Primer and crRNA for rapidly detecting nucleic acid of schistosoma japonicum based on Sj28S-LAMP-CRISPR / Cas12a system and application of primer and crRNA

Abstract

The invention discloses a primer for rapidly detecting nucleic acid of schistosoma japonicum katsurada based on an Sj28S-LAMP-CRISPR / Cas12a system, crRNA and application of the primer and the crRNA. A specific LAMP primer is designed aiming at a specific target sequence in a schistosoma japonicum Sj28S gene, and a target fragment is amplified; specific crRNA is designed to guide Cas12a to recognize a target fragment and activate the trans-cleavage activity of Cas12a, a fluorescence signal report group FQ probe is cleaved, and a result can be observed in real time through a luminoscope. On the basis, the invention further provides a kit and a detection method for rapidly detecting the nucleic acid of the schistosoma japonicum katsurada. The kit and the detection method are simple to operate, high in sensitivity and good in specificity, detection can be completed only through constant-temperature heating equipment, the kit and the detection method can be suitable for multi-scene on-site screening, and a new technology and a new method are provided for detection of schistosoma japonicum katsurada.

Description

Technical Field

[0001] The present invention belongs to the technical field of Schistosoma japonicum detection, and relates to primers, crRNAs and their applications for rapidly detecting Schistosoma japonicum nucleic acid based on the Sj28S-LAMP-CRISPR / Cas12a system. Background Art

[0002] Schistosomiasis is a zoonotic parasitic disease that seriously endangers human health and hinders social and economic development. Among them, Schistosoma japonicum, Schistosoma mansoni and Schistosoma haematobium are particularly harmful and widespread, and Schistosoma japonicum is mainly prevalent in China. After more than 70 years of active prevention and control, remarkable results have been achieved in the prevention and control of Schistosoma japonicum prevalent in China. As of the end of 2023, all Schistosoma japonicum endemic areas in China have passed the assessment of transmission interruption and are in a low-prevalence state.

[0003] At present, traditional detection technologies mainly based on pathogen and immunological diagnosis have disadvantages such as insufficient sensitivity and inapplicability to early detection, and may have a lag in the assessment of the current epidemic situation and a certain missed diagnosis rate. Molecular detection technologies have high application value in the detection of early and low-level Schistosoma infections due to their high sensitivity and specificity. Loop-mediated isothermal amplification (LAMP), as a new molecular biology detection tool, can achieve explosive amplification of nucleic acid DNA in a short time under isothermal conditions, and has advantages such as high sensitivity, simple and fast operation, no need for expensive instruments, and high cost-effectiveness. The limitations of LAMP mainly lie in primer self-aggregation, which is prone to non-specific amplification, resulting in false positive results; and in terms of sensitivity, the LAMP technology has strict restrictions on the length of the amplified target sequence, and the detection sensitivity is low when using the LAMP technology alone. Therefore, even with the assistance of professional software for design, the above problems cannot be effectively solved, thus limiting its application in the detection of Schistosoma japonicum.

[0004] Clustered regularly interspaced short palindromic repeats / CRISPR associated proteins (CRISPR / Cas) system is a unique system evolved from bacteria and archaea, with the ability to specifically recognize target sequences and trans-cleavage properties, and also has extensive applications in in vitro diagnosis.

[0005] At present, there is an urgent need for a Schistosoma japonicum detection kit and method that can combine LAMP technology and CRISPR / Cas system and has high sensitivity and specificity. Summary of the Invention

[0006] To overcome the disadvantages and deficiencies of the prior art, the present invention combines LAMP amplification and CRISPR / Cas12a system to provide a primer, crRNA and its application for rapid detection of Schistosoma japonicum nucleic acid based on Sj28S-LAMP-CRISPR / Cas12a system. By designing specific LAMP primers for specific target sequences in the Sj28s gene of Schistosoma japonicum, the target fragment is amplified, significantly improving the sensitivity and specificity of Schistosoma japonicum detection. Moreover, by designing specific crRNA to guide Cas12a to recognize the target fragment and activate the trans-cleavage activity of Cas12a, the fluorescent signal reporter group FQ probe is cleaved, which can distinguish non-specific amplification and further amplify the detection signal, improving the sensitivity and specificity. In addition, the present invention further amplifies the fluorescence detection signal by optimizing the reaction system of LAMP amplification and the reaction system of CRISPR detection, improving the sensitivity and specificity.

