Application of GOLGA7 in preparation of medicine for treating NRAS mutation positive tumor

Abstract

The invention relates to the technical field of biological medicines, and provides application of a GOLGA7 inhibitor in preparation of a medicine for treating NRAS mutation positive tumors. The medicine disclosed by the invention takes the GOLGA7 gene as a target spot, and particularly utilizes a CRISPR / Cas9 gene editing technology or an RNAi interference technology to knock out or silence biological functions of the targeted GOLGA7 gene. The single guide RNA (sgRNA) and short hairpin RNA (shRNA) of the GOLGA7 gene provided by the invention can inhibit the expression level or activity of the GOLGA7 protein, so that the transport of NRAS mutant protein from Golgi apparatus to a cytoplasmic membrane is inhibited, the proliferation of NRAS mutation positive tumor cells is further inhibited, and the result is well verified in human and mouse tumor models. The gene is used as a target to develop a targeted intervention drug, and is expected to be applied to treatment of NRAS mutation positive tumors including hematologic tumors including leukemia, melanoma, intestinal cancer and the like.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technologies, and relates to the use of GOLGA7 as a molecular marker in the treatment of NRAS mutation-positive tumors. Specifically, it relates to the use of GOLGA7 inhibitors in the preparation of therapeutic drugs for NRAS mutation-positive tumors. Further, it relates to the use of GOLGA7 gene single-guide RNAs (sgRNAs) and short hairpin RNAs (shRNAs) that knock out or inhibit the GOLGA7 gene in the preparation of biotherapeutic drugs against NRAS mutation-positive tumors, especially in hematological tumors. Background Art

[0002] Activating mutations in RAS proteins are one of the major mutant proteins driving human tumorigenesis and are present in approximately 25% of human malignancies. The three human RAS genes encode four proteins in total: HRAS, NRAS, and the KRAS splice variants KRAS4A and KRAS4B. Each of the four RAS proteins is a member of the small GTPase superfamily. Mutations in RAS cause RAS to remain in an activated state bound to GTP. RAS activates several downstream effector pathways such as the mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K) pathways, leading to abnormal cell proliferation and further causing the occurrence of diseases. Despite the important role of RAS proteins, therapies targeting these mutant RAS proteins are significantly lacking. Even 10 years ago, RAS inhibitors remained elusive, so RAS was called an "undruggable" target. The reasons for this are closely related to the extremely high affinity of RAS for GTP, the lack of a pocket suitable for traditional small molecule binding in its protein structure, and the mutual compensation of downstream complex pathways. Therefore, finding other targets or pathways that inhibit RAS tumor growth signals is crucial for the treatment of RAS-related tumors.

[0003] NRAS gene mutations are present in approximately 10% of patients with hematological tumors. The most common mutant form is a point mutation from glycine (G) to aspartic acid residue (D) at codon 12 (more than 50%), namely NRAS G12D. Palmitoylation modification is necessary for the upstream maturation pathway of mutant NRAS proteins and directly affects their plasma membrane localization and biological functions of signal transduction. Previous studies have shown that the palmitoyltransferase ZDHHC9 and the Golgi protein GOLGA7 (GolginA7, also known as GCP16) form a complex in yeast and eukaryotic cells to promote NRAS palmitoylation. Our research shows that inhibiting Zdhhc9 can delay the occurrence and development of NRAS-induced leukemia. Therefore, we have conducted a systematic study on GOLGA7 knockout or knockdown in NRAS mutation-positive leukemia and solid tumors. Summary of the Invention

[0004] The object of the present invention is to provide the use of a GOLGA7 inhibitor based on gene expression regulation in the treatment of NRAS mutation-positive tumors. The second object of the present invention is to provide a therapeutic drug for NRAS mutation-positive tumors.

[0005] The present invention systematically studied the role and mechanism of GOLGA7 in NRAS-driven leukemia, and searched for key molecules that may become NRAS targets. Based on the RAS-specific cell activity screening system established by the research group in the early stage, it was confirmed that knocking out GOLGA7 could selectively inhibit the proliferation, apoptosis and differentiation of mutant NRAS-dependent cells and the related downstream signaling pathways of NRAS. Further mechanism studies found that GOLGA7 only specifically inhibited the plasma membrane localization of NRAS, but had no significant effect on the plasma membrane localization of HRAS, KRAS4A and KRAS4B. Through immunofluorescence experiments, we found that GOLGA7 mainly blocked NRAS at the cis face and the middle layer of the Golgi apparatus, and this localization change was independent of whether NRAS was mutated, the mutation site or the amino acid after mutation, indicating that the localization regulation of GOLGA7 on NRAS was applicable to NRAS activation-related tumors.

