Molecular marker related to egg yolk color and application thereof

Through the SNP molecular markers found on the chicken reference genome 8, the chicken genome genome was detected and the high-quality parents were selected for breeding, the problem of high cost and low accuracy of traditional breeding methods was solved, and the early accurate selection of egg yolk color was achieved and the progress of breeding was accelerated.

CN120210388APending Publication Date: 2025-06-27INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510518151.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

The traditional egg yolk color breeding method consumes a lot of manpower and financial resources, has high cost and low accuracy, and the breeding progress is slow.

Method used

The genotype of the chicken to be tested was detected by SNP molecular markers found at locus 18935282 from the end of 5’ on the chicken reference genome 8, and high-quality parents were selected for breeding according to the AA, GA, and GG genotypes, and early selection accelerated the breeding progress of egg yolk color depth.

Benefits of technology

It has achieved early accurate selection of egg yolk color, improved the speed and accuracy of breeding progress, and has great application value and economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210388A_ABST
    Figure CN120210388A_ABST
Patent Text Reader

Abstract

The invention provides a molecular marker related to egg yolk color and application thereof, and belongs to the technical field of gene detection. The molecular marker is an SNP (Single Nucleotide Polymorphism) molecular marker and corresponds to the 18935282 site from the 5'tail end on a chromosome 8 of chicken reference genome Galusgallus 7.0 W version sequence information published in ENSEMBL, and the basic group at the site is A / G. The SNP molecular marker is related to the color of egg yolk, is a new molecular marker, can accelerate the breeding progress of the character by detecting the genotype of the locus of a chicken individual to be determined and performing early selection on the chicken with the dominant genotype (consistent with the breeding target direction), and has great application value and economic benefit.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and particularly relates to a molecular marker related to the egg yolk color and its application. Background Art

[0002] Eggs are an important source of high-quality protein on consumers' tables. Since the egg yolk color is usually associated with "free-range eggs", "local eggs", "flavor", etc., to a certain extent, the egg yolk color will affect consumers' willingness to buy and the price of eggs. Consumers usually prefer eggs with a darker and brighter egg yolk color. In addition, at present, extending the laying cycle of laying hens is a major trend in the laying hen industry, that is, the feeding time of laying hens is extended from about 70 weeks originally to 90 or even 100 weeks, so as to average the brooding and rearing costs per chicken and improve the utilization efficiency of chicken seedlings. However, due to the gradual decrease in the ability of pigment metabolism and absorption with the increase in the age of the chicken, the egg yolk color also decreases accordingly. Therefore, the egg yolk color is an important economic trait in the laying hen industry, and the egg yolk color during the extended production period has also attracted attention in current laying hen breeding and is used as one of the breeding objectives for strains.

[0003] The traditional breeding method for egg yolk color requires multiple individual determinations of egg yolk color in the whole flock. The defects include: consuming a large number of eggs and manpower for determination work, with high costs; the trait determination can only be carried out in the late laying period of chickens and cannot be used for early selection; the determination can only be carried out on hens, and the breeding of roosters needs to be selected according to the determination results of siblings or offspring, reducing the selection accuracy. Identifying molecular markers associated with traits will help establish molecular breeding methods for traits. Genome-wide association study is one of the most important methods for identifying genetic variations of complex traits. Through the selection of genetic variations such as SNP molecular markers, early and accurate selection of traits can be carried out, and the breeding progress of target traits can be further improved genetically. Therefore, the discovery and verification of molecular markers for egg yolk color in eggs and the establishment of molecular breeding technologies are of great significance for improving the breeding progress of this trait. Summary of the Invention

[0004] The purpose of the present invention is to provide a molecular marker related to the egg yolk color and its application, aiming to solve the technical problems in the prior art that the traditional breeding method consumes a large amount of manpower and financial resources, has high costs and low accuracy, and slow breeding progress.

[0005] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0006] The present invention provides a molecular marker related to the egg yolk color, and the molecular marker is a SNP molecular marker, corresponding to the 18,935,282nd position starting from the 5' end on chromosome 8 of the chicken reference genome Gallus_gallus7.0_W version sequence information published in ENSEMBL, and the base here is A / G.

[0007] Furthermore, when the SNP molecular marker is of the AA genotype, it corresponds to a dark egg yolk color; when it is of the GA genotype, it corresponds to a medium egg yolk color; when it is of the GG genotype, it corresponds to a light egg yolk color.