[0007] The object of the present invention can be achieved by the following solutions:

[0008] In the first aspect, the present invention provides a primer and crRNA composition for rapid detection of Schistosoma japonicum nucleic acid based on LAMP-CRISPR / Cas12a, including a LAMP primer pair, crRNA and ssDNA probe;

[0009] Among them, the sequences of the LAMP primer pair include:

[0010] The sequence of the outer primer Sj28S-F3 is shown in SEQ ID NO.1; the specific sequence is: 5'-GCAGTTGCGTATGTGAGCT-3';

[0011] The sequence of the outer primer Sj28S-B3 is shown in SEQ ID NO.2; the specific sequence is: 5'-AGGCAACAGGATCTCACCTT-3';

[0012] The sequence of the inner primer Sj28S-FIP is shown in SEQ ID NO.3; the specific sequence is: 5'-TCCGTGTTTCAAGACGGGTCAG-AATGGGCCAATAGTCTGTGG-3';

[0013] The sequence of the inner primer Sj28S-BIP is shown in SEQ ID NO.4; the specific sequence is: 5'-AACATGTGCGCGAGTCATTGGG-GCCGAACCTTTACCTTCACT-3';

[0014] The crRNA sequence is as shown in SEQ ID NO.5; specifically, the sequence is: UAAUUUCUACUAAGUGUAGAU-GGUUUCGUAACGCCCAAUGACUC;

[0015] The ssDNA probe sequence is as shown in SEQ ID NO.6; specifically, the sequence is: 5'-FAM-TTATTATT-BHQ1-3'.

[0016] As an embodiment of the present invention, the target sequence of the LAMP primer pair is as shown in SEQ ID NO.7.

[0017] The specific amplification fragment corresponding to the LAMP primer pair of the present invention is located between the 890bp - 1082bp sites of the Schistosoma japonicum ribosomal gene Sj28S (GenBank accession number: Z46504.4), with a size of 193bp, and its nucleotide sequence is:

[0018] 5'-gcagttgcgtatgtgagcttttgaatgggccaatagtctgtggtgtagtggtagacgatccacctgacccgtcttgaaacacg gaccaaggagtttaacatgtgcgcgagtcattgggcgttacgaaacccaaaggcgaagtgaaggtaaaggttcggctttcagtccgaa ctaaggtgagatcctgttgcct-3'.

[0019] As an embodiment of the present invention, the 5' and 3' ends of the ssDNA probe are respectively provided with a fluorescent group and a quenching group, wherein the fluorescent group includes FAM, and the quenching group includes BHQ1. The ssDNA probe sequence of the present invention is a fluorescence-quenching dual-labeled ssDNA probe FQ.

[0020] In a second aspect, the present invention provides an application of the primer and crRNA composition in the preparation of a kit for rapid detection of Schistosoma japonicum nucleic acid.

[0021] In a third aspect, the present invention provides a kit for rapid detection of Schistosoma japonicum nucleic acid, and the kit includes the primer and crRNA composition.

[0022] As an embodiment of the present invention, in the primer and crRNA composition, the concentrations of the outer primers Sj28S-F3 and Sj28S-B3 are both 4 - 6 μM; the concentrations of the inner primers Sj28S-FIP and Sj28S-BIP are both 35 - 45 μM; the concentration of crRNA is 50 - 200 nmol / L; the concentration of the ssDNA probe is 50 - 400 nmol / L.

[0023] Preferably, in the primer and crRNA composition, the concentrations of the outer primers Sj28S-F3 and Sj28S-B3 are both 5 μM; the concentrations of the inner primers Sj28S-FIP and Sj28S-BIP are both 40 μM; the concentration of the crRNA is 200 nmol / L; the concentration of the ssDNA probe is 400 nmol / L.

[0024] As an embodiment of the present invention, the kit further includes: 2×LAMP buffer, Bst2.0 DNA polymerase, NEBuffer r2.1, LbaCas12a protein, nuclease-free water.

[0025] Furthermore, the 2×LAMP buffer includes the following components: MgSO4, Betaine, dNTPs, 10×Isothermal reaction buffer; the 10×Isothermal reaction buffer includes MgSO4, TrisHCl (pH 8.8), KCl, (NH4)2SO4, Tween-20.