[0006] Previous studies have shown that GOLGA7 is an important molecule involved in the palmitoylation of NRAS, and the palmitoylation of NRAS is a necessary condition for its plasma membrane localization. Therefore, we first detected the change in the palmitoylation level of NRAS in cells after knocking out GOLGA7. Interestingly, taking cells with mutated palmitoylation sites as controls, knocking out GOLGA7 had no obvious effect on the palmitoylation level of NRAS, indicating that GOLGA7 specifically affects the plasma membrane localization of NRAS through a non-palmitoylation pathway. Therefore, we speculate that GOLGA7 may interfere with the normal membrane localization of NRAS by affecting the transport process of NRAS from the Golgi apparatus to the plasma membrane. Using fluorescence recovery after photobleaching technology and photoactivation experiments, we confirmed that GOLGA7 affected the anterograde transport process of NRAS from the Golgi apparatus to the plasma membrane, thus affecting the plasma membrane localization and tumor transformation ability of NRAS. Based on the above results, we can conclude that GOLGA7 affects the normal membrane localization of NRAS by affecting the anterograde transport of NRAS from the Golgi apparatus to the plasma membrane, inhibits the downstream signal transduction of NRAS, and this effect is independent of palmitoylation. This discovery fills the gap in the current research on the function of GOLGA7, emphasizes the highly selective inhibitory effect of GOLGA7 on NRAS, and suggests that GOLGA7 or its transport-related molecules may be effective therapeutic targets for NRAS-related tumors.

[0007] Based on the above research, the specific technical solution of the present invention is as follows:

[0008] In the first aspect of the present invention, there is provided the use of a GOLGA7 inhibitor in the preparation of a therapeutic drug for NRAS mutant-positive tumors.

[0009] The subjects targeted by the drugs of the present invention are selected from the following groups: hematological tumors mainly including leukemia, myeloma, lymphoma, and also including solid tumors such as melanoma and colorectal cancer, all of which belong to NRAS mutant malignancies.

[0010] Preferably, GOLGA7 is selected from any one of the following substances: the GOLGA7 gene, the mRNA or cDNA of GOLGA7, the GOLGA7 protein, or an active or signature fragment of any one of the foregoing.

[0011] Furthermore, the GOLGA7 is a molecule comprising the following sequences:

[0012] (a) A GOLGA7 molecule having the sequence shown in SEQ ID NO.1;

[0013] (b) A molecule that hybridizes with the sequence defined in (a) under stringent conditions;

[0014] (c) A GOLGA7 molecule having a sequence homology of more than 70% (such as 75%, 80%, 85%, 90%, 95%, 98%, 99%, more than 99.5%, or any value or value range therebetween) with the sequence in (a) or (b) and the encoded polypeptide or protein having the ability to affect the plasma membrane localization of NRAS and its tumor transformation ability, such as a GOLGA7 molecule obtained by codon optimization;

[0015] (d) A polypeptide encoded by any of the above-mentioned GOLGA7 molecules, or a derivative protein in which one or several amino acids are substituted, deleted, or added in the polypeptide.

[0016] As used herein, the term "stringent conditions" refers to: (1) hybridization and washing at low ionic strength and high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) adding a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 50%, preferably more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, or more than 90%, and more preferably more than 95%. For example, the sequence may be a complementary sequence of the sequence defined in (a).

[0017] Preferably, the GOLGA7 inhibitor is selected from any one of the following substances: a substance that reduces the expression level of GOLGA7, reduces the activity of GOLGA7, or promotes the metabolism of GOLGA7. For example, the GOLGA7 inhibitor includes any one of sgRNA of GOLGA7 and Crisper-CAS9 mRNA, small interfering RNA molecule, short hairpin RNA, and antisense nucleotide, or a nanoparticle, virus vector, PEG-modified protein, protein microsphere, liposome, or extracellular vesicle carrying any one of the above substances.

[0018] In the specific embodiments of the present invention, the GOLGA7 inhibitor selected is 3 sgGOLGA7 designed based on the CRISPR / Cas9 gene editing technology required for GOLGA7 gene knockout, or 3 GOLGA7 shRNA or siRNA.

[0019] Among them, the nucleotide sequence of sgGOLGA7 is shown as follows:

[0020] a) 5’-CACCGACTCGCAGTCCTCGCTCAAT-3’ (SEQ ID NO.2);

[0021] b) 5’-CACCGCTGACAGACCCTATTGAGCG-3’ (SEQ ID NO.3);

[0022] c) 5’-CACCGACCCGGTTCTCCAGCTCCGC-3’ (SEQ ID NO.4),

[0023] The nucleotide sequence of GOLGA7 shRNA / siRNA is shown as follows:

[0024] a) 5’-GCAGCAGTTTGAAGAAACATT-3’ (SEQ ID NO.5);

[0025] b) 5’-CCGGAAAGGTGTTCATTCATT-3’ (SEQ ID NO.6);

[0026] c) 5’-GGTTGTTTGGCTTGTTTAATT-3’ (SEQ ID NO.7).

[0027] It should be understood that the GOLGA7 molecules of the present invention are preferably obtained from humans, and other GOLGA7 molecules obtained from other animals that are highly homologous to human GOLGA7 (such as having a sequence identity of more than 70%, more than 75%, more than 80%, more preferably more than 85% such as 85%, 90%, 95%, 98% or even 99% or more) are also within the equivalent scope preferably considered in the present invention. Methods and tools for comparing sequence identity are also well-known in the art, such as BLAST.

[0028] In terms of source, the inhibitors of the present invention are selected from: natural purified substances, modified natural purified substances, semi-synthetic substances, chemically synthesized substances; further, the inhibitors are derived from mammals, such as humans, non-human primates (such as orangutans, apes), rodents (such as rats, mice, guinea pigs), pets (such as cats, dogs), livestock (such as horses, cows, sheep, pigs, rabbits).

