CKAP4 inhibitor, breast cancer medicine and application

By downregulating CKAP4 expression by various CKAP4 inhibitors, the problem of CKAP4 promoting proliferation, migration and invasion in breast cancer is solved, and the inhibition and treatment effects of breast cancer cells are achieved, with significant prevention and treatment potential.

CN120227440APending Publication Date: 2025-07-01FIRST AFFILIATED HOSPITAL OF KUNMING MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510420268.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-07-01

AI Technical Summary

Technical Problem

In the prior art, CKAP4 is highly expressed in a variety of solid tumor tissues, promoting the proliferation, migration and invasion of tumor cells, and is related to poor prognosis in patients and lacks effective inhibitory means.

Method used

A variety of CKAP4 inhibitors are provided, including isazomib, KY02111, (E/Z)-CP-724714, chlorogenic acid, MDL-28170, reduced L-glutathione, specific RNA and protein, etc., by directly or indirectly inhibiting CKAP4 expression, downregulate its amount, thereby inhibiting the proliferation, migration and invasion of breast cancer cells, and promoting apoptosis and inhibiting tumor angiogenesis.

Benefits of technology

It significantly inhibits the proliferation, migration and invasion of breast cancer cells, promotes cell apoptosis, and slows tumor growth. It has obvious breast cancer prevention and treatment effects, and has no obvious toxic side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120227440A_ABST
    Figure CN120227440A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of CKAP4, in particular to a CKAP4 inhibitor, a breast cancer drug and application. Tests show that the expression quantity of CKAP4 in breast cancer tissues is obviously higher than that in para-carcinoma tissues. Embodiments provide a variety of CKAP4 inhibitors. According to the embodiment of the invention, various CKAP4 inhibitors act on in-vitro breast cancer cells and in-vivo breast cancer tissues and play roles in inhibiting proliferation, migration and invasion of the in-vitro breast cancer cells and the in-vivo breast cancer tissues. Various CKAP4 inhibitors provided by the embodiment have the effects of promoting apoptosis of breast cancer cells and tissues and inhibiting tumor angiogenesis of the breast cancer cells and tissues, have obvious breast cancer prevention and treatment effects and have the application prospect of being developed as breast cancer drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the technical field of CKAP4, and particularly relates to a CKAP4 inhibitor, a breast cancer drug, and their applications. Background Art

[0002] Cytoskeleton Associated Protein 4 (CKAP4) is a palmitoylated type II transmembrane protein, containing a large number of negatively charged regions, highly folded into a random coil structure, with multiple ion binding sites, and its amino acid sequence contains a low complexity domain and an intrinsically disordered region. The predicted molecular weight of CKAP4 is 57.7 kDa, and the accurate molecular weight is 58 kDa as determined by SDS-PAGE under reducing conditions. CKAP4 is mainly localized in the endoplasmic reticulum and can also be present in the cell membrane and cytoplasm.

[0003] CKAP4 controls the transport of α5β1 integrin by interacting with β1 integrin, regulates the adhesion of tumor cells to fibronectin, and enhances the metastatic potential of tumor cells; it can also act as a receptor for Dickkopf1 (DKK1) to activate the phosphoinositide 3-kinase (PI3K) / protein kinase B (AKT) pathway in cancer, promoting cell migration and proliferation. CKAP4 also acts as a sensitive intracellular mechanosensor, which can specifically respond to the solid-phase stress in the tumor microenvironment through liquid-liquid phase separation, regulate the curvature and branching of microtubules, enhance the motility of tumor cells, and promote their metastasis in vivo. In hepatocellular carcinoma, CKAP4 can regulate endoplasmic reticulum autophagy and indirectly promote the proliferation of hepatocellular carcinoma cells by interacting with RETREG1 and TRIM21 proteins.

[0004] Clinically, since CKAP4 is highly expressed in various solid tumor tissues and is associated with tumor metastasis and poor patient prognosis, it is expected to be a potential biomarker for cancer diagnosis and prognosis assessment. Targeted blockade of CKAP4 has broad prospects in inhibiting the migration and invasion of cancer cells, and related research provides new targets and ideas for the development of new anti-tumor drugs. Summary of the Invention

[0005] Therefore, this application provides a CKAP4 inhibitor, a breast cancer drug, and their applications. This CKAP4 inhibitor can directly or indirectly inhibit CKAP4 expression, down-regulate its expression level, and thus play a role in inhibiting the proliferation, migration, and invasion of breast cancer cells and tissues. In addition, the various CKAP4 inhibitors provided in the examples can promote the apoptosis of breast cancer cells and tissues and inhibit their tumor angiogenesis, have obvious preventive and therapeutic effects on breast cancer, and have the application prospect of developing into breast cancer drugs.

[0006] In a first aspect, an embodiment discloses a CKAP4 inhibitor, including at least one of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, reduced L-glutathione, the protein shown in SEQ ID NO:5, the RNAs shown in SEQ ID NO:10 and SEQ ID NO:11, the RNAs shown in SEQ ID NO:12 and SEQ ID NO:13, a compound that inhibits MEK expression, a compound that inhibits PI3K expression, and a compound that inhibits AKT expression.

[0007] In a second aspect, an embodiment discloses the use of ixazomib in the preparation of a CKAP4 inhibitor, and the binding energy between the ixazomib and CKAP4 is -77.15 kcal / mol.

[0008] In a third aspect, an embodiment discloses the use of KY02111 in the preparation of a CKAP4 inhibitor, and the binding energy between the KY02111 and CKAP4 is -39.79 kcal / mol.

[0009] In a fourth aspect, an embodiment discloses the use of (E / Z)-CP-724714 in the preparation of a CKAP4 inhibitor, and the binding energy between the (E / Z)-CP-724714 and CKAP4 is -108.23 kcal / mol.

[0010] In a fifth aspect, an embodiment discloses the use of chlorogenic acid in the preparation of a CKAP4 inhibitor, and the binding energy between the chlorogenic acid and CKAP4 is -109.8 kcal / mol.

[0011] In a sixth aspect, an embodiment discloses the use of MDL-28170 in the preparation of a CKAP4 inhibitor, and the binding energy between the ixazomib and CKAP4 is -111.28 kcal / mol.

[0012] In a seventh aspect, an embodiment discloses the use of reduced L-glutathione in the preparation of a CKAP4 inhibitor, and the binding energy between the reduced L-glutathione and CKAP4 is -94.6 kcal / mol.

[0013] In an eighth aspect, an embodiment discloses the use of a compound that inhibits MEK expression in the preparation of a CKAP4 inhibitor.

[0014] In a ninth aspect, an embodiment discloses the use of a compound that inhibits AKT expression in the preparation of a CKAP4 inhibitor.

[0015] In a tenth aspect, an embodiment discloses the use of a compound that inhibits PI3K expression in the preparation of a CKAP4 inhibitor.

[0016] In the eleventh aspect, the embodiment discloses the use of the protein shown in SEQ ID NO: 5 in the preparation of a CKAP4 inhibitor.

[0017] In the twelfth aspect, the embodiment discloses the use of the RNAs shown in SEQ ID NO: 10 and SEQ ID NO: 11, and the RNAs shown in SEQ ID NO: 12 and SEQ ID NO: 13 in the preparation of a CKAP4 inhibitor.