[0026] Fourthly, the present invention provides a method for rapidly detecting Schistosoma japonicum nucleic acid for non-diagnostic purposes by using the kit, including the following steps:

[0027] Step 1: Extract the nucleic acid of the sample to be detected;

[0028] Step 2: Configure the reaction system for LAMP amplification and perform LAMP amplification;

[0029] The reaction system for LAMP amplification includes: 10×Isothermal reaction buffer, MgSO4, Betaine, Bst2.0 DNA polymerase, dNTPs, outer primers Sj28S-F3 and Sj28S-B3, inner primers Sj28S-FIP and Sj28S-BIP, sample nucleic acid, nuclease-free water;

[0030] The reaction conditions for LAMP amplification are: amplify at 61 - 65 °C for 20 - 40 minutes;

[0031] Step 3: Configure the reaction system for CRISPR detection and perform CRISPR detection;

[0032] The reaction system for the CRISPR detection includes: LAMP amplification product, LbaCas12a protein, crRNA, NEBuffer r2.1, ssDNA probe, and nuclease-free water;

[0033] The reaction conditions for the CRISPR detection are: reacting at 37 °C for 10 - 30 minutes;

[0034] Step 4: Judge the result according to the fluorescence group signal value of the CRISPR detection.

[0035] It should be noted that the method for rapidly detecting Schistosoma japonicum nucleic acid provided by the present invention is for non-disease diagnosis and treatment purposes. For example, it can be used to rapidly detect the nucleic acid situation of Schistosoma japonicum in the environment such as water bodies and soil samples, that is, all situations related to Schistosoma japonicum that are not directly used for diagnosing or treating diseases or symptoms of human or animal bodies can adopt the technical means of the present invention. Of course, for diagnosing or treating diseases or symptoms of human or animal bodies related to Schistosoma japonicum, the technical means of the present invention can also be adopted.

[0036] As an embodiment of the present invention, in Step 1, a DNA extraction kit is used to extract the nucleic acid of the sample to be detected to obtain the nucleic acid to be detected.

[0037] As an embodiment of the present invention, in Step 2, the concentration of Mg 2+ in the reaction system of the LAMP amplification is 4 - 10 mmol / L. The preferred concentration is 8 mmol / L. The Mg 2+ of the present invention is derived from MgSO4 in 10×Isothermal reaction buffer and additionally added MgSO4.

[0038] As an embodiment of the present invention, in Step 2, the concentration of Betaine is 0.4 - 1.0 mol / L. The preferred concentration is 0.8 mol / L.

[0039] Preferably, in Step 2, the reaction conditions for the LAMP amplification are: amplifying at 65 °C for 30 minutes.

[0040] Preferably, in Step 2, the reaction system for the LAMP amplification includes: 2.5 μL of 10×Isothermalreaction buffer, 8 mmol / L Mg 2+, 0.8M Betaine, 320U / mL Bst2.0 DNA polymerase, 1.4mmol / L dNTPs, 0.2μM outer primer Sj28S-F3 and Sj28S-B3, 1.6μM inner primer Sj28S-FIP and Sj28S-BIP, 2.0μL of template DNA, and nuclease-free water was added to make up 25μL.

[0041] As an embodiment of the present invention, in step 3, the concentration of the LbaCas12a protein is 50 - 400 nM. The preferred concentration is 200 nM.

[0042] Preferably, in step 3, the reaction system for CRISPR detection includes: 3μL of LAMP amplification product, 200 nM of LbaCas12a protein, 200 nM of crRNA, 2μL of NEBuffer r2.1, 400 nM of ssDNA probe, and nuclease-free water.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] 1. The present invention combines LAMP amplification with the CRISPR / Cas12a system to provide a primer and crRNA composition for rapid detection of Schistosoma japonicum nucleic acid. After rapid amplification of Schistosoma japonicum nucleic acid, this composition can accurately identify the amplification product and display the result with the fluorescence signal value of the fluorophore group, so as to meet the prevention and control work requirements under the existing monitoring system and provide technical support for accurately and timely identifying potential risk environments.

[0045] 2. The present invention designs specific LAMP primers for the specific target sequence (between 890bp - 1082bp sites) in the Sj28S gene of Schistosoma japonicum to amplify the target fragment, significantly improving the sensitivity and specificity of Schistosoma japonicum detection.

[0046] 3. The present invention designs specific crRNA to guide Cas12a to recognize the target fragment and activate the trans-cleavage activity of Cas12a, cleave the fluorescence signal reporter group FQ probe, can distinguish non-specific amplification and further amplify the detection signal, improving the sensitivity and specificity.

[0047] 4. The present invention also optimizes the reaction system of LAMP amplification and the reaction system of CRISPR detection to further amplify the fluorescence detection signal and improve the sensitivity and specificity.