[0029] In a second aspect of the present invention, there is provided a recombinant vector of a GOLGA7 inhibitor, comprising an expression vector and a sgRNA of GOLGA7, Crisper-CAS9 mRNA, GOLGA7 siRNA, GOLGA7 shRNA or STRIP antisense nucleotides inserted and provided on the expression vector.

[0030] Among them, the sequences of the sgRNA of GOLGA7 and the shRNA / siRNA are as shown above.

[0031] In a third aspect of the present invention, there is provided the use of the above recombinant vector of a GOLGA7 inhibitor in the preparation of a therapeutic drug for NRAS mutant-positive tumors.

[0032] In a fourth aspect of the present invention, there is provided a therapeutic drug composition for NRAS mutant-positive tumors, comprising an active ingredient and a pharmaceutically / immunologically acceptable excipient, carrier or diluent. Among them, the active ingredient is the above GOLGA7 inhibitor or the recombinant vector of a GOLGA7 inhibitor.

[0033] Preferably, the drug composition is used in combination with other anti-tumor active ingredients. Tumor treatment includes but is not limited to: surgery, radiotherapy, chemotherapy, immunotherapy, preferably chemotherapy.

[0034] The term "pharmaceutically / immunologically acceptable" ingredient is a substance that is applicable to humans and / or animals without excessive adverse side effects (such as toxicity, irritation and allergic reactions), that is, a substance with a reasonable benefit / risk ratio. As used herein, the term "effective amount" refers to an amount that can produce a function or activity in humans and / or animals and can be accepted by humans and / or animals.

[0035] The term "pharmaceutically acceptable carrier" refers to a carrier for the administration of a therapeutic agent, including various excipients and diluents. The term refers to those pharmaceutical carriers that are not themselves essential active ingredients and that are not unduly toxic when administered. Suitable carriers are well known to those of ordinary skill in the art. A thorough discussion of pharmaceutically acceptable excipients can be found in Remington’s Pharmaceutical Sciences, Mack Pub. Co., N.J. 1991.

[0036] In the compositions, the pharmaceutically acceptable carrier may contain liquids such as water, saline, glycerol, and ethanol. Additionally, auxiliary substances may be present in these carriers, such as fillers, disintegrants, lubricants, glidants, effervescent agents, wetting or emulsifying agents, flavoring agents, pH buffering substances, etc. Generally, these substances can be formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, where the pH is typically about 5 - 8, and preferably, the pH is about 6 - 8.

[0037] The active substance in the compositions of the present invention accounts for 0.001 - 99.9 wt% of the total weight of the composition; preferably 1 - 95 wt% of the total weight of the composition, more preferably 5 - 90 wt%, still more preferably 10 - 80 wt%, and the balance is a pharmaceutically acceptable carrier and other additives and the like.

[0038] The composition of the present invention can be in solid state (such as granule, tablet, lyophilized powder, suppository, capsule, sublingual tablet), liquid state (such as oral liquid) or other suitable forms. The administration routes can be: (1) direct naked DNA / RNA injection method; (2) connecting the GOLGA7 molecule-related sgRNA, CRISPR-Cas9 mRNA with transferrin / poly-L-lysine complex to enhance its biological effect; (3) forming a complex of GOLGA7 sgRNA and CRISPR-Cas9 mRNA with positively charged lipids to overcome the difficulty of crossing cell membranes caused by the negative charge of the phosphate backbone; (4) mediating the entry of GOLGA7 sgRNA and CRISPR-Cas9 mRNA into cells after encapsulating them with liposomes, which is beneficial for the smooth entry of macromolecules and protects them from hydrolysis by various extracellular enzymes; (5) binding GOLGA7 sgRNA and CRISPR-Cas9 mRNA with cholesterol to increase the cytoplasmic retention time by 10 times; (6) specifically transporting GOLGA7 sgRNA and CRISPR-Cas9 mRNA to target tissues and target cells by using immunoliposomes; (7) in vitro transfecting GOLGA7 sgRNA and CRISPR-Cas9 mRNA into carrier cells (such as fibroblasts) can also load related drugs into target cells well; (8) electroporation, that is, introducing GOLGA7 sgRNA and CRISPR-Cas9 mRNA into target cells by means of electric current.

[0039] As used in the present invention, the term "unit dosage form" refers to a dosage form prepared from the composition of the present invention for convenient administration, which is the dosage form required for single administration, including but not limited to various solid forms (such as tablets), liquid forms, capsules, sustained-release forms.

[0040] In some embodiments of the present invention, the composition is in unit dosage form or multiple dosage forms. "Unit dosage form" refers to a dosage form prepared from the product for convenient administration, which is the dosage form required for single administration, including but not limited to various solid forms (such as tablets), liquid forms, capsules, sustained-release forms. In some embodiments herein, the composition herein is administered at an appropriate frequency, for example, daily, every other day, weekly, every other week or two weeks, monthly, every other month or two months, for example, 1 to 6 doses are administered.

[0041] It should be understood that the effective dose of the active substance used can vary with the severity of the subject to be administered or treated. The specific situation is determined according to the individual situation of the subject (such as the subject's weight, age, physical condition, the effect to be achieved), which is within the scope that can be judged by a skilled physician.