[0018] In the thirteenth aspect, the embodiment discloses a breast cancer drug, comprising at least one of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, reduced L-glutathione, the protein shown in SEQ ID NO: 5, the RNAs shown in SEQ ID NO: 10 and SEQ ID NO: 11, the RNAs shown in SEQ ID NO: 12 and SEQ ID NO: 13, a compound that inhibits MEK expression, a compound that inhibits PI3K expression, and a compound that inhibits AKT expression.

[0019] In the fourteenth aspect, the embodiment discloses the use of at least one of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, reduced L-glutathione, the protein shown in SEQ ID NO: 5, the RNAs shown in SEQ ID NO: 10 and SEQ ID NO: 11, the RNAs shown in SEQ ID NO: 12 and SEQ ID NO: 13, a compound that inhibits MEK expression, a compound that inhibits PI3K expression, and a compound that inhibits AKT expression in the preparation of a CKAP4 inhibitor or a breast cancer drug.

[0020] In some embodiments, the compound that inhibits MEK expression is selected from at least one of U0126, PD 98059, SL 327, arctigenin, PD 198306, PD 334581, BIX 02189, trametinib, cobimetinib, selumetinib, binimetinib, and tazemetostat.

[0021] In some embodiments, the compound that inhibits AKT expression is selected from at least one of AKT Inhibitor IV, perifosine, 10-deethylbromide vincristine hydrochloride, Akti-1 / 2, trabectedin, GSK2141795, GSK 690693, AT7867, AZD5363, MK-2206 Dihydrochloride, urolithin A, OSU 03012, WYE 687 hydrochloride, and GSK2334470.

[0022] In some embodiments, the compounds that inhibit PI3K expression are selected from at least one of LY294002, PIK 90, Omipalisib, PI 103 hydrochloride, Urolithin A, LY294002 hydrochloride, A66, wortmannin, PI 828, AZD 6482, quercetin, and idelalisib. Description of the Drawings

[0023] Figure 1 Expression results in breast cancer and adjacent tissues provided for the test examples. Figure 1 A is an immunohistochemical staining image of CKAP4 protein. Figure 1 B is a statistical graph of the expression level of CKAP4 protein. Figure 1 C is the expression score of CKAP4 protein.

[0024] Figure 2 Expression results in breast cancer (T) and adjacent tissues (N) provided for the RT-PCR test example (A) and the WB test example (B), n = 12, ***P < 0.001.

[0025] Figure 3 Expression results of CKAP4 protein in various breast cancer cells provided for the WB test example.

[0026] Figure 4A Molecular docking diagram of ixazomib and CKAP4 provided for the test example.

[0027] Figure 4B Molecular docking diagram of KY02111 and CKAP4 provided for the test example.

[0028] Figure 4C Molecular docking diagram of (E / Z)-CP-724714 and CKAP4 provided for the test example.

[0029] Figure 4D Molecular docking diagram of chlorogenic acid and CKAP4 provided for the test example.

[0030] Figure 4E Molecular docking diagram of MDL-28170 and CKAP4 provided for the test example.

[0031] Figure 4F Molecular docking diagram of reduced L-glutathione and CKAP4 provided for the test example.

[0032] Figure 5 Cell proliferation inhibition rates after different concentrations of MDL-28170 (A) and chlorogenic acid (B) act on three different breast cancer cells provided for the test example.

[0033] Figure 6 Results of inhibiting CKAP4 and promoting apoptosis of breast cancer cells provided for the test example. Figure 6 A is the TUNEL staining image of MDA-MB-231 cells. Figure 6 B is the TUNEL staining image of HCC1806 cells. Figure 6 C is Figure 6 A and Figure 6 Statistical chart of the apoptosis rate of B.

[0034] Figure 7A Results of inhibiting CKAP4 and inhibiting the migration of MDA-MB-231 cells provided for the test example. *P < 0.05, **P < 0.01, ***P < 0.001.

[0035] Figure 7B Results of inhibiting CKAP4 and inhibiting the migration of HCC1806 cells provided for the test example. *P < 0.05, **P < 0.01, ***P < 0.001.

[0036] Figure 8 Results of inhibiting CKAP4 and inhibiting the invasion of breast cancer cells provided for the test example. Figure 8 A is the TUNEL staining image of MDA-MB-231 cells and HCC1806 cells. Figure 8 B is Figure 8 Statistical chart of the number of invasive cells of A.

[0037] Figure 9 Results of inhibiting CKAP4 and inhibiting the in vivo growth of breast cancer tissues provided for the test example. Figure 9 A is a schematic diagram of establishing a xenograft tumor model of HCC1806 cells in nude mice. Figure 9 B is the curve of the change in the volume of the transplanted tumor. Figure 9 C is the solid image of the transplanted tumor. Figure 9 D is the statistical chart of the weight of the transplanted tumor. ***P < 0.001.

[0038] Figure 10 Results of the staining of the protein shown in SEQ ID NO:5 provided for the test example to inhibit the expression of CKAP4 in breast cancer cells. Figure 10 A is the co-culture of the protein shown in SEQ ID NO:5 with MDA-MB-231 and HCC1806 breast cancer cells. Immunofluorescence shows that the protein shown in SEQ ID NO:5 is red, DAPI shows the cell nucleus, and the composite image shows that the protein shown in SEQ ID NO:5 is localized in the cytoplasm. Figure 10 B shows that compared with the control group, the expression of CKAP4 in breast cancer cells treated with the protein shown in SEQ ID NO:5 is significantly down-regulated.

[0039] Figure 11 The statistical results of CKAP4 expression inhibited by the protein shown in SEQ ID NO:5 provided for the test example in breast cancer cells. Figure 11 A is the statistical result of qPCR, Figure 11 B is the WB figure. ***P < 0.001.

[0040] Figure 12 The results of inhibiting the proliferation of breast cancer xenografts in vivo by the protein shown in SEQ ID NO:5 provided for the test example. Figure 12 A is a schematic diagram of the nude mouse xenograft model. Figure 12 B is the growth curve of the xenograft. Figure 12 C is the solid figure of the xenograft. Figure 12 D is the statistical chart of the weight of the xenograft. ***P < 0.001.

[0041] Figure 13 The HE, CKAP4, PLBD2, MCM6 and Ki-67 staining results of inhibiting breast cancer xenografts in vivo by the protein shown in SEQ ID NO:5 provided for the test example.

[0042] Figure 14 The statistical results of CKAP4, PLBD2, MCM6 and Ki-67 expression inhibited by the protein shown in SEQ ID NO:5 in breast cancer xenografts in vivo provided for the test example.

[0043] Figure 15 The tissue staining diagrams of heart, liver, spleen, kidney, lung, brain and stomach in the body of mice with breast cancer xenografts inhibited by the protein shown in SEQ ID NO:5 provided for the test example. ***P < 0.001.

[0044] Figure 16 The CKAP4 and KRAS expression results after interfering with breast cancer cells by interfering RNA provided for RT-PCR test example (A) and WB test example (B) respectively. In the figure, "shKRAS" indicates treatment with RNA shown in SEQ ID NO:8 and 9, and "shKRAS" indicates no RNA treatment.