[0048] 5. The detection kit of the present invention has the feasibility and excellent performance for detecting trace Schistosoma japonicum circulating nucleic acid and egg DNA in fecal samples, has early detection value, and can be used for early identification and screening in the laboratory for non-diagnostic purposes.

[0049] 6. Compared with other combined LAMP and CRISPR / Cas technologies, the method provided by the present invention optimizes the design idea of LAMP primers for amplifying Schistosoma japonicum, and can amplify more nucleic acids of Schistosoma japonicum by using the conserved region of the shorter gene Sj28S gene (between the 890bp-1082bp sites, with a size of 193bp), effectively meeting the length requirement of the amplified fragment by the LAMP technology. Combining with the CRISPR / Cas technology can make up for the problems of easy non-specific amplification or primer dimer in the amplification using the LAMP technology by the present method, and finally achieve higher specificity and sensitivity (the minimum detection limits of genomic and plasmid DNA are 10fg / μl and 1 copy / μL respectively).

[0050] 6. The detection method of the present invention has the characteristics of high sensitivity, rapid detection, simple portability, and does not require expensive instruments, and is suitable for the early diagnosis, identification and screening of schistosomiasis in laboratories and on-site. Brief Description of the Drawings

[0051] By reading the detailed description of the non-restrictive embodiments with reference to the following drawings, other features, objects and advantages of the present invention will become more obvious:[[]]END]]

[0052] Figure 1 For LAMP primer screening combination;

[0053] Figure 2 For the optimization result of Mg 2+ concentration in the LAMP reaction;

[0054] Figure 3 For the optimization result of betaine Betaine concentration in the LAMP reaction;

[0055] Figure 4 For the optimization result of the LAMP reaction temperature;

[0056] Figure 5 For the screening result of different crRNA activities of LAMP-CRISPR;

[0057] Figure 6 For the optimization result of crRNA concentration in the LAMP-CRISPR reaction;

[0058] Figure 7 For the optimization result of Lbacas12a concentration in the LAMP-CRISPR reaction;

[0059] Figure 8 For the optimization result of ssDNA concentration in the LAMP-CRISPR reaction;

[0060] Figure 9 For the optimization result of the LAMP pre-amplification time;

[0061] Figure 10 Results of the limit of detection tests for the LAMP and LAMP-CRISPR methods;

[0062] Figure 11 Results of the specificity tests for the LAMP-CRISPR method;

[0063] Figure 12 Evaluation of the effectiveness of the LAMP-CRISPR method for detecting Schistosoma japonicum cercaria-infected mouse feces. Detailed implementation manners

[0064] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. The following examples are implemented on the premise of the technical solution of the present invention, providing detailed implementation manners and specific operation procedures, which will help those skilled in the art to further understand the present invention. It should be noted that the protection scope of the present invention is not limited to the following embodiments. Several adjustments and improvements made on the premise of the concept of the present invention all fall within the protection scope of the present invention.

[0065] Example 1: Screening of specific target genes and primer design

[0066] Taking the ribosomal gene Sj28S of Schistosoma japonicum as the target gene, using the MEGA 11.0 software for homology alignment and selection of conserved target sequences, and designing LAMP primers for the specific conserved region of the target gene in the primer design software Primer Explorer, version 5 (http: / / primerexplorer.jp / lampv5e / index.html). The sequences are shown in Table 1. The screening process is as follows:

[0067] Table 1

[0068]

[0069]

[0070] Combining the peak emergence time and the end turbidity value for interpretation, the results are as Figure 1 shown. The reaction efficiency rankings of each primer group are as follows: Primer group 3 > Primer group 1 > Literature primer group (Sj28S-ref) > Primer group 2. Therefore, the outer primer pair 3 and the inner primer pair 3 are finally selected as the best LAMP primer pair for each primer group, as follows:

[0071] Sj28S-F3: 5'-GCAGTTGCGTATGTGAGCT-3' (SEQ ID NO.1);

[0072] Sj28S-B3: 5'-AGGCAACAGGATCTCACCTT-3' (SEQ ID NO.2);

[0073] Sj28S-FIP: 5'-TCCGTGTTTCAAGACGGGTCAG-AATGGGCCAATAGTCTGTGG-3' (SEQ ID NO.3);

[0074] Sj28S-BIP: 5'-AACATGTGCGCGAGTCATTGGG-GCCGAACCTTTACCTTCACT-3' (SEQ ID NO.4).