[0042] The administration methods of the present invention are diverse, including oral administration, injection (such as direct naked DNA or protein injection, liposome-encapsulated DNA, RNA or protein injection), gold-coated gene gun bombardment, plasmid DNA carried by replication-deficient bacteria, target DNA carried by replication-deficient adenovirus or the protein encoded by the target gene, electroporation, intravenous, pulmonary, mucosal, nasal, intraperitoneal, intracranial, intratumoral, sublingual, buccal, and transdermal administration.

[0043] In the fifth aspect of the present invention, a method for anti-tumor is provided, including administering a therapeutically effective amount of GOLGA7 sgRNA or shRNA to a subject in need. Preferably, other anti-tumor drugs are administered before, during, or after administering the GOLGA7 inhibitor of the present application.

[0044] The beneficial guarantees and effects of the present invention are as follows:

[0045] The present invention targets the GOLGA7 gene and particularly uses the CRISPR / Cas9 gene editing technology or RNAi interference technology to knockout or silence the biological function of the GOLGA7 gene. The single-guide RNA (sgRNA) and short hairpin RNA (shRNA) of the GOLGA7 gene provided by the present invention can inhibit the expression level or activity of the GOLGA7 protein, thereby inhibiting the transport of the NRAS mutant protein from the Golgi apparatus to the cytoplasmic membrane, and further inhibiting the proliferation of NRAS mutant-positive tumor cells. This result has been well verified in both human and mouse tumor models. Developing targeted intervention drugs targeting this gene is expected to be applied to the treatment of NRAS mutant-positive tumors including hematological tumors such as leukemia, melanoma, and colorectal cancer, and also provides a new treatment idea for the treatment of such tumors. Brief Description of the Drawings

[0046] Figure 1 It shows that GOLGA7 knockout selectively inhibits the proliferation and signal transduction of NRAS mutant tumor cells.

[0047] Figure 2 It shows that GOLGA7 knockout selectively inhibits the plasma membrane localization of the NRAS G12D mutant protein in humans: taking human HeLa cells as an example, GOLGA7 knockout selectively inhibits the transport of the GFP-fused NRAS G12D mutant protein to the plasma membrane localization, but does not inhibit the plasma membrane localization of the GFP-fused KRAS G12D mutant protein.

[0048] Figure 3Shown is that Golga7 knockout selectively inhibits the proliferation of mouse Ba / F3-N cells transformed by NRAS G12D: In mouse Ba / F3 cells, Golga7 knockout selectively inhibits the proliferation of cells transformed by NRAS G12D mutation (Ba / F3-N cells), but has no effect on KRAS G12D mutation.

[0049] Figure 4 Shown is that Golga7 knockout selectively inhibits the plasma membrane localization of NRAS G12D mutant protein in mouse cells: In mouse Ba / F3 cells, Golga7 knockout selectively inhibits the plasma membrane localization of GFP-fused NRAS G12D mutant protein in Ba / F3-N cells.

[0050] Figure 5 Shown is the knockout strategy of GOLGA7 when constructing Golga7 gene knockout mice.

[0051] Figure 6 Shown is that global knockout of the Golga7 gene in embryos causes mouse death, while inducible global knockout at the adult stage shows no significant abnormal phenotypes: Global knockout of the Golga7 gene in embryos (Golga7 fl / fl; EIIA-Cre) causes head bleeding and death of mice at the E12.5-14.5 stage, while inducible global knockout at the adult stage (Golga7 fl / fl; UBC-CreERT) shows no significant abnormal phenotypes.

[0052] Figure 7 Shown is that Golga7 knockout significantly inhibits Nras G12D / G12D Transgenic mouse leukemia development: Hematopoietic system-specific conditional knockout of Golga7 (Golga7 fl / fl; Mx1-Cre) can significantly inhibit the development of chronic myelomonocytic leukemia driven by homozygous NRAS G12D mutation.

[0053] Figure 8 Shown is that Golga7 knockout significantly inhibits the disease progression of mouse leukemia. Detailed implementation methods

[0054] The present invention uses CRISPR / Cas9 gene editing technology and RNAi gene interference silencing technology to target the GOLGA7 gene of humans or mice to construct specific gene knockout or knockdown cell or animal models, so as to verify the effects and functions of interfering with the expression of the GOLGA7 gene on the malignant growth of NRAS mutant leukemia or solid tumors.

[0055] All reagents and raw materials used in the present invention are commercially available or can be prepared according to the methods described in the literature. For the experimental methods without specific conditions noted in the following examples, they are generally carried out under conventional conditions such as those described in Sambrook et al., "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory Press, 1989), or under conventional conditions, or under the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by volume.

[0056] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to persons skilled in the art. In addition, any methods and materials similar or equivalent to those described may be applied to the present application. The preferred methods and materials described herein are for illustrative purposes only.

[0057] Example 1 Effects and functions of knocking out the GOLGA7 gene in human cells on NRAS mutation-positive cells

[0058] The NCBI Gene ID of the human GOLGA7 gene is 51125, and the mRNA transcript number is NM_001002296.2. The sequence is shown as follows (SEQ ID NO.1):

[0059]

[0060] I. Construction of sgRNA Plasmid and Cell Line Targeting GOLGA7

[0061] Design of sgRNA targeting the human GOLGA7 gene sequence: The gene sequence of human GOLGA7 was determined using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). The sgRNA of the GOLGA7 gene was designed using http: / / crispr.mit.edu / .