[0008] The present invention also provides a primer pair for detecting the molecular marker related to the egg yolk color of the above technical solution. The primer pair includes an upstream primer and a downstream primer. The upstream primer is as shown in SEQ ID NO:2, and the downstream primer is as shown in SEQ ID NO:3.

[0009] The present invention also provides an application of the molecular marker related to the egg yolk color of the above technical solution in identifying or assisting in identifying the egg yolk color. The specific application is as follows: detecting the genotype of the SNP in the chicken to be tested. For the chicken to be tested with the GG genotype, the egg yolk color of the eggs obtained is light; for the chicken to be tested with the GA genotype, the egg yolk color of the eggs obtained is medium; for the chicken to be tested with the AA genotype, the egg yolk color of the eggs obtained is dark.

[0010] The present invention also provides an application of the molecular marker related to the egg yolk color of the above technical solution in chicken breeding. The specific application is as follows: detecting the genotype of the SNP in the chicken to be tested, and selecting the parent with the AA genotype for breeding.

[0011] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0012] The SNP molecular marker of the present invention is related to the egg yolk color of eggs and is a new molecular marker. By detecting the genotype of this locus in the chicken to be tested and making early selection of chickens with the dominant genotype (consistent with the breeding goal direction), the breeding progress of this trait can be accelerated, and it has great application value and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is a schematic diagram of the results of the genome-wide association analysis in Example 1. DETAILED DESCRIPTION OF THE INVENTION

[0014] The present invention provides a molecular marker related to the egg yolk color of eggs. The molecular marker is an SNP molecular marker, corresponding to the 18935282nd position from the 5' end on chromosome 8 of the chicken reference genome Gallus_gallus7.0_W version sequence information published in ENSEMBL, and the base here is A / G.

[0015] Furthermore, when the SNP molecular marker is of the AA genotype, it corresponds to a dark egg yolk color; when it is of the GA genotype, it corresponds to a medium egg yolk color; when it is of the GG genotype, it corresponds to a light egg yolk color.

[0016] The 18,935,282nd position starting from the 5' end on chromosome 8 in the present invention is hereinafter abbreviated as the chr8:18935282 locus.

[0017] The present invention also provides a primer pair for detecting the molecular marker related to the egg yolk color described in the above technical solution. The primer pair includes an upstream primer and a downstream primer. The upstream primer is as shown in SEQ ID NO:2, and the downstream primer is as shown in SEQ ID NO:3.

[0018] In the present invention, the primer pair is designed and synthesized according to the DNA sequence information of the upstream and downstream of the chr8:18935282 locus published on the Ensemble website, i.e., SEQ ID NO:1, for PCR amplification. The SEQ ID NO:1 is: TCTAATGTTGTCTAACATCTGTTGTTAATATTGCCTGCCACCTGGAAATGAATGAAGAGTTACTCATGGGATATCCAGAAAAAAATGAGTAGTTAGAACCGTCGCTACTGCTTTGAAAGGAGTAGTTCAGTAATTTATGAACGTGGTGGTTTCTCCATATAAACAGATAAAACTTCATTTGAATTTGAGTGATCAAAATTCTGCTTCATAGTGGAAGTTTTGAGGCATGCAATTAATTTTATGAGATTAAG / AGAAAAAAAGCCAAAACAACCTGCTTCAGAGCCCATTGATTTAGAAGGGCTCACCTCGAGGTGGTGACACCATGGGAAATCCAAGTGGAGCTCCCAGGCAGGAGGCAGGGGTGTCCGGTGTGCATCTCCCAGATGGGGACAGAATGAGGCCTCTTCTCTGCAGAGCTGGGTTGGATTTGGTTCTGGTTCTGCTCCCACTGGCTTTGAGTTGCTGTAGCAACAGCATCTGCCCTGTAGAAGACTTTGAGATA.

[0019] In the present invention, the SEQ ID NO:2 is GAACGTGGTGGTTTCTCCAT, and the SEQ ID NO:3 is TCGAGGTGAGCCCTTCTAAA.

[0020] The present invention also provides an application of the molecular marker related to the egg yolk color in the above technical solution in identifying or assisting in identifying the egg yolk color, and the specific application is as follows: detecting the genotype of the SNP in the chicken to be tested, the egg yolk color of the chicken to be tested with the GG genotype is light; the egg yolk color of the chicken to be tested with the GA genotype is medium; the egg yolk color of the chicken to be tested with the AA genotype is dark.