[0075] The specific amplification fragment corresponding to the above primers is located between the 890bp - 1082bp sites of the Schistosoma japonicum ribosomal gene Sj28S (GenBank accession number: Z46504.4), with a size of 193bp, and its nucleotide sequence is:

[0076] 5'-gcagttgcgtatgtgagcttttgaatgggccaatagtctgtggtgtagtggtagacgatccacctgacccgtcttgaaacacg gaccaaggagtttaacatgtgcgcgagtcattgggcgttacgaaacccaaaggcgaagtgaaggtaaaggttcggctttcagtccgaa ctaaggtgagatcctgttgcct-3' (SEQ ID NO.7).

[0077] Example 2: Establishment and condition optimization of LAMP for detection of Schistosoma japonicum

[0078] Step 1: Use the Qiagen Blood / Tissue DNA Extraction Kit to extract nucleic acids from the sample to be detected, obtaining the nucleic acids of the sample to be detected;

[0079] Step 2: The initial LAMP reaction system (25 μL) includes: 1 μL of LAMP primer mixture (FIP (40 μM), BIP (40 μM), F3 (5 μM), B3 (5 μM), ddH2O), 2.5 μL of 10×Isothermal reaction buffer (2 mmol / l MgSO4), 1.5 μL of MgSO4 (2 - 6 mmol / L), 3.5 μL of dNTP Mix (1.4 mmol / L), 4 μL of betaine Betaine (0.4 - 1.0 M), 1 μL of Bst2.0 DNA polymerase (320 U / mL) and 2 μL of sample nucleic acid, and ddH2O is added to make up to 25 μL. Prepare the reaction system, mix well and place it in a LAMP real-time turbidimeter for incubation at a constant temperature of 61 - 65 °C for 10 - 60 minutes.

[0080] Optimization of LAMP reaction system and reaction conditions:

[0081] Mg 2+ Concentration: According to the initial reaction system, set the Mg 2+ concentration to 4, 6, 8, 10 mmol / L, monitor the results using a real-time turbidimeter, and the reaction results are as Figure 2 shown. When the Mg 2+ concentration is 8 mmol / L, the LAMP amplification efficiency is the highest.

[0082] Betaine Betaine concentration: Under the optimal Mg 2+ and dNTP concentrations, set the betaine concentration to 0.4, 0.6, 0.8, 1.0 mol / L, monitor the results using a real-time turbidimeter, and the reaction results are as Figure 3 shown. When the betaine concentration is 0.8 mol / L, the LAMP amplification efficiency is the highest.

[0083] Reaction temperature: Under the optimal reaction system, set the reaction temperature to 61 °C, 63 °C, 65 °C, monitor the results using a real-time turbidimeter, and the reaction results are as Figure 4 shown. When the temperature is 65 °C, the LAMP amplification efficiency is the highest.

[0084] Example 3: Sensitivity of LAMP for detecting Schistosoma japonicum

[0085] According to the optimized reaction system in Example 2, using adult Schistosoma japonicum DNA with gradient concentrations of 1 ng / μl, 100 pg / μl, 10 pg / μl, 1 pg / μl, 100 fg / μl, 10 fg / μl, 1 fg / μl as templates, and containing 10 6 、10 5 、10 4 、10 3 、102 and 10 1 and 10 0 and 10 -1 Using the recombinant plasmid DNA (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) at 10 copies / μl as the template and ddH2O as the negative control, a LAMP real-time turbidimeter was used to evaluate the lowest detection limit of this method.

[0086] The results showed that in the evaluation of adult sensitivity, the result discrimination method of the LAMP real-time turbidimetry showed ( Figure 10 ), when the genomic concentration of Schistosoma japonicum adults was 1 ng / μl, 100 pg / μl, 10 pg / μl, 1 pg / μl, and 100 fg / μl, a significant increase in the turbidimetry value was visible. Therefore, the lowest detection limit of this LAMP method for the genomic DNA of Schistosoma japonicum adults could reach 100 fg / μl. In the evaluation of plasmid sensitivity, the result discrimination method of the LAMP real-time turbidimetry showed ( Figure 10 ) 10 6 and 10 5 and 10 4 and 10 3 and 10 2 and 10 1 In the group with 10 copies / μL, a significant increase in the turbidimetry value was visible. Therefore, the lowest detection limit of this LAMP method for the plasmid DNA of Schistosoma japonicum could reach 10 copies / μL.