[0062] The design principles of sgRNA are as follows:

[0063] ① The designed sgRNA sequence should avoid ending with more than 4 Ts, and the GC% content is preferably 40%-60%; ② Design its complementary strand using the sgRNA sequence as the template strand; ③ The length of sgRNA is generally 20 nt; ④ The sequence of sgRNA should have as high a matching number with On-target and Off-target as possible, generally greater than 60.

[0064] The primer sequences of the Scramble sequence for negative control and 3 pairs of sgRNA primers targeting GOLGA7 are shown in Table 1 below:

[0065] Table 1 Primer sequences of the Scramble sequence for negative control and 3 pairs of sgRNA primers targeting GOLGA7

[0066]

[0067] Construction of recombinant plasmid: The Cas9-expressing lentiviral vector LentiCas9-Blast (#52962) and the sgRNA-expressing lentiviral vector lentiGuide-Puro (#52963) were both purchased from the Addgene plasmid library. The designed sgRNA was cloned onto the lentiGuide-Puro plasmid to form a recombinant plasmid according to the aforementioned method. Specifically as follows:

[0068] 1. Establishment of the stable GOLGA7 knockout strain by sgRNA:

[0069] (a) Establishment of Cas9-expressing cell line: The Cas9 targeting system used in this study is a binary vector system. After transfection with LentiCas9-Blast, it needs to be used in combination with the second vector, lentiGuide-Puro, which delivers sgRNA. Due to the cytotoxicity of Cas9 expression, when cells are infected with LentiCas9-Blast, this toxicity may affect cell growth, resulting in changes in the growth rate. To prevent this growth effect from interfering with the experimental results, it is necessary to first establish a monoclonal Cas9-expressing cell line. Therefore, cells are first infected with LentiCas9-Blast according to the aforementioned method, and then positive cells are screened using Geneticin (G418) at a final concentration of 100 μg / mL - 1 mg / mL.

[0070] (b) Establishment of stable sgRNA knockout GOLGA7 cell line and monoclonal screening: On the basis of the stable Cas9-expressing cell line, cells are infected with sgSCR and sgGOLGA7 viruses respectively, and then positive cells are screened using puromycin according to the aforementioned method. Single-cell screening is carried out in a 96-well plate using the limiting dilution method: cells are serially diluted to obtain a cell suspension with a cell density of 5 cells / mL. After thorough mixing, the cell suspension is inoculated into a 96-well plate, 100 μL per well, and a total of 4 96-well plates are inoculated. After 24 hours, observation is carried out under a light microscope, and small wells with only single cells are picked out and labeled. After the single-cell wells in the 96-well plate grow to confluence, they are transferred to a 24-well plate for continued culture, and further subcultured and amplified. A part of the cells is picked for Western Blot experiment to verify the knockout effect of the target gene GOLGA7.

[0071] II. Construction of RNAi GOLGA7 lentiviral plasmid and cell line

[0072] The RNAi lentiviral vector plasmid pLKO.1 (#10878) was purchased from the Addgene plasmid library (https: / / www.addgene.org / ). The Scrambled shRNA primers for negative control and 3 pairs of shRNA primers targeting GOLGA7 were designed and synthesized by Shanghai GenePharma Co., Ltd. Their sequences are shown in Table 2 below:

[0073] Table 2 Sequences of Scrambled shRNA primers for negative control and 3 pairs of shRNA primers targeting GOLGA7

[0074]

[0075] In this invention, stable cell lines with knocked-down GOLGA7 were established using shRNA in human leukemia cells such as THP-1 cells, OCI-AML3 cells, and HL60 cells.

[0076] 1) Establishment of stable cell lines with shRNA targeting GOLGA7:

[0077] a) Virus infection: Seed the cells to be infected in a six-well plate at an appropriate density. Add 1 mL of freshly collected virus supernatant, and then add polybrene to a final concentration of 8 μg / mL. Gently shake to mix well. After balancing, centrifuge at 33 °C and 1200 g for 90 minutes, and then continue to culture in a 37 °C incubator. Replace with complete medium 4 - 6 hours later.

[0078] b) Screening of positive cells with puromycin: i. Determine the optimal screening concentration of puromycin for different cells: Seed untransfected cells in a six-well plate at an appropriate density and culture routinely. Add puromycin at final concentrations of 0.5 μg / mL, 1 μg / mL, 1.5 μg / mL, 2 μg / mL, 2.5 μg / mL, and 3 μg / mL respectively. After culturing for two weeks, determine the lowest concentration that can kill all untransfected cells, which is the screening concentration.

[0079] 2) Screening of stable cell lines:

[0080] Replace the medium of the cells 48 hours after infection with fresh complete medium, and add puromycin to a final concentration of the optimal screening concentration, and continue to culture. Observe the cell status every two days thereafter, and continue to add puromycin for screening during each passage. After continuous screening for 14 days, it can be considered that the content of positive cells is higher than 99%. At this time, take a part of the cells to extract proteins and perform Western Blot experiments to detect the knockdown efficiency of the target gene GOLGA7.

[0081] III. Selective inhibitory effect of GOLGA7 knockdown on NRAS mutant-related tumor cells

[0082] To observe the effect of GOLGA7 knockout on NRAS signaling in tumor cells with a more complex background, we used shRNA or siRNA to silence GOLGA7 in a series of leukemia cells and other tumor cells with NRAS mutations, and selected tumor cells carrying other RAS mutations or wild-type RAS as controls.