[0021] The present invention also provides an application of the molecular marker related to the egg yolk color in the above technical solution in chicken breeding, and the specific application is as follows: detecting the genotype of the SNP in the chicken to be tested, and selecting the parent with the AA genotype for breeding.

[0022] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0023] Example 1

[0024] Determination of SNP molecular markers related to the egg yolk color level

[0025] (1) Experimental animals: 118 individuals of the White Leghorn pure line were selected. During the breeding process, they were fed ad libitum and provided with drinking water, and the feeding standards complied with the relevant regulations of the industry standard (NY / T 33-2004);

[0026] (2) Extraction of genomic DNA: 0.5 mL of venous blood from the wing of all experimental chickens was collected using anticoagulant vacuum blood collection tubes, and the genomic DNA was extracted by the phenol-chloroform extraction method. The DNA samples with qualified concentration and purity were detected, and then agarose gel electrophoresis was performed to further detect the purity and integrity of the DNA samples. The sample concentration was required to be greater than 50 ng / μL, the purity OD260 / 280 was 1.8-2.0, and the integrity was good. The DNA samples were stored at -20 °C for later use;

[0027] (3) Genomic resequencing: The DNA samples of all experimental chickens were sent to a gene detection company. Using the DNBSEQ sequencing platform, individual whole-genome resequencing was performed according to the standard operating procedures, and the sequencing depth was about 15×; BWA and GATK software were used for sequence alignment and genotype extraction; 7,498,204 SNPs and 203 individuals were obtained for subsequent analysis after further quality control using SNP call rate and MAF;

[0028] (4) Phenotype determination: The egg yolk color of three eggs per chicken at 100 weeks of age was measured using a multifunctional egg quality analyzer. The larger the value, the darker the egg yolk color;

[0029] (5) Genome-wide association study: After organizing the pedigree data, phenotypic data, and genomic SNP locus data, perform a genome-wide association analysis using the GCTA software. The univariate mixed linear model is:

[0030] y = Xb + jα + u + e

[0031] y is the phenotypic value; b is the fixed effect (including population effect and cage effect), X is the corresponding relationship matrix; j is the additive genotype of the SNP locus to be detected, α is the additive SNP effect; u is the random animal effect, following where G is the genomic relationship matrix, is the additive genetic variance; e is the residual effect following where I is the identity matrix, is the residual variance. Calculate the genome-wide FDR value using the R package qvalue, with FDR < 0.01 as the significance threshold (P = 1.43E-06).

[0032] The results of the GWAS analysis are as Figure 1 shown. Based on Figure 1 it can be seen that there is a significant association between the egg yolk color and the region of 1.0 Mb on chromosome 8 (chr8:18206959 - 19259895). Further verify all loci in the genomic association region and lock the locus chr8:18935282 as the candidate locus. The genetic marker information affecting the egg yolk color is shown in Table 1;

[0033] Table 1 Genetic markers affecting egg yolk color

[0034]

[0035] Example 2

[0036] Correlation test of different genotypes at the chr8:18935282 locus with egg yolk color

[0037] (1) Experimental animals: The same as in Example 1.

[0038] (2) Phenotypic determination: The same as in Example 1.

[0039] (3) Extraction of genomic DNA: The same as in Example 1.

[0040] (4) Genotyping of the chr8:18935282 locus: The same as in Example 1.

[0041] (5) Determination of the dominant genotype of the phenotype: For individuals with the GG genotype at the chr8:18935282 locus, the egg yolk color is 4.76; for those with the GA genotype, it is 5.62; and for those with the AA genotype, it is 6.46. (Due to the long feeding cycle, the number of individuals surviving at 100 weeks of age and with measured phenotypes is 118). Therefore, the AA genotype is the dominant genotype for the deep egg yolk color.

[0042] Table 2 Egg yolk colors of individuals with different genotypes at the chicken chr8:18935282 SNP locus

[0043]

[0044] Note: abc: Different superscript letters indicate significant differences between groups (P<0.05).