[0087] Example 4: Establishment and condition optimization of the LAMP-CRISPR / Cas12a system for detecting Schistosoma japonicum

[0088] The initial reaction system (20 μl) of Sj28S-LAMP-CRISPR / Cas12a included: 2 μl of NEBbuffer r2.1, 50 - 400 nmol / L Lbcas12a protein, 50 - 200 nmol / L crRNA, 50 - 400 nmol / L ssDNA (FAM-TTATTATT-BHQ1, SEQ ID NO.6), 3 μl of the LAMP reaction product, and ddH2O was added to make up to 20 μl. After mixing the reaction system evenly, it was placed in a fluorescence real-time turbidimeter and reacted at 37°C for 10 - 30 min for real-time fluorescence intensity detection.

[0089] Testing of each reaction condition of the LAMP-CRISPR / Cas12a fluorescence detection system:

[0090] Screening of different crRNA activities: Using the online design tool CRISPOR (http: / / crispor.gi.ucsc.edu / ), 3 specific crRNAs were designed within the amplification region of the best LAMP primers screened above (Table 2). The three groups of crRNAs were screened through the LAMP-CRISPR / Cas12a fluorescence detection system. Each group used ddH2O as a negative control, and a qPCR instrument was used for real-time fluorescence detection.

[0091] Table 2 Guide RNA sequences

[0092]

[0093] The results are as Figure 5 shown. crRNA3 has no cleavage activity, while both crRNA1 and crRNA2 groups have cleavage activity, and the fluorescence signal of crRNA2 is significantly stronger than that of crRNA1, indicating that the cleavage efficiency of crRNA2 in this reaction system is higher. Therefore, crRNA2 was selected for subsequent experiments.

[0094] Concentration of ssDNA probe: According to the initial reaction system, with other conditions unchanged, the concentration of the ssDNA probe was adjusted to 50 nM, 100 nM, 200 nM, and 400 nM. The detection results are as Figure 8 shown. As the concentration of the ssDNA probe increases, the fluorescence value increases. Therefore, the optimal concentration of the ssDNA probe is 400 nM.

[0095] Concentration of crRNA: After fixing the optimal ssDNA concentration of 400 nM and the concentrations of other components, the final concentration of crRNA was set to 50, 100, 150, and 200 nM. The detection results are as Figure 6 shown. The fluorescence values at 50 nM, 100 nM, and 150 nM do not differ much, but the fluorescence intensity at 200 nM is significantly higher than the other concentrations. Therefore, 200 nM was selected as the optimal concentration for subsequent system optimization.

[0096] Concentration of Lbcas12a: After fixing the optimal ssDNA concentration of 400 nM and the optimal crRNA concentration of 200 nM, the final concentration of Cas12a was set to 50, 100, 200, and 400 nM. The detection results are as Figure 7 shown. When the concentration of Cas12a is 200 nM and 400 nM, the end-point fluorescence value is the highest, and the fluorescence curves almost overlap, which is significantly better than 50 nM and 100 nM. Therefore, based on the principle of comprehensive reaction efficiency and cost-effectiveness, 200 nM was selected as the optimal concentration of Cas12a.

[0097] LAMP pre-amplification time: The LAMP pre-amplification time was set to 10, 20, 30, and 40 min for gradient concentrations of 108 ~10 -2 The recombinant plasmid of / μl was amplified to determine the optimal LAMP pre-amplification time. The results are as Figure 9 shown. Fluorescent signals could be detected by Sj28S-LAMP-CRISPR / Cas12a when pre-amplified for 20 min, and the lowest detection limit could reach 10 copies / μl. As the pre-amplification time was extended, the fluorescent signals were enhanced. When the pre-amplification time was 30 min and 40 min, the sensitivity of the method could reach 1 copy / μl. Therefore, considering the detection time and sensitivity factors comprehensively, 30 min was selected as the optimal time for LAMP pre-amplification to ensure a low detection limit and achieve rapid detection as much as possible.

[0098] Therefore, the selected optimal LAMP primer pair, the optimized reaction system for LAMP amplification, and the optimized reaction system for CRISPR / Cas12a detection were combined to establish the optimal Sj28S-LAMP-CRISPR / Cas12a reaction system.

[0099] Example 5: Evaluation of the sensitivity and specificity of Sj28S-LAMP-CRISPR / Cas12a for detecting Schistosoma japonicum

[0100] According to the optimized reaction system in Example 4, genomic DNA of Schistosoma japonicum adult worms with gradient concentrations of 1 ng / μl, 100 pg / μl, 10 pg / μl, 1 pg / μl, 100 fg / μl, 10 fg / μl, and 1 fg / μl was used as templates, and recombinant plasmid DNA with 10 6 、10 5 、10 4 、10 3 、10 2 、10 1 、10 0 、10 -1 copies / μl was used as templates, and ddH2O was set as a negative control to evaluate the lowest detection limit of the Sj28S-LAMP-CRISPR / Cas12a method.