[0045] Figure 17 The relative expression levels of CKAP4 mRNA in MDA-MB-231 cells (A) and HCC1806 cells (B) treated with different compounds respectively provided for RT-PCR test example. In the figure, "+" indicates treatment with this compound, and "—" indicates no treatment with this compound.

[0046] Figure 18 The expression levels of CKAP4 protein in MDA-MB-231 cells (A) and HCC1806 cells (B) provided for WB test cases, respectively treated with different compounds. In the figure, "+" indicates treatment with this compound, and "—" indicates no treatment with this compound.

[0047] Figure 19 The expression levels of CKAP4 protein in MDA-MB-231 cells (A) and HCC1806 cells (B) provided for WB test cases, respectively treated with MEK inhibitors. Detailed implementation manners

[0048] In order to make the objectives, technical solutions and advantages of this application clearer and more understandable, the following further details this application in combination with embodiments. It should be understood that the specific embodiments described herein are only used to explain this application and are not used to limit this application. Reagents not described in detail and separately in this application are all conventional reagents and can be obtained from commercial channels; methods not described in detail and specifically are all conventional experimental methods and can be learned from the prior art.

[0049] The expression of CKAP4 mRNA and protein in human breast cancer tissues is higher than that in adjacent tissues

[0050] 1. Clinical samples

[0051] 101 postoperative specimens of breast cancer patients who received surgical treatment in the hospital from January 2015 to January 2017 were collected. The tissues were routinely fixed with 4% neutral formalin, and tissue sections were prepared for hematoxylin-eosin staining. The pathological results were confirmed by two experienced pathologists above the attending physician level. Histopathological typing was performed according to the pathological diagnosis of breast tumors of the WHO (2019 edition), and the pathological diagnosis was non-special invasive breast cancer. Histological grading was performed according to the Nottingham grading system score. Patient follow-up data were collected by telephone. This study was approved by the Ethics Committee.

[0052] 2. Methods

[0053] (1) Hematoxylin-eosin (HE) staining

[0054] The paraffin blocks of breast cancer tissues or tissue microarray paraffin blocks were sectioned, fixed on glass slides, stained, and sealed.

[0055] (2) Immunohistochemical staining (IHC)

[0056] The paraffin blocks of breast cancer tissues or tissue microarray paraffin blocks were sectioned, dewaxed, hydrated, subjected to antigen retrieval, endogenous peroxidase blocked, primary antibody (CKAP4 antibody, Enzo Life Science) added and incubated at 37 °C for 1 hour. After washing, secondary antibody (enzymatically labeled goat anti-mouse / rabbit IgG polymer) was added and incubated at 37 °C for 20 minutes. After washing, color development, counterstaining, dehydration, clearing and mounting were carried out. The total score was calculated by multiplying the proportion of positive tumor cells by the staining intensity score. The proportions of positive tumor cells were 0 (5%), 1 (6 - 25%), 2 (26 - 50%), 3 (51% - 75%), 4 (76 - 100%) respectively. The staining intensity scores were 0 (none), 1 (weak), 2 (medium), 3 (strong) respectively. According to the final score, if <5% of the cells were stained, regardless of the staining intensity, it was determined to be negative (-); scores of 1 - 4 were recorded as weak (+); scores of 5 - 8 were moderate (++); scores of 9 - 12 were strong (+++). In the subsequent statistical analysis, negative and weak expression were determined as the low expression group, and moderate and strong expression were determined as the high expression group.

[0057] (3) Real-time fluorescence quantitative reverse transcription PCR

[0058] Total RNA was extracted from fresh breast cancer tissues and adjacent breast tissues using Trizol reagent. The concentration of total RNA was measured using NANODROP2000, and the quality of RNA was analyzed by agarose gel electrophoresis. The total RNA with determined concentration and quality was reverse transcribed into cDNA. The reverse transcription system was formulated to contain 2 μL RT Master Mix (5×), 100 ng - 1 μg total RNA, and the balance of nuclease-free water in a volume of 10 μL.

[0059] The cDNA samples obtained by reverse transcription were subjected to qPCR. The qPCR reaction system was formulated to contain 1 μL cDNA, 0.8 μL 10 μM upstream primer, 0.8 μL 10 μM downstream primer, 10 μL 1×TSING Master SYBR Green I qPCR Mix - UDG (Without ROX), and the balance of double-distilled water in a volume of 20 μL. The qPCR reaction steps included: 50 °C, 2 min; 95 °C, 2 min; 95 °C, 15 s; 40 cycles; 60 °C, 1 min. The expression of RNA was normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Data analysis was performed using Bio-Rad CFX96 Manager software.

[0060] Among them, the upstream primer for detecting CKAP4 mRNA is: aagctgtgaagcaaggggag, as shown in SEQ ID NO:1. The downstream primer for detecting CKAP4 mRNA: ggatttggtgagctccgtca, as shown in SEQ ID NO:2.

[0061] The upstream primer for detecting GAPDH mRNA is: gaaagcctgccggtgactaa, as shown in SEQ ID NO:3. The upstream primer for detecting GAPDH mRNA is: gcccaatacgaccaaatcagaga, as shown in SEQ ID NO:4.

[0062] (4) Protein immunoblotting (western blotting, WB)

[0063] Fresh breast cancer tissues and adjacent breast tissues were lysed with RIPA buffer, total proteins were extracted, and the protein concentration was detected by the BCA method. SDS-PAGE electrophoresis was performed, and the gel was transferred to a PVDF membrane using a membrane transfer instrument and blocked at room temperature for 1-2 h. The primary antibody (CKAP4 antibody, Enzo Life Science) was added and incubated at 4°C for 12 hours. After washing, the secondary antibody (horseradish peroxidase-labeled goat anti-rabbit IgG) was added and incubated at room temperature for 2 h, and then developed. The protein expression level was analyzed using ImageJ software.

[0064] 3. Results

[0065] As shown in Table 1 and Figure 1 101 clinical breast cancer samples were collected. Immunohistochemical staining was performed on breast cancer tissues and adjacent breast tissues to detect the CKAP4 protein expression level, and semi-quantitative analysis was carried out. According to the scoring principle, the CKAP4 expression level was divided into a low-expression group and a high-expression group. The results showed that among the 101 breast cancer tissues, 32 cases had low expression (accounting for 68.3%), and 69 cases had high expression (accounting for 31.7%); among the paired adjacent breast tissues of the same patients, 81 cases had low expression (accounting for 80.2%), and 20 cases had high expression (accounting for 19.8%). The CKAP4 expression in breast cancer tissues was significantly higher than that in adjacent breast tissues.

[0066] Twelve pairs of breast cancer tissues and corresponding breast tissues were randomly selected from the above samples, and the mRNA and protein expression levels of CKAP4 were detected by qPCR and WB. As Figure 2 shown, the mRNA and protein expression levels of CKAP4 in breast cancer tissues were both higher than those in adjacent tissues.

