Fingerprint spectrum of oyster mushroom P2101 strain, construction method and application
By developing the fingerprint map of the Oyster mushroom P2101 strain based on InDel labeling, and PCR amplification of 10 InDel labeling primers, the rapid and accurate identification of Oyster mushroom species was solved, and the rapid identification of Oyster mushroom P2101 strain was achieved, reducing the risks in breeding and production.
Patent Information
- Application Number
- CN202510389773.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-06-27
AI Technical Summary
It is difficult to quickly and accurately identify oyster mushroom species in the existing technology, resulting in damage to breeders' intellectual property rights and risky producers, which affects the healthy development of the oyster mushroom industry.
A fingerprint of InDel marker based on the insertion/deletion fragment of the oyster mushroom genome was developed, and the oyster mushroom strain was PCR amplified by 10 InDel marker primers, and the oyster mushroom P2101 strain was identified by the combination of allelic fragments.
The rapid and accurate identification of the Oyster mushroom P2101 strain was achieved, and the detection time was shortened to 3-4 days, which significantly improved the accuracy and repetition of the identification results and reduced the risks in breeding and production.
Smart Images

Figure CN120210408A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of detection of Pleurotus ostreatus strains, and particularly relates to an InDel marker fingerprint map of Pleurotus ostreatus strain P2101, a construction method thereof, and an application thereof. Background Art
[0002] Pleurotus ostreatus has a stable market demand globally due to its rich nutritional value, good taste, and easy cultivation characteristics. With the growing demand for healthy foods among consumers, the Pleurotus ostreatus market continues to expand, especially in the fields of organic vegetables and green foods, where the sales performance of Pleurotus ostreatus is strong. Currently, Pleurotus ostreatus ranks second only to Pleurotus ostreatus in domestic cultivation. In recent years, the government's support for the edible mushroom industry, including providing financial subsidies, tax incentives, technical support, etc., has created a good external environment for the development of the Pleurotus ostreatus industry. The cultivation scale of Pleurotus ostreatus in China has been further expanded. However, with the rapid development of the Pleurotus ostreatus industry in China, the problem of "same species with different names, different species with the same name" in the seeds used for Pleurotus ostreatus production has become increasingly prominent, which not only damages the intellectual property rights of Pleurotus ostreatus breeders but also poses great risks to producers, creating potential hazards for the further development of the Pleurotus ostreatus industry. To protect the rights and interests of breeders, reduce the risks of producers, and promote the healthy, stable, and sustainable development of the Pleurotus ostreatus industry in China, it is urgent to establish a simple, rapid, and reliable technique for specific identification of Pleurotus ostreatus strains.
[0003] With the rapid development of bioinformatics and the continuous maturity of DNA sequencing technology, the throughput of sequencing is increasing while the cost is decreasing. DNA molecular marker technology can detect the genetic specificity of Pleurotus ostreatus strains at the gene level, and the completion of the whole genome sequencing of Pleurotus ostreatus provides convenience for the development of InDel markers. InDel molecular markers are an application based on high-throughput sequencing technology, which reduces the cost of InDel marker development and is suitable for the development of molecular markers for Pleurotus ostreatus whole genome sequencing. Moreover, InDel markers have the advantages of rich quantity, high accuracy, good stability, fast and simple operation, etc., and can be used not only for molecular marker-assisted breeding but also for the identification of Pleurotus ostreatus strains. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a fingerprint map of Pleurotus ostreatus strain P2101, a construction method thereof, and an application thereof, which have a short detection time, high accuracy, and good repeatability.