[0101] Genomic DNA of adult worms of Schistosoma japonicum, Schistosoma mansoni, Clonorchis sinensis, Fasciola gigantica, Paragonimus westermani, Angiostrongylus cantonensis, Echinococcus multilocularis, genomic DNA of Oncomelania hupensis infected with Schistosoma mekongi, positive and negative Oncomelania hupensis infected with Schistosoma japonicum were used as templates, and ddH2O was set as a negative control to evaluate the specificity of the Sj28S-LAMP-CRISPR / Cas12a method.

[0102] The results showed that in the evaluation of the sensitivity of adult worms and plasmids, the results of Sj28S-LAMP-CRISPR / Cas12a showed ( Figure 10), the minimum detection limits of this method for Schistosoma japonicum adult worm genome and plasmid DNA were 10 fg / μl and 1 copy / μL, respectively. The specific evaluation results showed that ( Figure 11 ), the Sj28S-LAMP-CRISPR / Cas12a detection system showed positive results only for Schistosoma japonicum and positive Oncomelania hupensis, while negative results were obtained for the genomic detection of Schistosoma mansoni, Clonorchis sinensis, Fasciola gigantica, Paragonimus westermani, Angiostrongylus cantonensis, Echinococcus multilocularis, positive Tricula aperta, and negative Oncomelania hupensis, indicating that this method had no cross-reaction with common parasites or their intermediate hosts and had good specificity.

[0103] Example 6: Evaluation of the effect of Sj28S-LAMP-CRISPR / Cas12a in detecting Schistosoma japonicum cercaria-infected mouse feces

[0104] Sixty 6-week-old female BALB / c mice were used as the experimental group and randomly divided into 3 groups, with 20 mice in each group housed in 4 cages. The mice in the 3 experimental groups were infected with 40, 20, and 10 Schistosoma japonicum cercariae by the abdominal patch method, respectively. Taking each cage (5 mice) as a mixed unit, the mixed fecal samples of the mice in each infected group were collected at 3, 4, 5, and 6 weeks after infection. There were 4 parallel fecal samples at each time point for each infected group, totaling 48 samples. At the same time, 2 mixed fecal samples of the negative control group were collected.

[0105] Using the optimized experimental conditions, Sj28S-LAMP-CRISPR / Cas12a was used to detect the DNA of mouse feces after infection, to investigate the performance of this method in detecting nucleic acids in fecal samples infected with Schistosoma japonicum, and to evaluate its early detection value.

[0106] After extracting the DNA from the feces of mice infected with different infection intensities (10, 20, 40 cercariae) at 3W, 4W, 5W, and 6W, the detection value of this detection technology for early infection was evaluated.

[0107] The results of the fecal samples showed that ( Figure 12, wherein, 3,1 - 3,4, 3,5 - 3,8, 3,9 - 3,12: mixed fecal samples of mice at the third week after infection with 40 cercariae, 20 cercariae, and 10 cercariae of Schistosoma japonicum; 4,1 - 4,4, 4,5 - 4,8, 4,9 - 4,12: mixed fecal samples of mice at the fourth week after infection with 40 cercariae, 20 cercariae, and 10 cercariae of Schistosoma japonicum; 5,1 - 5,4, 5,5 - 5,8, 5,9 - 5,12: mixed fecal samples of mice at the fifth week after infection with 40 cercariae, 20 cercariae, and 10 cercariae of Schistosoma japonicum; 6,1 - 6,4, 6,5 - 6,8, 6,9 - 6,12: mixed fecal samples of mice at the sixth week after infection with 40 cercariae, 20 cercariae, and 10 cercariae of Schistosoma japonicum; PC: positive control; NC: negative feces; NTC: ddH2O). The overall positive rates of Sj28S-LAMP-CRISPR / Cas12a for detecting DNA in 48 mixed fecal samples of infected mice were 85.42% (41 / 48). Analyzed by sampling time, the detection results of both methods for all fecal samples at the 5th and 6th weeks after infection of mice with different infection gradients were positive (24 / 24), and the fecal samples of mice in the infected group at the 3rd week could be detected as early as possible (9 / 12). It is indicated that this detection method can be used for the feasibility and excellent performance of detecting trace Schistosoma japonicum circulating nucleic acids and egg DNA in fecal samples, has early detection value, and can be used for early identification and screening in the laboratory for non-diagnostic purposes.

