InDel molecular marker related to green leaf pigment content of non-heading Chinese cabbage as well as primer and application of InDel molecular marker

Abstract

The invention provides an InDel molecular marker related to the green leaf pigment content of non-heading Chinese cabbage as well as a primer and application of the InDel molecular marker. The primer sequences of the InDel molecular marker are shown as SEQ ID NO.1 and SEQ ID NO.2. The invention further provides an application of the InDel molecular marker. The InDel molecular marker disclosed by the invention is obtained according to the mutation design of InDel located on an exon of a BraC09g052220 gene. The InDel molecular marker primer pair provided by the invention is remarkably related to the color of green leaves of the non-heading Chinese cabbage and the content of chlorophyll and carotenoid, can be used for molecular assisted breeding and high-quality germplasm resource identification of the non-heading Chinese cabbage, and accelerates the creation of high-quality materials of the non-heading Chinese cabbage and the breeding process of new varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular assisted breeding of non-heading Chinese cabbage, and particularly relates to an InDel molecular marker for assisting in selecting the green leaf color of non-heading Chinese cabbage and the BraC09g052220 gene related to chlorophyll and carotenoid contents, primers thereof, and applications thereof. Background Art

[0002] Non-heading Chinese cabbage, a cruciferous vegetable, is rich in nutrients and is one of the common leafy vegetables in China. Non-heading Chinese cabbage has rich leaf color resources, and green is a common leaf color, which can be divided into yellowish green, light green, conventional green, dark green, etc. The green color of the leaves is mainly regulated by the pigment content, such as chlorophyll and carotenoid. At the same time, chlorophyll and carotenoid are common nutrients, which have the functions of improving human immunity, antioxidation, and protecting the cardiovascular system. With the continuous improvement of people's living standards, the requirements for the color and nutrition of vegetables are also getting higher and higher. Selecting vegetable varieties with high ornamental value and high nutritional quality is the current market demand. In recent years, with the rapid development of molecular biology and genetic engineering technologies, more and more researchers have used molecular assisted breeding methods to efficiently select high-yield, high-quality, and highly resistant vegetable varieties, but there is still a lack of available molecular markers for breeding non-heading Chinese cabbage varieties with green leaf traits.

[0003] BraC09g052220, namely BcSG1, is an important gene involved in chloroplast development, and it has the functions of regulating the development of thylakoid membranes in chloroplasts and regulating the expression of genes related to chloroplast development. Chloroplasts are the main sites for the biosynthesis of chlorophyll and carotenoid, and their quantity and development status are closely related to the pigment content. In the sg1 mutant of Arabidopsis thaliana, the color of the newly grown leaves is white. As the plant grows, the leaves gradually turn from white to white-green, and after three weeks, the leaves are green. Therefore, the SG1 gene has a certain correlation with the green color of leaves in the early development stage.

[0004] In order to efficiently identify the green leaf color of non-heading Chinese cabbage and the chlorophyll and carotenoid contents, and quickly select green leaf varieties that meet the market needs, it is urgent to develop a molecular marker that is closely related to the green leaf color and chlorophyll and carotenoid contents. Summary of the Invention

[0005] The object of the present invention is to provide an InDel molecular marker of the BraC09g052220 gene in non-heading Chinese cabbage and its application; by using wuta-cai with dark green leaves and erqing with yellowish-green leaves as parents to construct a recombinant inbred line population, re-sequencing is carried out on the parents and the recombinant inbred line population to further mine variation sites. Through analysis, it is found that variation sites are found in the exon region of BraC09g052220. An InDel molecular marker is developed for this variation and corresponding primers are set. 36 non-heading Chinese cabbage varieties are used for identification. Among them, 24 germplasm materials with the BraC09g052220 gene as the major gene for green leaves in non-heading Chinese cabbage and non-heading Chinese cabbage varieties cultivated from these 24 core germplasms of non-heading Chinese cabbage can identify the contents of chlorophyll and carotenoids through this marker. Therefore, the molecular marker obtained in the present invention can be used as a molecular marker-assisted breeding for these 24 core germplasm materials of non-heading Chinese cabbage, and can rapidly identify the green leaf color and the contents of chlorophyll and carotenoids of the varieties selected based on these 24 core germplasm materials, reducing the field screening work, which has very positive significance for efficient germplasm screening and breeding work.