[0005] The technical solution adopted by the present invention to solve its technical problems is as follows: A fingerprint map of Pleurotus ostreatus strain P2101, which has been deposited with the China Center for Type Culture Collection on May 27, 2024, and its biological deposit number is CCTCC NO: M2024997; it consists of 10 pairs of InDel markers, which are InDel marker primers developed based on the insertion / deletion fragments of the Pleurotus ostreatus genome. The sequences (5′3′) of the 10 pairs of InDel marker primers are as follows:
[0006] Forward primer of Lefp_id001: AATTTACCGTCACGTTCTCAAC
[0007] Reverse primer: TCGTGGTGTGCTATGCAGAT
[0008] Forward primer of Lefp_id002: CACCGAAGAACTGCACGAC
[0009] Reverse primer: CATACCAAACGCATCGATCA
[0010] Forward primer of Lefp_id003: ACCGGTGAGTGCAAATGAA
[0011] Reverse primer: GGTCTAGGAGCTGGCCTTG
[0012] Forward primer of Lefp_id004: TAGGGATAAACTCCCCAGAG
[0013] Reverse primer: AGAACCGCTATCTGTCCTG
[0014] Forward primer of Lefp_id005: GTTGCGGCAAGAAATACA
[0015] Reverse primer: GCGAAGTATAATTGCATCAC
[0016] Forward primer of Lefp_id006: GCGAAACTGCGCTTATT
[0017] Reverse primer: GCTATGCGCCCAACAA
[0018] Forward primer of Lefp_id007: GCACGATGTCCGAGT
[0019] Reverse primer: GCCATTAGTCTGAGATGA
[0020] Forward primer of Lefp_id008: GCTTGTTGGGTCCAG
[0021] Reverse primer: AAAGCCCCCTGCAAA
[0022] Forward primer of Lefp_id009: GTTCTGGCTTGGGTTCTG
[0023] Reverse primer: CATCGATACCACCAGCTC
[0024] Forward primer of Lefp_id0010: GATCCAAGATGATGTGCAA
[0025] Reverse primer: AAGAGCTTCTGGGAAGGAG.
[0026] An InDel marker fingerprint of Pleurotus ostreatus strain P2101 of the present invention. This fingerprint consists of 10 pairs of InDel markers, which are InDel marker primers developed based on the insertion / deletion fragments of the Pleurotus ostreatus genome. The amplification band pattern is good, the repeatability is high, and the detailed information of the markers is shown in Table 1.
[0027] Table 1
[0028]
[0029] By amplifying the band patterns of InDel marker primers for 48 collected Pleurotus ostreatus varieties, the present invention determined the number of allelic fragments amplified by 10 pairs of InDel marker primers in 48 Pleurotus ostreatus varieties and numbered them (Table 2). The P2101 strain can be effectively identified through the number combinations of different InDel allelic sites ( Figure 2-8 ). By using the DNA molecular weight control D2000bp DNA ladder, the relative molecular weights of the allelic sites amplified by each InDel marker primer can be determined. The strain with the specific InDel allelic fragment combination of the P2101 strain is the Pleurotus ostreatus P2101 strain, and the number combination of this strain is: (1,3), (1,2), 2, 2, 3, 1, 2, (1,2,3), (1,2,3), 2.
[0030] Summary table of allelic fragment information amplified by InDel primers
[0031]
[0032] The present invention also provides a method for constructing the InDel marker fingerprint of the above-mentioned Pleurotus ostreatus P2101 strain, and this method includes the following steps:
[0033] 1) Mycelium culture: Transfer the Pleurotus ostreatus mycelium to a PDA plate and culture it in the dark at 25 °C. Collect the mycelium after 10 days;
[0034] 2) Extraction of genomic DNA: The genomic DNA of the above mycelium was extracted using a kit method (ComWin Biotech, New Plant Genomic DNA Extraction Kit), and the concentration and purity of the total genomic DNA were detected by ultraviolet spectrophotometry. The concentration of the sample DNA was adjusted to 20 - 30 ng / μL. The process of extracting the genomic DNA of mycelium by the kit method includes:
[0035] S1. Take about 100 mg of fresh plant tissue or about 20 mg of dry weight tissue, and add liquid nitrogen to grind thoroughly.
[0036] S2. Collect the ground powder into a centrifuge tube (prepared by yourself), add 400 μL of Buffer LP1 and 6 μL of RNase A (10 mg / ml), vortex for 1 minute, and let it stand at room temperature for 10 minutes to fully lyse.
[0037] Note: a) Use vortex oscillation or pipette to blow and beat to fully lyse the tissue. Incomplete lysis of the tissue will affect the final DNA yield.