[0045] Example 3

[0046] Establishment of a molecular marker detection method for the chr8:18935282 locus and its application in breeding Establishment of the molecular marker detection method: According to the upstream and downstream DNA sequence information (SEQ ID NO: 1) of the chr8:18935282 locus published on the Ensemble website, specific primers were designed and synthesized for PCR amplification. The SEQ ID NO: 1 is: TCTAATGTTGTCTAACATCTGTTGTTAATATTGCCTGCCACCTGGAAATGAATGAAGAGTTACTCATGGGATATCCAGAAAAAAATGAGTAGTTAGAACCGTCGCTACTGCTTTGAAAGGAGTAGTTCAGTAATTTATGAACGTGGTGGTTTCTCCATATAAACAGATAAAACTTCATTTGAATTTGAGTGATCAAAATTCTGCTTCATAGTGGAAGTTTTGAGGCATGCAATTAATTTTATGAGATTAAG / AGAAAAAAAGCCAAAACAACCTGCTTCAGAGCCCATTGATTTAGAAGGGCTCACCTCGAGGTGGTGACACCATGGGAAATCCAAGTGGAGCTCCCAGGCAGGAGGCAGGGGTGTCCGGTGTGCATCTCCCAGATGGGGACAGAATGAGGCCTCTTCTCTGCAGAGCTGGGTTGGATTTGGTTCTGGTTCTGCTCCCACTGGCTTTGAGTTGCTGTAGCAACAGCATCTGCCCTGTAGAAGACTTTGAGATA.

[0047] The obtained specific primer sequence information is shown in Table 3, the PCR amplification system is shown in Table 4, and the PCR amplification conditions are shown in Table 5. The genotype of the chr8:18935282 locus was analyzed by the first-generation sequencing results of the amplification products, and the genotype results included GG, GA, and AA.

[0048] Table 3 Specific primer sequence table

[0049] Primer Name Sequence Sequence Listing Corresponding Number Forward Primer GAACGTGGTGGTTTCTCCAT SEQ ID NO:2 Reverse Primer TCGAGGTGAGCCCTTCTAAA SEQ ID NO:3

[0050] Table 4 PCR amplification system table

[0051] Reagent Volume (μL) <![CDATA[ddH2O]]> 8.0 2×Taq Plus Master Mix 10.0 Forward Primer (10 μM) 0.5 Reverse Primer (10 μM) 0.5 Genomic DNA 1.0 Total 20.0

[0052] Table 5 PCR amplification condition table

[0053]

[0054] Application Example 1

[0055] A total of 104 purebred Beijing Fatty Chickens were selected as the breeding objects, and the breeding goal was to deepen the egg yolk color. At 3 weeks of age, blood samples were collected, and genomic DNA was extracted with reference to (3) of Example 1. The site sequence was amplified by specific primers and subjected to first-generation sequencing to genotype the site. Among them, there were 22 individuals with the GG genotype, 43 individuals with the GA genotype, and 39 individuals with the AA genotype. AA-type individuals can be selected according to the dominant genotype with a darker egg yolk color. The chickens were continuously raised until they started laying eggs, and the egg yolk color was measured at 100 weeks of age. The verification results are shown in Table 6. The average egg yolk color of individuals with the AA genotype was 7.01, which was significantly higher than the average egg yolk color of 6.20 for individuals with the GG genotype and 5.94 for the GA genotype.

[0056] Table 6 Correlation index table between individuals with different genotypes at the chr8:18935282 SNP locus of chickens and the egg yolk color

[0057]

[0058] Note: ab: Different lowercase letters in the superscript indicate significant differences between groups (P<0.05).

[0059] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can still be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A molecular marker related to egg yolk color, characterized in that: The molecular marker is a SNP molecular marker, corresponding to the 18935282nd position from the 5' end on chromosome 8 of the chicken reference genome Gallus_gallus7.0_W version sequence information published in ENSEMBL, where the base is A / G.

2. The molecular marker associated with egg yolk color according to claim 1, characterized in that: When the SNP molecular marker is an AA genotype, the corresponding yolk color is dark; when it is a GA genotype, the corresponding yolk color is medium; when it is a GG genotype, the corresponding yolk color is light.

3. A primer pair for detecting a molecular marker associated with egg yolk color as claimed in any one of claims 1 to 2, characterized in that: The primer pair includes an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO:2, and the downstream primer is shown as SEQ ID NO:

3.

4. Use of a molecular marker related to egg yolk color as claimed in any one of claims 1 to 2 in identifying or assisting in identifying egg yolk color, characterized in that: The application is specifically: detecting the genotype of the SNP in the tested chicken, the yolk color of the eggs obtained from the tested chicken with the genotype of GG is light; the yolk color of the eggs obtained from the tested chicken with the genotype of GA is medium; the yolk color of the eggs obtained from the tested chicken with the genotype of AA is dark.

5. Use of a molecular marker related to egg yolk color as claimed in any one of claims 1 to 2 in chicken breeding, characterized in that: The application is specifically: detecting the genotype of the SNP in the chicken to be tested, and selecting parents with the genotype of AA for breeding.