[0083] After knocking down GOLGA7, the proliferation of NRAS-mutated leukemia cells HL-60 (NRAS Q61L), THP-1 (NRAS G12D), OCI-AML3 (NRAS Q61L), melanoma cells SK-MEL-2 (NRAS Q61R), and hepatoma cells HepG2 (NRAS Q61L) was significantly inhibited, while the proliferation of leukemia cells MOLM13 and melanoma cells SK-MEL-30 carrying wild-type RAS, leukemia cells NB4 (KRAS A18D) carrying KRAS mutation, and bladder cancer cells T24 (HRAS G12V) carrying HRAS mutation was not affected by GOLGA7 silencing ( Figure 1 A and 1B).

[0084] Similar to the results of proliferation, Western blot detection of the main molecules in the NRAS downstream signaling pathway in these cells also found that after knocking down GOLGA7, compared with the control group, the phosphorylation levels of AKT, ERK, and S6 in NRAS-mutated tumor cells were significantly decreased ( Figure 1 C), indicating that the signal transduction of the main downstream pathway of NRAS was significantly inhibited. There were no obvious changes in other RAS-mutated or wild-type RAS-carrying cells. The above results indicate that in tumor cell lines, silencing of GOLGA7 also has a selective inhibitory effect on NRAS-dependent cells.

[0085] IV. Deletion of GOLGA7 selectively inhibits the plasma membrane localization of NRAS mutant proteins.

[0086] To study the specific functional effects of GOLGA7 on NRAS protein, the HeLa cell line transfected with NRAS G12D / KRAS G12D was stably knocked out of GOLGA7 using the CRISPR / Cas9 technique. Fluorescence staining ( Figure 2 A) and electrophoresis ( Figure 2 B) results showed that in HeLa cells, it was clearly observed that after knocking out GOLGA7, the GFP-fused NRAS G12D mutant protein could not be localized to the cell membrane, but had no obvious effect on the membrane localization of the same-family KRAS G12D mutant protein. Therefore, we reasonably speculate that GOLGA7 specifically affects the function of the NRAS G12D mutant protein by influencing the vesicle trafficking pathway mediated by palmitoylation modification of the NRAS G12D mutant protein.

[0087] Example 2: Effects and functions of knocking out the Golga7 gene in mouse cells or animals on NRAS mutant-positive leukemia transformation

[0088] The Gene ID of mouse Golga7: 57437, mRNA transcript number: NM_001042484.1, sequence as SEQ

[0089] As shown in ID NO.18:

[0090] gcgacaggac gtaagcggcg acggaggtgg cgcgacagct gctggagggccgaggaggcggagcggcggg tcctgtcctc gccatgaggc cgcagcaggc accggtgtccgggaaggtgttcattcagcg agactacagc agcggcacgc gctgccagttccagaccaagttccccgcggagctggagaa caggattgac agacagcagt ttgaagaaac agttcgaact ctaaataatc tttatgcagaagcagagaaa cttgggggcc agtcgtatct tgaaggctgt ttggcttgtt taacagcata caccatcttcttatgcatgg aaactcatta tgagaaggtc ttgaagaaag tctccaaata cattcaagaa cagaatgagaagatatatgc tccccaaggc ctcctcctaacagaccccattgagagaggacttcgagttattgaaatcaccatctatgaagacagaggtg tgagcagtgg aagataaacc acagagttac aggtcctgcc tccagctgggaccttcgtct atccactggc cgatggcaga gtgtccctac ctcctctcca gagcgttatt ctcttgtctctgctgccaga gccacggtgc cacacctgga gtgaccgctc gtcactcagc atccactttg tctcccagttgtgtaggact ctgtgatctt ttgatttgtt tccaagaaaa taaaggaagc aattctcttt ataaattcaaagccatttaa aacacaggca gttggccagc ccaagacaga gtcgttttct taccagatac cagtgtcactggttctcctt gtcccttggg tcagtttcct aggtggcttt atgatcccac aagtcatgtc ttagctcagtccctccccca gattagtagc aggctttgag ggtgtgtgtg cctgtggtccggctgacccg ccgcccgagtccccaagcta ccagccttga cgtgcttcag atcttcagat tggtttctgc tgttcaattt cagaggctccttgagagaat aatatatgtt acttgtttta gtgttgcagt tattattaag gcagtattta tgcaattccggttgtttctt tgaaagcagt tctgttaatg tgcattacct cgagatgttg gggagatgtt gtgtgtgttgcttgttcatt ccacagataa gtaagcacaa tgagcagacc ctcagccatc agctccacct gccccagctctgcccggtgt ggaagaagca agtgtcctaa gcacctaact ctagttttgt tacaagtata acttaggagaaaaaattggt agaaataata cagtatgttg ctaatttgta acctacttta aactctgatt tatagcctcacatacagtattcagggcaca gaaatctttt gattgactca agtaagtttt ggcttccgtg taacttcaagttaaagttaa tttttttcag ctcttcttta tctctatact ctcttagtat cggaatttcttatgttcttttaggaatttg agagcactgt gtttgggaga agttaggaaa cataaggaatgaatgaagca gttgaacttggagatactgt aggtgctaat actggatcta atctttcaga tttaatttgt tttctgggcc ttgtagttactcagtaaacc ccttagatct gtgtaataat ttaattgtat aacgctcatt tgttccttta aagcctattctagtctgtct gccttttaaa cttgttgcaa taatgtcgcc aagatataaa cacattagta aaacttttcttaaataaacc ctctcttgtc ttagtcta

[0091] I. Construction of Golga7 gene knockout mouse Ba / F3 cells

[0092] Using the mouse cell lines Ba / F3, 3T3 cell line, Ba / F3-N cells, and Ba / F3-K cells, stable cell lines with sgRNA-mediated knockout of Golga7 were established.