[0038] b) Do not mix Buffer LP1 and RNase A before use.
[0039] S3. Add 130 μL of Buffer LP2, mix well, and vortex for 1 minute.
[0040] S4. Centrifuge at 12,000 rpm (~13,400 xg) for 5 minutes, and transfer the supernatant to a new centrifuge tube (prepared by yourself).
[0041] S5. Add 1.5 times the volume of Buffer LP3 (check whether absolute ethanol has been added before use), and mix well (for example, add 750 μL of Buffer LP3 to 500 μL of filtrate).
[0042] Note: After adding Buffer LP3, mix well immediately. Precipitation may occur but it does not affect subsequent experiments.
[0043] S6. Add all the solution and precipitate obtained in the previous step to the adsorption column (Spin Columns DM) placed in the collection tube. If the solution cannot be added all at once, it can be transferred in multiple times. Centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.
[0044] S7. Add 500 μL of Buffer GW2 to the adsorption column (check whether absolute ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.
[0045] Note: If the adsorption film shows green, add 500 μL of absolute ethanol to the adsorption column, centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube. Repeat step 7.
[0046] S8. Centrifuge at 12,000 rpm for 2 minutes, pour out the waste liquid in the collection tube. Place the adsorption column at room temperature for several minutes to thoroughly dry it.
[0047] Note: The purpose of this step is to remove the residual ethanol in the adsorption column. The residual ethanol will affect subsequent enzymatic reactions (such as enzymatic digestion, PCR, etc.).
[0048] S9. Place the adsorption column into a new centrifuge tube (prepared by yourself), suspend and add 80 μL of Buffer GE or sterilized water to the middle part of the adsorption film, let it stand at room temperature for 2 - 5 minutes, centrifuge at 12,000 rpm for 1 minute, and collect the DNA solution. Store the DNA at -20 °C.
[0049] 3) Detection of InDel molecular markers: Perform PCR amplification of the developed InDel markers on the DNA extracted above;
[0050] The PCR amplification system is as follows: The total volume is 20 μL, including: 2×SanTaq PCR Mix premix, containing blue dye 10 μL, 1 μL each of the forward and reverse primers of 10 μmol / L InDel markers, 2 μL of the extracted template DNA with a concentration of 20 - 30 ng / μL, and 6 μL of ddH2O;
[0051] PCR reaction conditions: Preheat at 94 °C for 5 min; denature at 94 °C for 30 s, anneal at 55 °C for 30 s, extend at 72 °C for 40 s, for 35 cycles; extend at 72 °C for 10 min, and store at 4 °C;
[0052] 4) Electrophoresis detection: Load 7 μL of the product obtained from the above PCR amplification onto an agarose gel added with nucleic acid dye for electrophoresis. The volume percentage concentration of the agarose gel is 3%, the electrophoresis buffer is 1×TAE, the voltage is 110 v, the current is 200 mA, electrophoresis for 1 h, and after completion, observe and take pictures with a gel imager.
[0053] An application of the fingerprint map of the above Pleurotus ostreatus P2101 strain. Using 10 pairs of InDel marker primers developed from the insertion / deletion fragments of the Pleurotus ostreatus genome, perform InDel marker amplification on Pleurotus ostreatus strains, and compare the obtained band patterns with the band pattern of the P2101 strain. Those with the same band pattern are the Pleurotus ostreatus P2101 strain; among them, the band pattern number combination of the Pleurotus ostreatus P2101 strain is: (1,3), (1,2), 2, 2, 3, 1, 2, (1,2,3), (1,2,3), 2.
[0054] Ten pairs of InDel marker primers were selected to perform PCR amplification on Pleurotus ostreatus strains. By comparing with the DNA molecular weight control D2000bp DNA ladder, the number and relative molecular weight of the allelic fragments amplified by each InDel marker primer can be determined. If the strain with the numbered combination of (1,3),(1,2),2,2,3,1,2,(1,2,3),(1,2,3),2 is found, then this strain can be determined as Pleurotus ostreatus strain P2101.