[0067] As Figure 3WB analysis of CKAP4 protein expression in breast cell lines showed that, compared with breast epithelial cell lines (MCF-10A, 184B5), HER-2 overexpressing breast cancer cell lines (SKBR-3), and Luminal breast cancer cell lines (T47D, MCF-7), CKAP4 was significantly upregulated in TNBC cell lines (MDA-MB-231, HCC1806, HS578T, 149PT); among them, the expression of CKAP4 was relatively high in MDA-MB-231 and HCC1806 cells. These results suggest that both the transcriptional and translational expression levels of CKAP4 are elevated in breast cancer, especially TNBC (triple-negative breast cancer), and it may play a regulatory role in the occurrence and development of cancer.

[0068] Table 1 Statistical analysis of CKAP4 protein expression in breast cancer and adjacent tissues

[0069]

[0070] Directly inhibit CKAP4

[0071] In addition, high expression of CKAP4 is a poor prognostic factor in pancreatic cancer and lung cancer patients, promoting tumor cell proliferation and migration. Therefore, the embodiments of the present application provide an inhibitor of CKAP4, which inhibits the expression of CKAP4 or binds to CKAP4 to make it difficult to promote the proliferation and migration of tumor cells.

[0072] In some embodiments, the inhibitor is selected from ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, and reduced L-glutathione.

[0073] Download the crystal structure of CKAP4 protein (ID: AF-Q07065-F1) from the AlphaFold2 website (https: / / alphafold.ebi.ac.uk) as the molecular docking acceptor, and use docking software to determine the optimal ligand binding site. The docking of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, and reduced L-glutathione with CKAP4 was analyzed by LibDock molecular docking.

[0074] As Figure 4A shown in Figures F, the docking diagrams of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, and reduced L-glutathione with CKAP4 are respectively shown. The binding energies of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, and reduced L-glutathione with CKAP4 were calculated and are shown in Table 2.

[0075] Table 2 Docking Statistical Results of CKAP4 and Small Molecule Compounds

[0076] Site CAS number LibDock docking score Calculate the binding energy (kcal / mol) Ixazomib 1072833-77-2 125.76 -77.15 KY02111 1118807-13-8 129.506 -39.79 (E / Z)-CP-724714 537705-08-1 124.23 -108.23 Chlorogenic acid 327-97-9 123.913 -109.8 MDL-28170 88191-84-8 125.448 -111.28 Reduced L-glutathione 70-18-8 122.39 -94.6

[0077] As shown in Table 2, the binding energies of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, and reduced L-glutathione to CKAP4 are all negative values, indicating that they all have an affinity for CKAP4 and can inhibit the function of CKAP4.

[0078] In addition, through testing, it is known that the binding constants of chlorogenic acid and MDL-28170 to CKAP4 are 4.26×10 -4 M and 8.69×10 -4 M, respectively.

[0079] Inhibit CKAP4 and then inhibit the proliferation of breast cancer cells

[0080] In some test examples, different concentrations of MDL-28170 and chlorogenic acid were co-incubated with breast cancer cells highly expressing CKAP4, and the cell proliferation was tested. Specifically as follows:

[0081] HCC1806 cells highly expressing CKAP4 or MDA-MB-231 cells highly expressing CKAP4 in the logarithmic growth phase were seeded into 6-well plates at a density of 2×10 5 cells / well. After the cells adhered, the medium was replaced with a medium containing 2 μM, 4 μM, 6 μM, or 8 μM of MDL-28170 or a medium containing 2 μM, 4 μM, 6 μM, or 8 μM of chlorogenic acid. At least 3 replicate wells were set, and a solvent control group (a medium containing the same concentration of DMSO as the drug group) was also set. After the cells were cultured for another 48 hours, the medium in the culture wells was aspirated, and the cell inhibition rate was tested by the SRB staining method. The cell inhibition rate is the percentage of SRB-positive cells in the total number of cells.

[0082] As Figure 5 shown, compared with normal mammary epithelial cells MCF-10A, MDL-28170 and chlorogenic acid can significantly inhibit the proliferation of MDA-MB-231 cells and HCC180 cells.

[0083] Inhibit CKAP4 and then promote the apoptosis of breast cancer cells

[0084] In some test examples, different concentrations of MDL-28170 and chlorogenic acid were co-incubated with breast cancer cells highly expressing CKAP4, and the cell apoptosis was tested. Specifically as follows:

[0085] The HCC1806 cells with high expression of CKAP4 or MDA-MB-231 cells with high expression of CKAP4 that have grown to the logarithmic growth phase were seeded into 6-well plates at a density of 2×10 5 cells / well. After the cells adhered, the medium was replaced with a medium containing 40 μM MDL-28170 or a medium containing 40 μM chlorogenic acid. At least 3 replicate wells were set up, and a solvent control group (medium containing only the same concentration of DMSO as in the drug group) was also set up. After culturing the cells for another 48 hours, the medium in the culture wells was aspirated, and the cell apoptosis rate was measured by the TUNEL staining method. The cell apoptosis rate was the percentage of the number of TUNEL-positive cells to the total number of cells.

[0086] As Figure 6 shown, compared with the control group, after MDL-28170 and chlorogenic acid acted on breast cancer cells for 48 hours respectively, the number of apoptotic tumor cells increased significantly.

[0087] Inhibit CKAP4 and then inhibit the migration of breast cancer cells

[0088] In some test cases, different concentrations of MDL-28170 and chlorogenic acid were co-incubated with breast cancer cells with high expression of CKAP4 respectively to test cell migration. The specific steps were as follows:

[0089] When the MDA-MB-231 cells and HCC1806 cells with high expression of CKAP4 reached 80%-90% confluence, a sterile 200 μL pipette tip was used to scratch the cell layer perpendicular to the bottom of the culture well. After scratching, the cells were gently rinsed 2-3 times with PBS to remove the scratched cell debris. An experimental group and a control group were set up. The experimental group was added with a medium containing 40 μM MDL-28170 and 40 μM chlorogenic acid, and the control group was added with a medium without small molecule compounds (containing an equal amount of solvent). The culture plate was placed in a cell culture incubator and continued to be cultured. At time points such as 0 h, 24 h, 48 h, and 72 h after culturing, the cell migration was observed under an inverted microscope. Photos could be taken at a fixed field of view, and the cell migration rate (%) = (initial scratch area - scratch area at a certain time point) / initial scratch area × 100%.

[0090] As Figure 7A shown, when MDL-28170 and chlorogenic acid were co-cultured with MDA-MB-231 cells for 24 h, 48 h, and 72 h respectively, the change in scratch width was small, and the cell migration rate of MDA-MB-231 cells was small.

[0091] As Figure 7B shown, when MDL-28170 and chlorogenic acid were co-cultured with HCC1806 cells for 24 h, 48 h, and 72 h respectively, the change in scratch width was small, and the cell migration rate of HCC1806 cells was small.

[0092] This indicates that MDL-28170 and chlorogenic acid can significantly inhibit the migration of breast cancer cells with high CKAP4 expression.