[0006] The technical solution of the present invention is as follows:

[0007] The first object of the present invention is to provide the application of an InDel molecular marker closely linked to the trait of the content of green leaf-related pigments in non-heading Chinese cabbage in the molecular marker-assisted breeding of the trait of the content of green leaf-related pigments in non-heading Chinese cabbage. The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4; the application is as follows:

[0008] (1) If the nucleotide sequence of the InDel molecular marker is the fragment shown in SEQ ID NO.3, it is determined that the tested non-heading Chinese cabbage is a high-pigment content variety;

[0009] (2) If the nucleotide sequence of the InDel molecular marker is the fragment shown in SEQ ID NO.4, it is determined that the tested non-heading Chinese cabbage is a low-pigment content variety.

[0010] SEQ ID No.3:

[0011] GCTATATTTTTTAAAGCCCACAAGTCTAAAATGAATCATTACAGACAGGATCCATGATCTTCATTCTCCTTCTTCCTCAGATCTCTCTTTACTGAACAAAGGGTTTGAAGGTTCATCACTCACCACAGTCATGTACTCTCTGGGAAGATTACAGCTTAATCACCTTCCCTTCACTCACACCTCTTCATCCTT

[0015] SEQ ID No.4:

[0016] GCTATATTTTTTAAAGCCCACAAGTCTAAAATGAATCATTACAGACAGGATCTCTCTTTACTGAACAAAGGGTTTGAAGGTTCATCACTCACCACAATCACAATCATGTACTCCCTGGGAAGATTACAGCTTCATCACCAGCCAGCCCACCTTCCCTTCACTCACACCTCTTCATCCTT

[0019] Furthermore, the application further includes (3) if the InDel molecular markers shown in SEQ ID NO.3 and SEQ ID NO.4 are included simultaneously, it is determined that the non-heading Chinese cabbage to be tested is a variety with intermediate pigment content.

[0020] The second object of the present invention is to provide the application of the primer pair for amplifying the aforementioned InDel molecular marker in the auxiliary breeding of the green leaf-related pigment content trait of non-heading Chinese cabbage.

[0021] Furthermore, the primer pair is as shown in SEQ ID NO.1 and SEQ ID NO.2:

[0022] SEQ ID No.1: GCTATATTTTTTAAAGCCCAC;

[0023] SEQ ID No.2: AAGGATGAAGAGGTGTGAGTG.

[0024] The third object of the present invention is to provide the application of the kit for detecting the aforementioned InDel molecular marker in the auxiliary breeding of the green leaf-related pigment content trait of non-heading Chinese cabbage;

[0025] Preferably, the kit includes the primer pair shown in SEQ ID No.1 and SEQ ID No.2.

[0026] The fourth object of the present invention is to provide a method for the auxiliary breeding of the green leaf-related pigment content trait of non-heading Chinese cabbage, and the method includes the following steps:

[0027] (1) Extract the total genomic DNA of the non-heading Chinese cabbage to be tested;

[0028] (2) Perform PCR amplification on the total genomic DNA of the non-heading Chinese cabbage to be tested using the InDel molecular marker primers shown in SEQ ID NO.1 and SEQ ID NO.2;

[0029] (3) Electrophorese and / or sequence the PCR amplification products, and judge the traits of the green leaf-related pigment content of non-heading Chinese cabbage according to the length differences of the amplified fragments and / or the sequencing results of the PCR products.

[0030] Furthermore, if the amplification product only contains a 192bp band and / or only contains a fragment with a sequence as shown in SEQ ID NO.3, the non-heading Chinese cabbage to be tested is a variety with high pigment content; if it only contains a 179bp band and / or only contains a fragment with a sequence as shown in SEQ ID NO.4, the non-heading Chinese cabbage to be tested is a variety with low pigment content; if it contains both 192bp and 179bp bands and / or simultaneously includes the InDel molecular markers shown in SEQ ID NO.3 and SEQ ID NO.3, the non-heading Chinese cabbage to be tested is a heterozygous individual and is a variety with intermediate pigment content.