[0055] Compared with the prior art, the beneficial effects of the InDel marker fingerprint map of a Pleurotus ostreatus strain P2101, its construction method and application of the present invention are as follows: The InDel marker fingerprint map of the Pleurotus ostreatus strain P2101 of the present invention can be used for the identification of P2101 strains. Compared with conventional morphological detection, antagonism test, and fruiting test, it has the advantages of short detection time, high accuracy, and good repeatability. The detection only takes 3 - 4 days, while the conventional antagonism test requires at least two weeks, and the fruiting test requires at least three months; this method has specificity for P2101 strains among the 48 Pleurotus ostreatus strains collected in China and has good application prospects. Brief Description of the Drawings
[0056] Figure 1 It is the InDel marker fingerprint map of Pleurotus ostreatus strain P2101, where the numbers 1 - 10 represent the 10 pairs of InDel marker primers used, M is D2000bp DNA ladder, and N represents the blank control.
[0057] Figure 2 It is the amplification map of primer Lefp_id001 in the selected 48 Pleurotus ostreatus materials.
[0058] Figure 3 It is the amplification map of primer Lefp_id002 in the selected 48 Pleurotus ostreatus materials.
[0059] Figure 4 It is the amplification map of primer Lefp_id003 in the selected 48 Pleurotus ostreatus materials.
[0060] Figure 5 It is the amplification map of primer Lefp_id004 in the selected 48 Pleurotus ostreatus materials.
[0061] Figure 6 It is the amplification map of primer Lefp_id002 in the selected 48 Pleurotus ostreatus materials.
[0062] Figure 7 It is the amplification map of primer Lefp_id006 in the selected 48 Pleurotus ostreatus materials.
[0063] Figure 8Amplification map of primer Lefp_id007 in 48 selected Pleurotus ostreatus materials.
[0064] Figure 9 Amplification map of primer Lefp_id008 in 48 selected Pleurotus ostreatus materials.
[0065] Figure 10 Amplification map of primer Lefp_id009 in 48 selected Pleurotus ostreatus materials.
[0066] Figure 11 Amplification map of primer Lefp_id0010 in 48 selected Pleurotus ostreatus materials. Detailed implementation manners
[0067] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.
[0068] Marker and 2×SanTaq PCR Mix are both purchased from: Sangon Biotech (Shanghai) Co., Ltd.
[0069] New plant genomic DNA extraction kit: purchased from ConWin Biotech Co., Ltd.
[0070] The remaining materials and reagents are all ordinary commercially available products.
[0071] Sources of 48 strains:
[0072] Xue Mei F2, Variant 40, R80, J-C-P2101, G20, 8129, Pleurotus sapidus, Zhongshu 10, Zaoyou 8, Zaoguan 1, Yupingwang, Youping 88, Xinke 101, Xiaoheiping, Teping 8, Suyan 1, Shuangkang (Heiping), Nongping 21, Lushanping 1-2, Kangbing 265, Huimei 2, Heimudan, Dutch Pleurotus ostreatus, Gaowen 908, Gaochan 8105, Fuzhou Xia 200, Defeng 5, YH-3, TB-10, NF-2, HK35, a total of 31 strains are all from Shandong Academy of Agricultural Sciences; Xinong 1, Xiahui 1, Xiafu 2, Wenquan 1, 16-3
[0073] Gaoping 3, Gaoping 1, a total of 7 strains are all from Jiangdu Tianda Edible Fungi Research Institute; P2101, Liuyuehui, Zaoqiu Gaofeng, Zaoqiu 903, Xinke 205, Xinke 170, Ping 1300, Fuxia 200, Chunqiu Kangwang, a total of 9 strains are all from Gaoyou Scientific Edible Fungi Research Institute, Jiangsu Province; Kejia 1, a total of 1 strain is from Shijiazhuang Beikang Edible Fungi Technology Co., Ltd.