[0093] 1. Golga7 selectively regulates the proliferation of NRAS G12D-transformed cells Ba / F3-N

[0094] To investigate the role of Golga7 in NRAS, we examined the effect of Golga7 deletion on the transforming ability of mutant NRAS. First, stable cell lines with knockout of Golga7 in Ba / F3-N (Ba / F3 cells transformed with NRAS G12D) and Ba / F3-K (Ba / F3 cells transformed with KRAS G12D) were established. First, the effect of GOLGA7 deletion on cell proliferation was detected by live cell counting and cell viability assay. With the same initial cell seeding number, the total cell number was counted every two days after withdrawing IL-3. It was found that after withdrawing IL-3, the number of GOLGA7-knockout Ba / F3-N cells was significantly reduced compared with the control group, and its total cell number was only 1 / 5 of the control group on the 8th day. The cell proliferation rates among the three different sgRNA groups were relatively consistent, and only the GOLGA7-sg2 group had a slight decrease, ruling out the inhibition of cell proliferation caused by off-target effects of sgRNA. In contrast, the silencing of GOLGA7 had no obvious effect on the proliferation of BaF3-K cells ( Figure 3 A). The CellTiter-Glo reagent was used to detect the ATP level produced by cells to reflect the proliferation viability of mutant RAS-transformed Ba / F3 cells. Similarly, it was found that 48 hours after withdrawing IL-3 from the same number of cells in each group, the viability of BaF3-N cells with knockout of GOLGA7 decreased significantly compared with the control group, while the viability of BaF3-K cells was basically not affected by the presence or absence of GOLGA7 ( Figure 3 B).

[0095] 2. Golga7 deletion selectively inhibits the plasma membrane localization of NRAS mutant protein.

[0096] Similarly, to investigate the specific function of Golga7 in mouse cells, we clearly observed in Ba / F3-N cells with knockout of Golga7 using the CRISPR / Cas9 technique that GFP-fused NRAS was also unable to localize to the cell membrane (labeled with Na+ / K+-ATPase) ( Figure 4A and 4B). This shows that mice and humans have similarities in the mechanism of Golga7-mediated vesicular transport of NRAS mutant proteins, suggesting that in mouse Ba / F3 cells, Golga7 knockout specifically inhibits the localization of GFP-fused NRAS G12D mutant proteins in the cytoplasmic membrane in Ba / F3-N cells.

[0097] 2. Construction of Golga7 knockout mice

[0098] 1. Knockout process

[0099] Target and vector construction: Using CRISPR / Cas9 technology, design and construct sgRNA targeting the target gene, and transcribe Cas9 mRNA in vitro; construct a Donor with a homology arm of loxp.

[0100] Golga7 has 4 coding regions, all of which are 3N coding regions. Only exon1 (111bp, highlighted in yellow) where the start codon ATG is located can be used as the flox region. Target sites are designed for cutting in the intron regions on both sides of exon1, and donors are constructed. Through the principle of homologous recombination, loxp sites are site-specifically integrated into the non-coding region about 50bp upstream of exon1 and the intron about 100-200bp downstream. However, loxp insertion upstream of exon1 may destroy the promoter region. The strategy diagram is shown in the figure below. Figure 5 As shown.

[0101] 2. GuideRNA sequence information:

[0102] Golga7-sgRNA-L1:TGCCCGAACTCGCAGAGCGGCGG (SEQ ID NO. 19);

[0103] Golga 7-sgRNA-L2: CCGAACTCGCAGAGCGGCGGGTC (SEQ ID NO. 20);

[0104] RE:GACCCGCCGCTCTGCGAGTTCGG(SEQ ID NO.21);

[0105] Golga 7-sgRNA-R1:tcatgggaaaagatatacgaagg (SEQ ID NO. 22);

[0106] Golga 7-sgRNA-R2:aaagatatacgaaggaggtacgg (SEQ ID NO. 23).

[0107] To comprehensively understand the biological functions and roles of GOLGA7, while analyzing the role of GOLGA7 in mediating the vesicular transport and tumor transformation of NRAS mutant proteins at the in vitro level, we also studied the physiological functions and roles of Gogla7 at the whole animal level. We found that global knockout of Golga7 (Golga7 fl / fl; EIIA-Cre) in mice led to embryonic lethality (E12.5-E14.5), accompanied by a bleeding phenotype in the head and spinal cord regions ( Figure 6 ). As Figure 6 shown in A, bleeding could be observed in the heads and some spinal cord regions of Golga7- / - embryos at E13.5 and E14.5, but the bleeding was not severe. Some Golga7- / - embryos even had no bleeding phenotype, and some Golga7- / - embryos showed a smaller embryonic volume. In addition, we also noticed that Golga7- / - embryos had abnormal phenotypes such as pale fetal livers and impaired primitive hematopoiesis. At the same time, we used UBC-CreERT mice to study the biological effects and target safety of adult-induced global knockout of the Golga7 gene (Golga7 fl / fl; UBC-CreERT). As Figure 6 shown in B, there were no significant abnormal phenotypes in adult-induced global knockout (Golga7 fl / fl; UBC-CreERT), and the mice could survive and reproduce. Monthly follow-up of the body weights of male and female mice showed no significant differences for the time being.