[0093] Inhibiting CKAP4 and thereby inhibiting the invasion of breast cancer cells

[0094] In some test cases, different concentrations of MDL-28170 and chlorogenic acid were co-incubated with breast cancer cells with high CKAP4 expression respectively to test the cell invasion. The specific steps are as follows:

[0095] After digesting MDA-MB-231 cells with high CKAP4 expression in the logarithmic growth phase and HCC1806 cells with high CKAP4 expression in the logarithmic growth phase, the cells were resuspended with serum-free medium. 10 5 cell suspensions were added to the upper chamber of the Transwell chamber (8μm), and at the same time, 40 μM MDL-28170 and chlorogenic acid were added. DMEM containing 20% fetal bovine serum was added to the lower chamber of the Transwell chamber as a chemotactic factor. The Transwell chamber was placed in a 24-well plate and cultured in an incubator at 37°C and 5% CO2 for 24 h. The invasion chamber was taken out, and the non-invasive cells in the upper chamber were gently wiped off with a cotton swab. The cells migrating to the lower chamber were fixed with formaldehyde and then stained with Giemsa. The number of cells invading into the lower chamber was observed and counted under a microscope, and statistical analysis was performed.

[0096] As Figure 8 shown, after MDL-28170 was co-incubated with MDA-MB-231 and HCC1806 cells respectively, the number of invaded cells decreased. After chlorogenic acid was co-incubated with MDA-MB-231 and HCC1806 cells respectively, the number of invaded cells decreased. This indicates that MDL-28170 and chlorogenic acid can significantly inhibit the invasion of breast cancer cells with high CKAP4 expression.

[0097] Inhibit CKAP4 and then inhibit the proliferation of xenografts in vivo

[0098] In some test cases, different concentrations of MDL-28170 and chlorogenic acid were respectively injected into the transplanted tumors of breast cancer model mice with high CKAP4 expression to test the proliferation of the transplanted tumors. The specific steps are as follows:

[0099] Six-week-old female BALB / c nude mice (Beijing) were raised under specific pathogen-free (SPF) conditions. All animal experiments were approved by the Animal Ethics Committee. 1×10 6Highly CKAP4-expressing HCC1806 breast cancer cells were subcutaneously injected into the mammary fat pads of nude mice, and the size of subcutaneous tumors was observed every 4 days. The growth of tumors was dynamically observed using vernier calipers, and the calculation formula was volume = 1 / 2 (width² × length), obtaining breast cancer model mice. The breast cancer model mice were divided into a control group, an MDL28170 group, and a chlorogenic acid group. When the tumor volume reached 100 mm 3 MDL28170 at a dose of 100 μg / mouse was injected into the transplanted tumors of the breast cancer model mice in the MDL28170 group three times a week for 2 weeks. At the same time, when the tumor volume reached 100 mm 3 chlorogenic acid at a dose of 100 μg / mouse was injected into the transplanted tumors of the breast cancer model mice in the chlorogenic acid group three times a week for 2 weeks.

[0100] At the observation endpoint, euthanasia was performed by rapid cervical dislocation. The tumors were excised and weighed. The tumor tissues were sampled, dehydrated, embedded, sectioned, and stained with HE to observe the histological morphology and immunohistochemical analysis. The specific method was the same as described above.

[0101] As Figure 9 shown, compared with the control group, the tumor growth rate in the treatment group was significantly slowed down, and the volume and weight of the transplanted tumors were significantly decreased. This indicates that MDL-28170 and chlorogenic acid can inhibit CKAP4 and thus inhibit the proliferation of transplanted tumors in vivo.

[0102] The protein shown in SEQ ID NO:5 inhibits the expression of CKAP4 in breast cancer cells

[0103] In some embodiments, the inhibitor further comprises a protein as shown in SEQ ID NO:5.

[0104] In some test examples, proteins at different concentrations as shown in SEQ ID NO:5 were co-incubated with breast cancer cells highly expressing CKAP4, and the expression of CKAP4 in the cells was tested. Specifically as follows:

[0105] HCC1806 cells highly expressing CKAP4 or MDA-MB-231 cells highly expressing CKAP4 in the logarithmic growth phase were seeded into 6-well plates at a density of 2×10 5 cells / well. After the cells adhered, the medium was replaced with a medium containing 6 μM of the protein as shown in SEQ ID NO:5, and at least 3 replicate wells were set. At the same time, a solvent control group was set, which was a medium containing only the same concentration of DMSO as the drug group. After the cells were cultured for another 48 hours, the medium in the culture wells was aspirated, and the apoptosis rate of the cells was tested by the TUNEL staining method. The apoptosis rate was the percentage of apoptotic cells in the total number of cells.

[0106] The relative expression levels of CKAP4 mRNA in MDA-MB-231 cells and HCC1806 cells were detected by the same method as in the above embodiments, and the expression level of CKAP4 protein in breast cancer cells incubated with the protein shown in SEQ ID NO: 5 was detected by WB.

[0107] As Figure 10 shown, immunofluorescence experiments showed that the protein shown in SEQ ID NO: 5 was localized in the cytoplasm, suggesting that the protein shown in SEQ ID NO: 5 could bind to integrin on the surface of breast cancer cells through the RGD it carried. Compared with the control group, the expression of CKAP4 in breast cancer cells co-cultured with the protein shown in SEQ ID NO: 5 was significantly down-regulated.

[0108] As Figure 11 shown, co-incubating the protein shown in SEQ ID NO: 5 with MDA-MB-231 cells and HCC1806 cells with high expression of CKAP4 could significantly reduce the expression levels of CKAP4, PLBD2 (protein 2 with phospholipase B domain) and MCM6 (minichromosome maintenance complex 6) in MDA-MB-231 cells and HCC1806 cells. Among them, the primers for detecting the expression level of PLBD2 mRNA by RT-PCR were as described in SEQ ID NO: 6 and 7, and the primers for detecting the expression level of MCM6 mRNA by RT-PCR were as described in SEQ ID NO: 8 and 9. Among them, the primary antibody for WB detection of PLBD2 was purchased from Proteintech, catalog number: #14475-1-AP, dilution factor 1:1000. The primary antibody for WB detection of MCM6 was purchased from Abcam, catalog number: #ab4459, dilution factor 1:1000.

[0109] This shows that using the protein shown in SEQ ID NO: 5 can not only act on CKAP4 in breast cancer cells, but also act on protein 2 with phospholipase B domain and minichromosome maintenance complex 6.

[0110] Protein 2 with phospholipase B domain has biological functions of promoting lipid metabolism, promoting tumor cell migration and invasion, and participating in the apoptosis regulation of tumor cells, affecting tumor angiogenesis. It can be seen that the protein shown in SEQ ID NO: 5 provided in this application can inhibit lipid metabolism, tumor cell migration and invasion of lactic acid cancer cells, promote their apoptosis and inhibit their tumor angiogenesis, has obvious tumor prevention and treatment effects, and has the application prospect of developing as a breast cancer drug.

[0111] The protein shown in SEQ ID NO:5 inhibits the proliferation of breast cancer in vivo

[0112] Six-week-old female BALB / c nude mice (Beijing) were raised under specific pathogen-free (SPF) conditions. All animal experiments were approved by the Animal Ethics Committee. 1×10 6 HCC1806 breast cancer cells with high CKAP4 expression were subcutaneously injected into the mammary fat pads of nude mice, and the size of subcutaneous tumors was observed every 4 days. The growth of tumors was dynamically observed using vernier calipers, and the calculation formula was volume = 1 / 2 (width² × length), obtaining breast cancer model mice. The breast cancer model mice were divided into a control group and an antibody group. When the tumor volume reached 100 mm 3 , the protein shown in SEQ ID NO:5 at a dose of 30 mg / kg body weight was intraperitoneally injected into the breast cancer model mice in the antibody group once every 3 days for a total of 22 days. At the end of the observation, euthanasia was performed by rapid cervical dislocation, and the tumors were excised and weighed and the volume was calculated.