[0031] Furthermore, the reaction system for the PCR amplification described in step (2) is as follows: The total system for PCR amplification is 10 μl, including 0.5 μl of each of the forward and reverse primers, 5 μl of Taq enzyme, 1 μl (50 ng) of DNA, and 3 μl of ddH2O; the reaction program for the PCR amplification described in step (2) is pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 53°C for 15 s, extension at 72°C for 20 s, for 30 cycles; extension at 72°C for 5 min, and preservation at 10°C.

[0032] Furthermore, the specific operation of the electrophoresis described in step (3) is as follows: Load 5 μl onto a 2% agarose gel, perform electrophoresis at a constant voltage of 120 V for 40 min, turn off the power supply, remove the gel, and perform ultraviolet visualization.

[0033] Furthermore, the green leaf-related pigments in the present invention are total chlorophyll, chlorophyll a, chlorophyll b, and carotenoids.

[0034] Furthermore, the non-heading Chinese cabbage is selected from at least one of the following 24 core germplasms of non-heading Chinese cabbage, or at least one of the non-heading Chinese cabbage varieties cultivated using the 24 core germplasms of non-heading Chinese cabbage as parents:

[0035]

[0036]

[0037] Beneficial effects:

[0038] The molecular markers developed by the present invention have the ability to detect the green leaf color and the levels of chlorophyll and carotenoids in non-heading Chinese cabbage. Using this marker, we can accurately identify the chlorophyll and carotenoid contents and reliably predict the leaf color of a large number of non-heading Chinese cabbage varieties at the seed stage. Compared with traditional breeding methods, this technology greatly shortens the breeding time and improves the accuracy of identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Bands identified by the molecular marker developed for BraC09g052220 in Brassica narinosa and Erqing. The W type is the molecular marker band cloned from Brassica narinosa, and the E type is the molecular marker band cloned from Erqing.

[0040] Figure 2 Correlation analysis chart of the genotype of the molecular marker developed for BraC09g052220 and chlorophyll a, chlorophyll b, total chlorophyll, carotenoids, carotene, and lutein in 36 samples involving 24 species DETAILED DESCRIPTION OF THE INVENTION

[0041] Next, the present invention will be elaborated in detail and comprehensively through specific examples. It should be clear that these examples are only a part of the numerous possible examples of the present invention, not all of them. For those skilled in the art, all other examples that can be deduced based on these examples without creative work are included in the protection scope of the present invention.

[0042] The primers were completed by Beijing Tsingke Biotechnology Co., Ltd. All non-heading Chinese cabbage varieties used in the following examples are from the Chinese Cabbage Systems Biology Laboratory of the College of Horticulture, Nanjing Agricultural University.

[0043] Example 1: Obtaining of the BraC09g052220 gene related to the green leaf color and chlorophyll and carotenoid contents in non-heading Chinese cabbage

[0044] (1) QTL mapping of green leaf color

[0045] In this example, re-sequencing was performed on the recombinant inbred line population constructed with Wutacai and Erqing as parents. QTL mapping was carried out on the green leaf color, namely the chlorophyll and carotenoid contents, obtained by constructing a high-density linkage map and collecting the replicates at three locations. According to the QTL mapping results, the green leaf color is mainly controlled by two major loci, which are mainly located on chromosome A07 and chromosome A09. The F2 population constructed with Wutacai and Erqing was further used to finely map the two major loci, and finally the QTL loci on chromosomes A07 and A09 were narrowed down to 170.25 kb and 191.41 kb. Through annotation using the non-heading Chinese cabbage database, it was found that the BraC09g052220 gene exists in the 191.41 kb interval of chromosome A09.

[0046] (2) Obtaining the BcSG1 gene

[0047] The full-length sequence of the BraC09g052220 gene was downloaded from the non-heading Chinese cabbage database, and the cloning primers for this gene were designed using SnapGeneViewer and sent to Tsingke Biotechnology Co., Ltd. for primer synthesis.