[0074] Among them, the sequences (5′-3′) of 10 pairs of InDel marker primers are as follows:
[0075] Forward primer of Lefp_id001: AATTTACCGTCACGTTCTCAAC
[0076] Reverse primer: TCGTGGTGTGCTATGCAGAT
[0077] Forward primer of Lefp_id002: CACCGAAGAACTGCACGAC
[0078] Reverse primer: CATACCAAACGCATCGATCA
[0079] Forward primer of Lefp_id003: ACCGGTGAGTGCAAATGAA
[0080] Reverse primer: GGTCTAGGAGCTGGCCTTG
[0081] Forward primer of Lefp_id004: TAGGGATAAACTCCCCAGAG
[0082] Reverse primer: AGAACCGCTATCTGTCCTG
[0083] Forward primer of Lefp_id005: GTTGCGGCAAGAAATACA
[0084] Reverse primer: GCGAAGTATAATTGCATCAC
[0085] Forward primer of Lefp_id006: GCGAAACTGCGCTTATT
[0086] Reverse primer: GCTATGCGCCCAACAA
[0087] Forward primer of Lefp_id007: GCACGATGTCCGAGT
[0088] Reverse primer: GCCATTAGTCTGAGATGA
[0089] Forward primer of Lefp_id008: GCTTGTTGGGTCCAG
[0090] Reverse primer: AAAGCCCCCTGCAAA
[0091] Forward primer of Lefp_id009: GTTCTGGCTTGGGTTCTG
[0092] Reverse primer: CATCGATACCACCAGCTC
[0093] Forward primer of Lefp_id0010: GATCCAAGATGATGTGCAA
[0094] Reverse primer: AAGAGCTTCTGGGAAGGAG.
[0095] The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0096] Example 1
[0097] 1) Mycelium culture: Transfer Pleurotus ostreatus mycelium onto a PDA plate and culture it in the dark at 25 °C. Collect the mycelium after 10 days.
[0098] 2) Genomic DNA extraction: Extract the genomic DNA of the above mycelium using the kit method (ComWin Biotech, New Plant Genomic DNA Extraction Kit). Detect the concentration and purity of the total genomic DNA by ultraviolet spectrophotometry, and adjust the concentration of the sample DNA to 20 - 30 ng / μL. The process of extracting the genomic DNA of mycelium by the kit method includes:
[0099] S1. Take about 100 mg of fresh plant tissue or about 20 mg of dry weight tissue, and add liquid nitrogen to grind thoroughly.
[0100] S2. Collect the ground powder into a centrifuge tube (self - prepared), add 400 μL of Buffer LP1 and 6 μL of RNase A (10 mg / ml), vortex for 1 minute, and let it stand at room temperature for 10 minutes to fully lyse.
[0101] Note: a) Use vortex or pipette to blow and mix to fully lyse the tissue. Incomplete lysis of the tissue will affect the final DNA yield.
[0102] b) Do not mix Buffer LP1 and RNase A before use.
[0103] S3. Add 130 μL of Buffer LP2, mix well, and vortex for 1 minute.
[0104] S4. Centrifuge at 12,000 rpm (~13,400 xg) for 5 minutes, and transfer the supernatant to a new centrifuge tube (self - prepared).
[0105] S5. Add 1.5 times the volume of Buffer LP3 (check whether absolute ethanol has been added before use), and mix well (for example, add 750 μL of Buffer LP3 to 500 μL of filtrate).
[0106] Note: Mix well immediately after adding Buffer LP3. Precipitation may occur but will not affect subsequent experiments.
[0107] S6. Add all the solution and precipitate obtained in the previous step to the adsorption column (Spin Columns DM) placed in the collection tube. If the solution cannot be added all at once, it can be transferred in multiple portions. Centrifuge at 12,000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.
[0108] S7. Add 500 μL of Buffer GW2 to the adsorption column (check whether absolute ethanol has been added before use). Centrifuge at 12,000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.
[0109] Note: If the adsorption membrane shows green, add 500 μL of absolute ethanol to the adsorption column. Centrifuge at 12,000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube. Repeat step 7.
[0110] S8. Centrifuge at 12,000 rpm for 2 minutes, discard the waste liquid in the collection tube. Place the adsorption column at room temperature for several minutes to dry thoroughly.
[0111] Note: The purpose of this step is to remove the residual ethanol in the adsorption column. The residual ethanol will affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).