[0113] As Figure 12 shown, compared with the control group, the growth rate of the treatment group was significantly decreased, and the volume and weight of the xenograft tumors in the nude mice of the treatment group were significantly smaller than those of the control group.

[0114] As Figure 13 shown, the histological morphology of the xenograft tumors in nude mice was observed by hematoxylin-eosin staining of the xenograft tumor tissues. Under the microscope, atypical cell clusters were distributed in a nest-like pattern, and keratin pearls were seen in some areas. The cells were round or oval, with large nuclei, rough chromatin, and obvious nucleoli, showing the morphology of squamous cell carcinoma. Compared with the antibody group, multiple foci of necrosis were seen in the xenograft tumors of the untreated group (Control), and the cellular atypia was more significant.

[0115] As Figure 14 shown, when the protein shown in SEQ ID NO:5 acted on the HCC1806 breast cancer-inhibited tumor mice, the expressions of CKAP4, PLBD2, MCM6, and Ki-67 in the tumor tissues were all decreased. This indicates that the protein shown in SEQ ID NO:5 can not only act on CKAP4 in breast cancer cells, but also act on the protein 2 of the phospholipase B domain and the minichromosome maintenance complex 6. The protein shown in SEQ ID NO:5 provided in this application can inhibit the lipid metabolism, migration and invasion of lactic acid cancer cells, promote their apoptosis and inhibit their tumor angiogenesis, and has an obvious preventive and therapeutic effect on breast cancer, and has the application prospect of developing as a breast cancer drug.

[0116] As Figure 15As shown, the protein shown in SEQ ID NO:5 was used on HCC1806 breast cancer inhibitory tumor mice, and there were no pathological changes in the heart, liver, spleen, kidney, lung, brain and stomach of the mice. This shows that the protein shown in SEQ ID NO:5 has no organ toxicity, not only has obvious breast cancer prevention and treatment effects, but also has no toxic and side effects, and has the application prospect of developing as a breast cancer drug.

[0117] Inhibit KRAS and then inhibit CKAP4

[0118] The ERK signaling pathway is mainly composed of RAS protein, RAF protein, MEK protein and ERK protein. Among them, the RAS protein is a small G protein with GTPase activity. It binds to GDP in the inactive state. When the cell is stimulated by external signals, the RAS protein binds to the guanine nucleotide exchange factor (GEF), and the exchange of GDP and GTP occurs to activate it. The activated RAS-GTP can bind to and activate downstream proteins. The RAS protein is a protein family encoded by the RAS gene family, and this family includes genes such as KRAS, NRAS and HRAS. The KRAS protein is a member of the RAS protein family and is encoded by the KRAS gene. The KRAS protein is a key protein in the ERK signaling pathway, and its main function is to transmit extracellular signals into the cell, thereby regulating processes such as cell growth, proliferation and differentiation. When the cell receives signals such as growth factors, the KRAS protein will bind to GTP and be activated, and then initiate downstream signal transduction.

[0119] The examples also proved that the expression of CKAP4 in breast cancer is activated by the signaling pathway. Therefore, the examples provide a CKAP4 inhibitor, including at least one of interfering RNA targeting KRAS, a lentiviral vector carrying the interfering RNA, and a lentivirus carrying the interfering RNA.

[0120] Among them, the sense strand of interfering RNA1 targeting KRAS is 5’-GCUGGAGCAGAUGACGCAGAUUCAAGAGA-3’, SEQ ID NO:10, and the antisense strand is: 5’-UCUGCGUCAUCUGCUCCAGC-3’, SEQ ID NO:11.

[0121] The sense strand of interfering RNA2 targeting KRAS is 5’-GCUGGUGCAGACGAAUAUCUUUCAAGAGA-3’, SEQ ID NO:12, and the antisense strand is: 5’-AGAUAUUCGUCUGCACCAGC-3’, SEQ ID NO:13.

[0122] The embodiment also provides a method for inhibiting the CKAP4 expression of breast cancer cells. The method includes: mixing the interfering RNA targeting KRAS with a transfection reagent to form a complex of double-stranded RNA and the transfection reagent; co-culturing the complex with breast cancer cells; harvesting and screening positive cells from the co-culture, and the positive cells are the breast cancer cells with inhibited CKAP4 expression.

[0123] In some embodiments, the method for inhibiting the CKAP4 expression of breast cancer cells specifically includes:

[0124] 1) Chemically synthesize the interfering RNA targeting KRAS and dissolve it in RNase-free water to 20 μM.

[0125] 2) Inoculate HCC1806 cells or MDA-MB-231 cells in the logarithmic growth phase at an appropriate density (such as 2×10 5 cells / well) into a 6-well plate, add 2 ml of complete medium to each well, and place it in an incubator for 24 h to allow the cells to adhere and reach 30%-50% confluence.

[0126] 3) Preparation of the transfection complex: Operate according to the instructions of Lipofectamine RNAiMAX transfection reagent. In a sterile centrifuge tube, dilute 50 pmol of double-stranded RNA and 5 μL of transfection reagent to 100 μL with Opti-MEM medium respectively, mix gently, and incubate at room temperature for 5 min. Then mix the diluted double-stranded RNA and transfection reagent, mix gently, and incubate at room temperature for 20 min to form a complex of double-stranded RNA and the transfection reagent.

[0127] 4) Cell transfection: Aspirate the original medium in the 6-well plate, and add 800 μL of Opti-MEM medium to each well. Then add the complex of double-stranded RNA and transfection reagent dropwise into the cell culture wells, gently shake the culture plate to make the complex evenly distributed. Place the culture plate back into the incubator and continue to culture for 4-6 h, then replace it with complete medium and continue to culture. Screen positive cells from the culture, and the positive cells are the breast cancer cells with inhibited CKAP4 expression.

[0128] In some test cases, RT-PCR and Western blot were used to detect the expression levels of RNA as shown in SEQ ID NO: 10 and SEQ ID NO: 11, RNA as shown in SEQ ID NO: 12 and SEQ ID NO: 13, the expression level of CKAP4 and the expression level of KRAS in breast cancer cells with interference. The detection steps were the same as those in the above embodiments. Among them, the primers for detecting the relative expression level of KRAS mRNA were as shown in SEQ ID NO: 8 and 9. The primary antibody for detecting the expression level of KRAS protein in Western blot was purchased from Cell Signaling Technology (CST), catalog number: #12063, dilution factor 1:1000.

[0129] As Figure 16 shown, the expression of KRAS in HCC1806 cells and MDA-MB-231 cells interfered by double-stranded RNA decreased, indicating that the double-stranded RNA successfully interfered with the expression of the KRAS gene. Moreover, when the double-stranded RNA interfered with the expression of KRAS, the expression level of CKAP4 in HCC1806 cells and MDA-MB-231 cells decreased. Therefore, the double-stranded RNA can be used as a CKAP4 inhibitor.