[0048] Using the synthesized primers, further PCR amplification was carried out. The 20 μl amplification system consisted of 10 μl of high-fidelity enzyme, 1 μl of forward primer, 1 μl of reverse primer, 1 μl of Wutacai / Erqing genomic DNA, and 7 μl of sterile water. The reaction program was 98 °C for 5 min, 98 °C for 10 s, 55 °C for 15 s, 72 °C for 1 min 20 s, 72 °C for 5 min, for 35 cycles.

[0049] The obtained PCR product was stained with 3.3 μl of 6x loading buffer (Takara) and separated by 1.2% agarose gel electrophoresis. A band was obtained at the position of 1000 bp, and the gene was recovered by cutting the gel and using an agarose gel recovery kit (Sangon). (3) The gene was constructed on a T-vector and sent to Tsingke Biotechnology Co., Ltd. for sequencing to obtain the BraC09g052220 gene sequences in Wutacai and Erqing.

[0050] Example 2 Obtaining molecular markers of the BraC09g052220 gene related to the green leaf color and chlorophyll and carotenoid contents of non-heading Chinese cabbage

[0051] In this example, the BraC09g052220 gene sequences obtained from Brassica rapa ssp. chinensis var. rosularis and Brassica rapa ssp. chinensis in Example 1 were mainly compared, and three InDel mutation sites were found in the exon region of the BcSG1 gene. Through the analysis of population variation information in Example 1, it was found that these three InDel sites were linked. Based on the positions of these three InDel markers, a molecular marker with a size of 200 bp was designed using the full-length gene of BraC09g052220 downloaded from the Brassica rapa database as a reference sequence, and primer sequences shown in SEQ ID No.1 and SEQ ID No.2 were designed using SnapGene Viewer.

[0052] The sequence information within primers SEQ ID No.1 and SEQ ID No.2 was intercepted from the BraC09g052220 gene sequences of Brassica rapa ssp. chinensis var. rosularis and Brassica rapa ssp. chinensis obtained in Example 1, and a SEQ ID No.3 sequence of 192 bp and a SEQ ID No.4 sequence of 179 bp were obtained from Brassica rapa ssp. chinensis var. rosularis respectively.

[0053] Application of the molecular marker of the BraC09g052220 gene related to the green leaf color, chlorophyll, and carotenoid content in Brassica rapa ssp. chinensis

[0054] In this example, the InDel molecular marker primer pairs designed in Example 2 were mainly used to identify 36 core germplasms of Brassica rapa ssp. chinensis.

[0055] (1) Determination of pigment content

[0056] The contents of chlorophyll a, chlorophyll b, total chlorophyll, carotenoid, lutein, and carotene in 36 core germplasms of Brassica rapa ssp. chinensis were determined. Approximately 0.1 g of mature leaves were taken, ground in liquid nitrogen, 1 ml of anhydrous ethanol and acetone (1:1) extraction solution was added, shaken horizontally in the dark for 24 h, centrifuged, and the supernatant was taken and diluted by one time, and the absorbance values at 470 nm, 474 nm, 485 nm, 642 nm, 649 nm, and 665 nm were measured respectively under an enzyme-linked immunosorbent assay (ELISA) reader, and repeated three times.

[0057] (2) Genotype identification

[0058] The DNA of 36 core germplasms of non-heading Chinese cabbage (Table 1) was extracted using the CTAB method. The 36 core germplasm materials include the core germplasm materials for the breeding of most non-heading Chinese cabbage varieties. Among them, the most common germplasm materials in the middle and lower reaches of the Yangtze River are Suzhouqing, Yangzhouqing, Aijiaohuang, and Shanghaiqing. In order to better identify the chlorophyll and carotenoid contents between the varieties bred from the same germplasm material, common varieties of Suzhouqing, Yangzhouqing, Aijiaohuang, and Shanghaiqing collected from the market were included in this example to identify the chlorophyll and carotenoid contents between the varieties bred from the same germplasm material. PCR amplification was performed according to the molecular marker primers developed in Example 2. The PCR amplification system was 5 μl Taq mix, 0.5 μl primer such as SEQ ID.No.1, 0.5 μl primer such as SEQ ID.No.2, 1 μl DNA, and 3 μl sterile water. The PCR amplification program was 95°C for 3 min, 95°C for 15 s, 53°C for 15 s, 72°C for 20 s, 72°C for 5 min, 30 cycles, extension at 72°C for 5 min, and preservation at 10°C.

