOL1A1 and linearCOL1A1 in their neck and spine skin tissues, and compared the differences. Finally, two individuals meeting the standards were found among the 14 individuals. In addition, after they expressed this trait, the medulla situation was determined by electron microscopy and confirmed to meet the standards. Therefore, the molecular identification method provided by the present invention can achieve early selection of the quality of white goat brush hair, and can directly judge the quality of brush hair after the lambs are born. Compared with the traditional phenotypic identification method, it can effectively shorten the identification time.

[0073] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular identification method for early high-quality brush-hair type Yangtze River Delta white goats, characterized in that: Here are the steps: Step 1: Grind the skin tissue sample of the back of the neck of the Yangtze River Delta white goat to be tested into powder, add lysis solution to lyse, extract RNA, and reverse transcribe the extracted RNA to synthesize cDNA; Step 2: Use semi-quantitative PCR and agarose electrophoresis to obtain the electrophoresis images of circCOL1A1 and linearCOL1A1 genes, and determine their expression levels by gray value analysis. The detection of a single goat was repeated at least 4 times, and an independent sample T test was used to determine whether the expression level of circCOL1A1 was significantly lower than that of linearCOL1A1. If so, it was identified as a high-quality pen-type Yangtze River Delta white goat, otherwise, it was not.

2. The molecular identification method of a kind of early high-quality brush material hair type Yangtze River Delta white goat according to claim 1 is characterized in that, The Yangtze River Delta white goat tissue sample to be tested in step 1 is the skin tissue of the neck and back of the Yangtze River Delta white goat lamb.

3. The molecular identification method of a kind of early high-quality brush material hair type Yangtze River Delta white goat according to claim 1 is characterized in that, In the step 1, the Yangtze River Delta white goat tissue sample to be tested is pretreated before being ground into powder, specifically as follows: after collection, it is rinsed three times with 0.9% saline and 1× phosphate buffer respectively, and then frozen for storage.

4. The molecular identification method of a kind of early high-quality brush material hair type Yangtze River Delta white goat according to claim 1 is characterized in that, In the step 1, the lysis solution is RNAiso plus reagent, the lysis condition is lysis at 4°C for 15 min, and the RNA is extracted by chloroform extraction method.

5. The molecular identification method of a kind of early high-quality brush material hair type Yangtze River Delta white goat according to claim 4 is characterized in that, In step 1, the lysis buffer was added to perform lysis, and the specific steps for RNA extraction were as follows: the tissue sample of the Yangtze River Delta white goat to be tested was ground into powder using a mortar treated with DEPC in advance, and then placed in an enzyme-free tube, 1 ml of RNAiso plus reagent was added, and the sample was allowed to stand at 4 °C for 15 min to fully lyse; the supernatant was added to a 1.5 ml enzyme-free tube, 200 μl of chloroform was added, and the sample was fully mixed, and then allowed to stand on ice for 5 min, and then centrifuged at 4 °C, 10,000 g for 15 min; Collect 400 μl of the upper aqueous phase, add 400 μl of isopropanol, mix gently, and let stand at room temperature for 10 min; centrifuge at 4 °C, 10,000 g for 10 min to collect the precipitate; add 1 mL of pre-cooled 75% ethanol, mix gently, and suspend the precipitate; centrifuge at 4 °C, 10,000 g for 5 min, open the tube cap and let it stand for 10 min to evaporate the ethanol; add 40 μl RNase-free water, use NanoDrop 1000 to determine the RNA quality and concentration, and store in an ultra-low temperature refrigerator after labeling.

6. The molecular identification method of a kind of early high-quality brush material hair type Yangtze River Delta white goat according to claim 1 is characterized in that, The reverse transcription in step 1 is specifically as follows: S1. Remove genomic DNA and premix the following reagents in an enzyme-free tube: gDNA Eraser 1 μl, 5× gDNA EraserBuffer 2 μl, RNA template 1 μg, RNase-free ddH2O up to 10 μl, gently pipette to mix, and incubate at 42 ℃ for 2 min. S2. Prepare the reverse transcription reaction system. Add reverse transcription reagents to the product of step S1, as follows: 10 μl of the reaction solution of step S1, 1 μl of PrimeScript RT Enzyme Mix I, 1 μl of RT Primer Mix, 4 μl of 5× PrimeScript Buffer, and 4 μl of RNase Free Water. Mix by gently pipetting. Incubate at 37 ℃ for 15 min and 85 ℃ for 5 s. After reverse transcription, store at -20 ℃.

7. The molecular identification method of a kind of early high-quality brush material hair type Yangtze River Delta white goat according to claim 1 is characterized in that, In the step 2, when the electrophoresis images of circCOL1A1 and linearCOL1A1 genes are obtained by semi-quantitative PCR and agarose electrophoresis, the primer pair of circCOL1A1 gene is: Primer F: 5'TATCCTCCACTCCACTCACA 3', Primer R: 5'CTTGAATACCAGTGGGACCAG 3'; The primer pairs for the linearCOL1A1 gene are: Primer F: 5'GGGGAAAGAAGGAAAGCGAGG 3', Primer R: 5'CTCACCAGCAGGACCCTTG 3'.

8. The molecular identification method of a kind of early high-quality brush material hair type Yangtze River Delta white goat according to claim 1 is characterized in that, The PCR system of the semi-quantitative PCR in step 2 is as follows: PCR Mix 5 μl, RNase Free Water 3 μl, 10 μM Primer F 0.5 μl, 10 μM Primer R 0.5 μl, and cDNA 1 μl.

9. The molecular identification method of a kind of early high-quality brush material hair type Yangtze River Delta white goat according to claim 1 is characterized in that, The PCR program of the semi-quantitative PCR in step 2 is as follows: pre-denaturation at 95°C for 3 min; 30-35 cycles at 95°C for 15 s, 60°C for 15 s, and 72°C for 15 s; and finally extension at 72°C for 5 min.

10. The molecular identification method of a kind of early high-quality brush material hair type Yangtze River Delta white goat according to claim 1 is characterized in that, In the step 2, GAPDH was used as an internal reference for homogenization analysis, and an independent sample T test was performed to determine whether the expression level of circCOL1A1 was significantly lower than the expression level of linearCOL1A1.