[0130] Inhibit at least one of MEK / AKT / PI3K and then inhibit CKAP4

[0131] The ERK signaling pathway, namely the extracellular signal-regulated kinase signaling pathway, is one of the important signal transduction pathways in cells and plays a key role in various physiological processes such as cell growth, differentiation, proliferation, apoptosis, and cell migration. The ERK signaling pathway mainly consists of RAS protein, RAF protein, MEK protein, and ERK protein. MEK protein, namely mitogen-activated protein kinase kinase, is a dual-specificity kinase that can phosphorylate and activate ERK protein. MEK protein has two key phosphorylation sites, and its activation requires the simultaneous phosphorylation of these two sites. ERK protein is a serine / threonine protein kinase that usually exists in an inactive form in the cytoplasm. ERK protein has multiple subtypes, such as ERK1 and ERK2, etc., which have similar structures and functions and contain functional domains such as kinase domains and nuclear localization signals. When specific threonine and tyrosine residues of ERK protein are phosphorylated by MEK, ERK is activated and can translocate into the nucleus to regulate the expression of downstream genes.

[0132] The AKT signaling pathway, also known as the PI3K-AKT signaling pathway, is a signal transduction pathway that plays a crucial role in various physiological processes such as cell growth, proliferation, survival, and metabolism. The AKT signaling pathway mainly consists of PI3K protein, PIP3 protein, and AKT protein. PI3K: Phosphatidylinositol 3-kinase, is a key upstream molecule in the AKT signaling pathway. It can be activated by various extracellular signaling molecules such as growth factors and cytokines. PI3K can catalyze the conversion of phosphatidylinositol-4,5-bisphosphate (PIP2) into phosphatidylinositol-3,4,5-trisphosphate (PIP3). AKT: Also known as protein kinase B (PKB), is a serine / threonine protein kinase. When AKT binds to PIP3 through its PH domain, it is recruited to the cell membrane and then phosphorylated at threonine 308 and serine 473 sites under the action of phosphatidylinositol-dependent kinase-1 (PDK1) and mammalian target of rapamycin complex 2 (mTORC2), respectively, thus being activated.

[0133] The AKT and ERK signaling pathways play important roles in participating in malignant biological behaviors such as the proliferation and migration of malignant tumors, and their upstream is regulated by RAS kinase. The examples found that CKAP4 is regulated by the AKT and ERK signaling pathways, and by inhibiting the expression of at least one of MEK, PI3K, and AKT, the expression of CKAP4 can be decreased.

[0134] Based on this, the examples also disclose a CKAP4 inhibitor, including at least one of a compound that inhibits the expression of MEK, a compound that inhibits the expression of PI3K, and a compound that inhibits the expression of AKT.

[0135] In some examples, the compound that inhibits the expression of MEK is selected from at least one of U0126, PD 98059, SL 327, arctigenin, PD 198306, PD 334581, BIX 02189, trametinib, cobimetinib, selumetinib, binimetinib, tazemetostat.

[0136] In some examples, the compound that inhibits the expression of AKT is selected from at least one of AKT Inhibitor IV, perifosine, 10-deethylbromide vincristine hydrochloride, Akti-1 / 2, trabectedin, GSK2141795, GSK 690693, AT7867, AZD5363, MK-2206 Dihydrochloride, urolithin A, OSU 03012, WYE 687 hydrochloride, GSK2334470.

[0137] In some embodiments, the compounds that inhibit PI3K expression are selected from at least one of LY294002, PIK 90, Omipalisib, PI 103 hydrochloride, Urolithin A, LY294002 hydrochloride, A66, wortmannin, PI 828, AZD 6482, quercetin, and idelalisib.

[0138] 1. Inhibit CKAP4 alone or in combination

[0139] In some test examples, the compounds that inhibit MEK expression, the compounds that inhibit AKT expression, and the compounds that inhibit PI3K expression were co-incubated with HCC1806 cells and MDA-MB-231 cells respectively, and the expressions of pMEK, AKT, PI3K, and CKAP4 in the cells after incubation were detected. pMEK refers to phosphorylated MEK protein. MEK itself needs to be phosphorylated by the upstream RAF kinase to be activated. After receiving signal stimuli such as extracellular growth factors and cytokines, RAF kinases (such as A-RAF, B-RAF, C-RAF) will be activated and phosphorylate serine residues at specific sites on the MEK protein, and this phosphorylated MEK is pMEK.

[0140] This test example specifically includes: inoculating HCC1806 cells or MDA-MB-231 cells grown to the logarithmic growth phase into a 6-well plate at 2×10 5 cells / well. After the cells adhered, the medium was replaced with a medium containing 0.1 μM cobimetinib, or a medium containing 0.1 μM GSK2141795, or a medium containing 0.1 μM LY294002, or a medium containing both 0.1 μM cobimetinib and 0.1 μM GSK2141795, or a medium containing both 0.1 μM cobimetinib and 0.1 μM LY294002. At least 3 replicate wells were set, and a solvent control group (a medium containing only DMSO at the same concentration as the drug group) was set at the same time. After culturing the cells for another 48 hours, the medium in the culture wells was aspirated, and the cells were gently washed 2-3 times with pre-cooled PBS. Total RNA in the cells was extracted by a conventional method for RT-PCR detection of the relative expression level of CKAP4 mRNA in the cells before and after treatment. Total protein in the cells was extracted by a conventional method for WB detection of the expression levels of pMEK protein, AKT protein, PI3K protein, and CKAP4 protein in the cells before and after treatment. Among them, the primary antibody for detecting the expression level of pMEK protein was purchased from Yubo Biotech, with the product number yb0185 and a dilution ratio of 1:1000.

[0141] The primary antibody for detecting the expression level of AKT protein was purchased from Fine Biotech, with the product number FNab00271 and a dilution factor of 1:1000. The primary antibody for detecting the expression level of PI3K protein was purchased from Sigma-Aldrich, with the product number SAB5500162 and a dilution factor of 1:1000.

[0142] As Figure 17 and Figure 18 shown, any one of the compounds that inhibit MEK expression, the compounds that inhibit AKT expression, and the compounds that inhibit PI3K expression was co-incubated with HCC1806 cells or MDA-MB-231 cells respectively, and the expression levels of CKAP4 in both types of breast cancer cells decreased. This indicates that the compounds that inhibit MEK expression, the compounds that inhibit AKT expression, and the compounds that inhibit PI3K expression can all serve as MEK inhibitors for breast cancer cells.

[0143] As Figure 17 and Figure 18 shown, the combination of the compound that inhibits MEK expression and the compound that inhibits AKT expression, and the combination of the compound that inhibits MEK expression and the compound that inhibits PI3K expression were co-incubated with HCC1806 cells or MDA-MB-231 cells respectively, and the expression levels of CKAP4 in both types of breast cancer cells decreased. This indicates that the combination of the compound that inhibits MEK expression and the compound that inhibits AKT expression, and the combination of the compound that inhibits MEK expression and the compound that inhibits PI3K expression can all serve as MEK inhibitors for breast cancer cells.