[0059] In the table, the W type refers to the genotype with a 192 bp band detected, which is a variety with high pigment content; the E type refers to the genotype with a 179 bp band detected, which is a variety with low pigment content. The high-generation inbred lines used in the examples are highly pure lines without heterozygosity, but they appear in the F1 after the cross between Brassica narinosa and Erqing. The pigment content of its F1 is intermediate.

[0060] Table 1

[0061]

[0062]

[0063] The 5 μl PCR amplification product was electrophoresed on a 2% agarose gel at a constant voltage of 120 V for 40 min, and the band genotype was read by ultraviolet visualization ( Figure 1 ).

[0064] (3) Result analysis

[0065] Among the identification results of 36 non-heading Chinese cabbage germplasm samples, it was found that the chlorophyll and carotenoid contents of 24 core germplasms could be identified by this molecular marker. The amplified band size was consistent with the amplification result of Brassica narinosa, that is, 192 bp, which is a variety with high chlorophyll and carotenoid contents. The amplified band size was consistent with the amplification result of Erqing, that is, 179 bp, which is a variety with low pigment content. The correlation coefficient between the molecular marker and the pigment content was as high as 0.91 - 0.93, and the molecular marker developed by BcSG1 was significantly correlated with the pigment content (P < 0.05).

[0066] Among them, in the family with 12 W genotypes, the average chlorophyll a content is 49.21±5.80 mg / 100 g, the chlorophyll b content is 22.48±8.48 mg / 100 g, the total chlorophyll content is 87.71±10.91 mg / 100 g, the lutein content is 7.37±3.25 mg / 100 g, the carotene content is 10.52±5.06 mg / 100 g, and the carotenoid content is 18.23±2.70 mg / 100 g;

[0067] In the family with 24 identical E genotypes, the average chlorophyll a content is 24.01±4.35 mg / 100 g, the chlorophyll b content is 7.43±0.61 mg / 100 g, the total chlorophyll content is 34.73±6.58 mg / 100 g, the lutein content is 4.08±1.12 mg / 100 g, the carotene content is 4.53±0.89 mg / 100 g, and the carotenoid content is 8.56±1.32 mg / 100 g;

[0068] Both the significant difference analysis and the correlation analysis can show that the molecular marker of the BcSG1 gene is closely related to the contents of chlorophyll and carotenoid in the leaves of non-heading Chinese cabbage. The correlation coefficients between it and the total chlorophyll content, chlorophyll a content, chlorophyll b content, and carotenoid content are 0.90, 0.93, 0.83, and 0.93 respectively. However, the correlation between this marker and lutein and carotene is relatively low, and the correlation coefficients are 0.61 and 0.70 respectively. Therefore, this molecular marker can only identify the total chlorophyll content, chlorophyll a content, chlorophyll b content, and carotenoid content in the leaves of non-heading Chinese cabbage, and cannot identify the levels of lutein and carotene contents ( Figure 2 ).

[0069] The above description is only a preferred implementation manner of the present invention. It should be emphasized that any person with common knowledge in the technical field, as long as they do not violate the core principle of the present invention, has the ability to make various improvements and adjustments to it. These improvements and adjustments based on the present invention should also be recognized as belonging to the protection scope of the present invention. The essence of the present invention is not limited to the above specific implementation manners, but lies in the core concept it reveals. When technicians understand and apply the present invention, they can make necessary modifications and optimizations according to the actual situation to adapt to different application scenarios or solve specific problems. This flexibility and adaptability are also important features of the present invention.