[0112] S9. Place the adsorption column into a new centrifuge tube (prepared by yourself). Drop 80 μL of Buffer GE or sterile water onto the middle part of the adsorption membrane in a suspended manner. Let it stand at room temperature for 2 - 5 minutes, centrifuge at 12,000 rpm for 1 minute, and collect the DNA solution. Store the DNA at -20°C.
[0113] 3) Detection of InDel molecular markers: Perform PCR amplification of the developed InDel markers on the DNA extracted above;
[0114] The PCR amplification system is as follows: The total volume is 20 μL, including: 2×SanTaq PCR Mix premix, containing blue dye 10 μL, 1 μL each of the forward and reverse primers of the 10 μmol / L InDel marker, 2 μL of the extracted template DNA with a concentration of 20 - 30 ng / μL, and 6 μL of ddH2O;
[0115] PCR reaction conditions: Preheat at 94°C for 5 min; denature at 94°C for 30 s, anneal at 55°C for 30 s, extend at 72°C for 40 s, for 35 cycles; extend at 72°C for 10 min, and store at 4°C;
[0116] 4) Electrophoresis detection: Load 7 μL of the product obtained from the above PCR amplification onto an agarose gel added with nucleic acid dye for electrophoresis. The volume percentage concentration of the agarose gel is 3%, the electrophoresis buffer is 1×TAE, the voltage is 110 v, the current is 200 mA, and electrophoresis is carried out for 1 h. After completion, observe and take pictures with a gel imaging system.
[0117] Select 10 pairs of InDel marker primers to perform PCR amplification on Pleurotus ostreatus strains. By comparing with the DNA molecular weight control D2000bp DNA ladder, the number and relative molecular weight of the allelic fragments amplified by each InDel marker primer can be determined, and the strain with the following number combinations can be found:
[0118] (1,3), (1,2), 2, 2, 3, 1, 2, (1,2,3), (1,2,3), 2. Then this strain can be determined as Pleurotus ostreatus strain P2101.
[0119] As described above, it is only the preferred embodiment of the present invention, and it is not a limitation to the present invention in other forms. Any person skilled in the art may use the disclosed technical content to make changes or modifications into equivalent embodiments with equivalent changes. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the technical solution content of the present invention still fall within the protection scope of the technical solution of the present invention.
Claims
1. A fingerprint of Pleurotus ostreatus P2101 strain, characterized in that: It consists of 10 pairs of InDel markers, which are InDel marker primers developed based on the insertion / deletion fragments of the Pleurotus ostreatus genome. The sequences of the 10 pairs of InDel marker primers (5′3′) are as follows: Lefp_ID001 forward primer: AATTTACCGTCACGTTCTCAAC Reverse primer: TCGTGGTGTGCTATGCAGAT Lefp_id002 forward primer: CACCGAAGAACTGCACGAC Reverse primer: CATACCAAACGCATCGATCA Lefp_id003 forward primer: ACCGGTGAGTGCAAATGAA Reverse primer: GGTCTAGGAGCTGGCCTTG Lefp_id004 forward primer: TAGGGATAAACTCCCCAGAG Reverse primer: AGAACCGCTATCTGTCCTG Lefp_id005 forward primer: GTTGCGGCAAGAAATACA Reverse primer: GCGAAGTATAATTGCATCAC Lefp_ID006 forward primer: GCGAAACTGCGCTTATT Reverse primer: GCTATGCGCCCAACAA Lefp_id007 forward primer: GCACGATGTCCGAGT Reverse primer: GCCATTAGTCTGAGATGA Lefp_id008 forward primer: GCTTGTTGGGTCCAG Reverse primer: AAAGCCCCCTGCAAA Lefp_ID009 forward primer: GTTCTGGCTTGGGTTCTG Reverse primer: CATCGATACCACCAGCTC Lefp_id0010 forward primer: GATCCAAGATGATGTGCAA Reverse primer: AAGAGCTTCTGGGAAGGAG.