[0144] 2. Dose-dependent inhibition of MEK and subsequent inhibition of CKAP4

[0145] In some test examples, the compound that inhibits MEK expression was co-incubated with HCC1806 cells and MDA-MB-231 cells, and the expressions of pMEK and CKAP4 in the cells after incubation were detected.

[0146] This test example specifically includes: HCC1806 cells or MDA-MB-231 cells that had grown to the logarithmic growth phase were seeded at 2×10 5Inoculate into a 6-well plate at a density of [number] / well. After the cells adhere, replace the medium with medium containing cobimetinib at different concentrations (such as 0 μM, 0.1 μM, 0.01 μM, 0.001 μM, and 0.0001 μM, with at least 3 replicate wells), and set up a solvent control group (medium containing only the same concentration of DMSO as the drug group). After culturing the cells for another 48 hours, aspirate the medium in the culture wells and gently wash the cells 2-3 times with pre-cooled PBS. Extract the total protein in the cells using a conventional method and perform WB to detect the expression levels of pMEK protein and CKAP4 protein in the cells before and after treatment. Among them, the primary antibody for detecting the expression level of pMEK protein was purchased from Yubo Biotech, with the catalog number yb0185 and a dilution ratio of 1:1000.

[0147] As Figure 19 shown, the compound cobimetinib, which inhibits MEK expression, was co-incubated with HCC1806 cells or MDA-MB-231 cells respectively. Not only did the expression of pMEK decrease in both breast cancer cell lines, but the expression of CKAP4 also decreased. Moreover, cobimetinib at different concentrations had different inhibitory effects on the expression levels of pMEK and CKAP4 in breast cancer cells, showing a dose-dependent relationship between the two. This further demonstrates that the compound that inhibits MEK expression can be used as a MEK inhibitor for breast cancer cells.

[0148] As described above, the above are only the preferred specific embodiments of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present application should be covered by the protection scope of the present application.

Claims

1. A CKAP4 inhibitor, comprising at least one of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, reduced L-glutathione, a protein as shown in SEQ ID NO: 5, RNA as shown in SEQ ID NO: 10 and SEQ ID NO: 11, RNA as shown in SEQ ID NO: 12 and SEQ ID NO: 13, a compound that inhibits the expression of MEK, a compound that inhibits the expression of AKT, and a compound that inhibits the expression of PI3K.

2. The CKAP4 inhibitor according to claim 1, wherein the compound that inhibits MEK expression is selected from at least one of U0126, PD 98059, SL327, arctigenin, PD 198306, PD 334581, BIX 02189, trametinib, cobimetinib, selumetinib, bimetinib, and tazemetostat; Optionally, the compound that inhibits AKT expression is selected from at least one of AKT Inhibitor IV, perifosine, 10-desethylvincristine hydrochloride, Akti-1 / 2, triciribine, GSK2141795, GSK 690693, AT7867, AZD5363, MK-2206 Dihydrochloride, urolithin A, OSU 03012, WYE 687 hydrochloride, and GSK2334470; Optionally, the compound that inhibits PI3K expression is selected from at least one of LY294002, PIK 90, Omipalisib, PI 103 hydrochloride, Urolithin A, LY294002 hydrochloride, A66, Wortmannin, PI 828, AZD 6482, Quercetin, and Idelalisib.

3. Use of at least one of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170 and reduced L-glutathione in the preparation of a CKAP4 inhibitor, wherein the binding energy of ixazomib to CKAP4 is -77.15 kcal / mol; Optionally, the binding energy between KY02111 and CKAP4 is -39.79 kcal / mol; Optionally, the binding energy of (E / Z)-CP-724714 to CKAP4 is -108.23 kcal / mol; Optionally, the binding energy between chlorogenic acid and CKAP4 is -109.8 kcal / mol; Optionally, the binding energy of ixazomib to CKAP4 is -111.28 kcal / mol; Optionally, the binding energy of the reduced L-glutathione to CKAP4 is -94.6 kcal / mol.

4. Use of a compound that inhibits MEK expression in the preparation of a CKAP4 inhibitor, wherein the compound that inhibits MEK expression is selected from at least one of U0126, PD 98059, SL 327, arctigenin, PD 198306, PD 334581, BIX 02189, trametinib, cobimetinib, selumetinib, bimetinib, and tazemetostat.

5. Use of a compound that inhibits AKT expression in the preparation of a CKAP4 inhibitor, wherein the compound that inhibits AKT expression is selected from at least one of AKT Inhibitor IV, perifosine, 10-desethylvincristine bromide hydrochloride, Akti-1 / 2, triciribine, GSK2141795, GSK 690693, AT7867, AZD5363, MK-2206 Dihydrochloride, urolithin A, OSU03012, WYE 687 hydrochloride, and GSK2334470.

6. Use of a compound that inhibits PI3K expression in the preparation of a CKAP4 inhibitor, wherein the compound that inhibits PI3K expression is selected from at least one of LY294002, PIK 90, Omipalisib, PI 103 hydrochloride, UrolithinA, LY294002 hydrochloride, A66, wortmannin, PI 828, AZD 6482, quercetin, and idelalisib.

7. Use of the protein shown in SEQ ID NO: 5, the RNA shown in SEQ ID NO: 10 and SEQ ID NO: 11, and the RNA shown in SEQ ID NO: 12 and SEQ ID NO: 13 in the preparation of CKAP4 inhibitors.

8. A breast cancer drug, comprising at least one of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, reduced L-glutathione, the protein shown in SEQ ID NO: 5, the RNA shown in SEQ ID NO: 10 and SEQ ID NO: 11, the RNA shown in SEQ ID NO: 12 and SEQ ID NO: 13, a compound that inhibits the expression of MEK, a compound that inhibits the expression of PI3K, and a compound that inhibits the expression of AKT.

9. The breast cancer drug according to claim 8, wherein the compound that inhibits MEK expression is selected from at least one of U0126, PD98059, SL 327, arctigenin, PD 198306, PD 334581, BIX 02189, trametinib, cobimetinib, selumetinib, bimetinib, and tazemetostat; The compound inhibiting AKT expression is selected from at least one of AKT Inhibitor IV, perifosine, 10-deethylvincristine hydrochloride, Akti-1 / 2, triciribine, GSK2141795, GSK 690693, AT7867, AZD5363, MK-2206 Dihydrochloride, urolithin A, OSU 03012, WYE 687 hydrochloride, and GSK2334470; The compound that inhibits PI3K expression is selected from at least one of LY294002, PIK 90, Omipalisib, PI 103 hydrochloride, UrolithinA, LY294002 hydrochloride, A66, wortmannin, PI 828, AZD 6482, quercetin, and idelalisib.

10. Use of at least one of ixazomib, KY02111, (E / Z)-CP-724714, chlorogenic acid, MDL-28170, reduced L-glutathione, the protein shown in SEQ ID NO: 5, the RNA shown in SEQ ID NO: 10 and SEQ ID NO: 11, the RNA shown in SEQ ID NO: 12 and SEQ ID NO: 13, a compound that inhibits the expression of MEK, a compound that inhibits the expression of PI3K, and a compound that inhibits the expression of AKT in the preparation of a breast cancer drug.