Claims

1. Application of InDel molecular marker closely linked to pigment content trait related to green leaves of non-heading Chinese cabbage in assistant breeding of pigment content trait related to green leaves of non-heading Chinese cabbage, characterized in that, The nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO.3 or SEQ ID NO.4; the application is as follows: (1) If the nucleotide sequence of the InDel molecular marker is the fragment shown as SEQ ID NO.3, it is determined that the tested non-heading Chinese cabbage is a variety with high pigment content; (2) If the nucleotide sequence of the InDel molecular marker is the fragment shown as SEQ ID NO.4, it is determined that the tested non-heading Chinese cabbage is a variety with low pigment content.

2. The application according to claim 1, wherein The application further includes (3) if the InDel molecular markers shown as SEQ ID NO.3 and SEQ ID NO.4 are both included, it is determined that the tested non-heading Chinese cabbage is a variety with intermediate pigment content.

3. Application of the primer pair for amplifying the InDel molecular marker described in claim 1 in the assisted breeding of the green leaf related pigment content trait of non-heading Chinese cabbage.

4. The application according to claim 3, wherein The primer pair is shown as SEQ ID NO.1 and SEQ ID NO.2: SEQ ID No.1: GCTATATTTTTTAAAGCCCAC; SEQ ID No.2: AAGGATGAAGAGGTGTGAGTG.

5. Application of the kit for detecting the InDel molecular marker described in claim 1 in the assisted breeding of the green leaf related pigment content trait of non-heading Chinese cabbage; preferably, the kit includes the primer pair shown as SEQ ID No.1 and SEQ ID No.

2.

6. A method for assisting breeding of the trait of the content of green leaf-related pigments in non-heading Chinese cabbage, characterized in that, The method includes the following steps: (1) Extract the total genomic DNA of the tested non-heading Chinese cabbage; (2) Perform PCR amplification on the total genomic DNA of the tested non-heading Chinese cabbage using the InDel molecular marker primers shown as SEQ ID NO.1 and SEQ ID NO.2; (3) Perform electrophoresis and / or sequencing on the PCR amplification product, and judge the green leaf related pigment content trait of the non-heading Chinese cabbage according to the length difference of the amplified fragment and / or the sequencing result of the PCR product.

7. The method according to claim 6, wherein If the amplification product only contains a 192bp band and / or only contains the fragment shown as SEQ ID NO.3, the tested non-heading Chinese cabbage is a variety with high pigment content; if it only contains a 179bp band and / or only contains the fragment shown as SEQ ID NO.4, the tested non-heading Chinese cabbage is a variety with low pigment content; if it contains both 192bp and 179bp bands and / or includes the InDel molecular markers shown as SEQ ID NO.3 and SEQ ID NO.3 at the same time, the tested non-heading Chinese cabbage is a heterozygous individual and is a variety with intermediate pigment content.

8. The method according to claim 6, wherein The reaction system of the PCR amplification in step (2) is: the total system of PCR amplification is 10 μl, including 0.5 μl of each of the forward and reverse primers, 5 μl of Taq enzyme, 1 μl (50 ng) of DNA, and 3 μl of ddH2O; the reaction program of the PCR amplification in step (2) is pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 53 °C for 15 S, extension at 72 °C for 20 s, 30 cycles; extension at 72 °C for 5 min, and preservation at 10 °C.

9. The method according to claim 6, characterized in that, The specific operation of the electrophoresis described in step (3) is as follows: Load 5 μl onto a 2% agarose gel, perform electrophoresis at a constant voltage of 120 V for 40 min, turn off the power supply, remove the gel, and visualize under ultraviolet light.

10. The method or application according to any one of claims 1 to 9, characterized in that, The green leaf-related pigments are total chlorophyll, chlorophyll a, chlorophyll b, and carotenoids; The non-heading Chinese cabbage is selected from at least one of the following 24 core germplasms of non-heading Chinese cabbage, or at least one of the non-heading Chinese cabbage varieties cultivated using the 24 core germplasms of non-heading Chinese cabbage as parents

Images