2. A method for constructing a fingerprint of the Pleurotus ostreatus P2101 strain according to claim 1, characterized in that: The steps include: 1) Mycelium culture: The mycelium of Pleurotus ostreatus was transferred to a PDA plate and cultured at 25°C in the dark. The mycelium was collected after 10 days. 2) Extraction of genomic DNA: The genomic DNA of mycelium was extracted using a kit method, and the total genomic DNA concentration and purity were detected by ultraviolet spectrophotometry. The concentration of the sample DNA was adjusted to 20 ng / uL to 30 ng / uL; 3) Detection of InDel molecular markers: PCR amplification of the developed InDel markers was performed on the above extracted DNA; 4) Electrophoresis detection: Spot 7 μL of the product obtained by the above PCR amplification on an agarose gel with nucleic acid dye added for electrophoresis. The volume percentage concentration of the agarose gel is 3%, the electrophoresis buffer is 1×TAE, the voltage is 110V, the current is 200mA, and the electrophoresis is performed for 1h. After completion, it is observed and photographed with a gel imager.
3. The method for constructing a fingerprint of Pleurotus ostreatus P2101 strain according to claim 2, characterized in that: Step 2) The process of extracting genomic DNA from mycelium using the kit method comprises: S1. Take 95mg-105mg of fresh plant tissue or 18mg-22mg of dry weight tissue, add liquid nitrogen and grind thoroughly to obtain powder; S2. Collect the powder into a centrifuge tube, add 400 μL Buffer LP1 and 6 μL RNase A (10 mg / ml), vortex for 1 minute, and leave at room temperature for 10 minutes to allow for complete lysis; S3. Add 130 μL Buffer LP2, mix well, and vortex for 1 minute; S4. Centrifuge at 12000 rpm for 5 minutes and transfer the supernatant to another centrifuge tube; S5. Add 1.5 times the volume of Buffer LP3 and mix thoroughly; S6. Add all the obtained solution and precipitate to the adsorption column loaded into the collection tube, centrifuge at 12000rpm for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube; S7. Add 500 μL of Buffer GW2 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube; when the adsorption film turns green, add 500 μL of anhydrous ethanol to the adsorption column, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube; S8. Centrifuge at 12000rpm for 2 minutes and discard the waste liquid in the collection tube; place the adsorption column at room temperature to dry; S9. Place the adsorption column in a centrifuge tube, add 80 μL of Buffer GE or sterile water to the middle part of the adsorption membrane, leave it at room temperature for 2 to 5 minutes, centrifuge at 12,000 rpm for 1 minute, and collect the DNA solution; store the DNA below -20°C.
4. The method for constructing a fingerprint of Pleurotus ostreatus P2101 strain according to claim 3, characterized in that: As described in S6, the obtained solution and precipitate are all added to the adsorption column loaded into the collection tube, and the addition is performed multiple times.
5. The method for constructing a fingerprint of Pleurotus ostreatus P2101 strain according to claim 2, characterized in that: The PCR amplification system of the PCR amplification in step 3) is: a total volume of 20 μL, including: 2×SanTaq PCR Mix premix, containing 10uL of blue dye, 10μmol / L InDel labeled forward primer and reverse primer with a total volume of 1μL each, 2μL of template DNA extracted with a concentration of 20ng / μL to 30ng / μL, and 6μL of ddH2O; PCR reaction conditions: preheating at 94°C for 5min; denaturation at 94°C for 30s, annealing at 55°C for 30s, extension at 72°C for 40s, 35 cycles; extension at 72°C for 10min, and storage at 4°C.
6. An application of the fingerprint of the Pleurotus ostreatus P2101 strain according to claim 1, characterized in that: Using 10 pairs of InDel marker primers developed from the insertion / deletion fragments of the Pleurotus ostreatus genome, InDel marker amplification was performed on the Pleurotus ostreatus strain, and the obtained banding pattern was compared with the banding pattern of the P2101 strain. The one with the same banding pattern was the Pleurotus ostreatus P2101 strain; the banding pattern number combinations of the Pleurotus ostreatus P2101 strain are: (1,3), (1,2), 2,2,3, 1,2, (1,2,3), (1,2,3), 2.
Citation Information
Cited By
Agronomic character and InDel marker fingerprint spectrum of dictyophora rubrovolvata YZS021 strain and construction method
CN122081082A