[0108] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various deformations or modifications within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A primer and crRNA composition for rapid detection of Schistosoma japonicum nucleic acid based on LAMP-CRISPR / Cas12a, characterized in that: Including LAMP primer pair sequence, crRNA sequence and ssDNA probe sequence; Wherein, the LAMP primer pair sequence includes: The sequence of the outer primer Sj28S-F3 is shown in SEQ ID NO.1; The sequence of the outer primer Sj28S-B3 is shown in SEQ ID NO.2; The sequence of the internal primer Sj28S-FIP is shown in SEQ ID NO. 3; The sequence of the internal primer Sj28S-BIP is shown in SEQ ID NO.4; The crRNA sequence is shown in SEQ ID NO.5; The ssDNA probe sequence is shown as SEQ ID NO.

6.

2. The primer and crRNA composition according to claim 1, characterized in that: The target sequence of the LAMP primer pair sequence is shown in SEQ ID NO.7; the 5' and 3' ends of the ssDNA probe carry a fluorescent group and a quenching group, respectively, wherein the fluorescent group includes FAM and the quenching group includes BHQ1.

3. Use of the primer and crRNA composition as claimed in claim 1 or 2 in the preparation of a kit for rapid detection of Schistosoma japonicum nucleic acid.

4. A kit for rapid detection of Schistosoma japonicum nucleic acid, characterized in that: The kit comprises the primers and crRNA composition according to claim 1 or 2; in the primers and crRNA composition, the concentrations of the outer primers Sj28S-F3 and Sj28S-B3 are both 4-6 μM; the concentrations of the inner primers Sj28S-FIP and Sj28S-BIP are both 35-45 μM; the concentration of crRNA is 50-200 nmol / L; and the concentration of the ssDNA probe is 50-400 nmol / L.

5. The kit according to claim 4, characterized in that In the primer and crRNA composition, the concentrations of the outer primers Sj28S-F3 and Sj28S-B3 are both 5 μM; the concentrations of the inner primers Sj28S-FIP and Sj28S-BIP are both 40 μM; the concentration of the crRNA is 200 nmol / L; and the concentration of the ssDNA probe is 400 nmol / L.

6. The kit according to claim 4, characterized in that The kit also includes: 2×LAMP buffer, Bst2.0 DNA polymerase, NEBuffer r2.1, LbaCas12a protein, and nuclease-free water; the 2×LAMP buffer includes the following components: MgSO4, Betaine, dNTPs, and 10×Isothermal reaction buffer; wherein the 10×Isothermal reaction buffer includes MgSO4, Tris HCl, pH 8.8, KCl, (NH4)2SO4, and Tween-20.

7. A method for rapid detection of Schistosoma japonicum nucleic acid using the kit according to any one of claims 4 to 6 for non-diagnostic purposes, characterized in that: The following steps are involved: Step 1: Extract nucleic acid from the sample to be tested; Step 2: Prepare the reaction system for LAMP amplification and perform LAMP amplification; The reaction system of LAMP amplification includes: 10×Isothermal reaction buffer, MgSO4, Betaine, Bst2.0 DNA polymerase, dNTPs, outer primers Sj28S-F3 and Sj28S-B3, inner primers Sj28S-FIP and Sj28S-BIP, sample nucleic acid, and nuclease-free water; The reaction conditions of the LAMP amplification are: 61-65°C for 20-40 minutes; Step 3: Configure the reaction system for CRISPR detection and perform CRISPR detection; The reaction system of the CRISPR detection includes: LAMP amplification product, LbaCas12a protein, crRNA, NEBufferr2.1, ssDNA probe, and nuclease-free water; The reaction conditions of the CRISPR assay are: 37°C for 10-30 minutes; Step 4: Determine the result based on the fluorescent group signal value detected by CRISPR.

8. The method according to claim 7, characterized in that In step 2, the Mg in the LAMP amplification reaction system 2+ The concentration of is 4-10mmol / L; the concentration of Betaine is 0.4-1.0mol / L; Or, the concentration of the LbaCas12a protein is 50-400nM.

9. The method according to claim 7, characterized in that: In step 2, the Mg in the LAMP amplification reaction system 2+ The concentration of is 8mmol / L; the concentration of Betaine is 0.8mol / L; Or, the concentration of the LbaCas12a protein is 200nM.

10. The method according to claim 7, characterized in that In step 2, the reaction conditions of the LAMP amplification are: amplification at 65° C. for 30 minutes.

Images