[0108] To further examine the functional effects of Golga7 on NRAS mutant proteins at the in vivo level, we used a Golga7 gene knockout mouse model to study its role in the pathogenesis of chronic myelomonocytic leukemia (CMML) caused by the NrasG12D point mutation ( Figure 7 A); preliminary results showed that after pIpC induction and specific knockout of the Golga7 gene in hematopoietic cells ( Figure 7 B), the pathogenesis of CMML caused by the NrasG12D / G12D homozygous point mutation was significantly inhibited ( Figure 7 C). Specifically, within 5 months after pIpC induction, all Golga7 wild-type mice (WT) and nearly 80% of Golga7 heterozygous mice (HET) had developed the disease and died, while none of the Golga7 homozygous knockout mice (KO) had severe disease or death. Our monthly analysis of peripheral blood cells for blood routine and immunophenotype showed that the peripheral blood white blood cell count (WBC), especially the proportion of Mac-1+ granulomonocytes (M), in Golga7 wild-type mice and heterozygous mice increased significantly and abnormally, and the corresponding proportions of T cells and B cells (T and B) decreased significantly ( Figure 7In contrast, the Golga7 homozygous knockout mice were closer to the normal non-diseased control mice (NC), and the numbers of WBC and Mac-1+ cells were maintained at normal levels.

[0109] The leukemia incidence was analyzed by dissecting each group of mice 4 months after pIpC induction, and the results are as Figure 8 shown. Golga7 deficiency led to significant improvement in the involvement of hematopoietic tissues and spleen size ( Figure 8 A and B). Hematoxylin and eosin (HE) tissue staining and flow cytometry analysis showed that Golga7 deficiency could significantly inhibit the infiltration of Mac-1+ / Gr-1+ myeloid cell populations into the spleen ( Figure 8 C and D).

[0110] Regarding the current follow-up, some NrasG12D / G12D mice with Golga7 gene deletion have survived for up to one year, while the wild-type and heterozygous Golga7 gene mice all developed the disease and died around 4 to 6 months. The in vivo experimental results indicate that the Golga7 gene is crucial for the pathogenesis of leukemia caused by Nras mutation.

[0111] The above results show that single-guide RNA (sgRNA) and short hairpin RNA (shRNA) of the GOLGA7 gene can inhibit the expression level or activity of GOLGA7 protein, thereby blocking the transport of NRAS mutant protein from the Golgi apparatus to the plasma membrane, and further inhibiting the proliferation of NRAS mutant-positive tumor cells. At the same time, the study at the whole animal level also suggests its safety in inhibition in adults and the possibility of becoming a drug target. In summary, these results provide a new treatment idea for the treatment of NRAS mutant-positive tumors.

[0112] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the described embodiments. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.

Claims

1. Use of a GOLGA7 inhibitor in the preparation of a drug for treating NRAS mutation-positive tumors.

2. The application according to claim 1, wherein The NRAS mutation-positive tumors include hematological tumors, melanoma, and colorectal cancer.

3. The use according to claim 1, characterized in that: Among them, The GOLGA7 is selected from any one of the following substances: GOLGA7 gene, mRNA or cDNA of GOLGA7, GOLGA7 protein, or an active or signature fragment of any one of the foregoing. The GOLGA7 inhibitor is selected from any one of the following substances: a substance that reduces the expression level of GOLGA7, reduces the activity of GOLGA7, or promotes the metabolism of GOLGA7.

4. The use according to claim 1, characterized in that: Among them, The GOLGA7 inhibitor includes any one of sgRNA of GOLGA7 and Crisper-CAS9 mRNA, small interfering RNA molecules, short hairpin RNA, antisense nucleotides, or nanoparticles, viral vectors, PEG-modified proteins, protein microspheres, liposomes, or extracellular vesicles carrying any one of the foregoing substances.

5. The application according to claim 4, characterized in that The GOLGA7 inhibitor is 3 sgGOLGA7 designed based on the CRISPR / Cas9 gene editing technology required for GOLGA7 gene knockout, or 3 GOLGA7 shRNA or siRNA. The nucleotide sequences of sgGOLGA7 are shown in SEQ ID NO.2-4, and the nucleotide sequences of GOLGA7 shRNA or siRNA are shown in SEQ ID NO.5-7.

6. The application according to claim 1, characterized in that, The GOLGA7 inhibitor is used in combination with other therapeutic drugs.

7. A recombinant vector of GOLGA7 inhibitor, characterized in that, It includes an expression vector and sgRNA of GOLGA7 and Crisper-CAS9 mRNA, GOLGA7 siRNA, GOLGA7 shRNA, or STRIP antisense nucleotides inserted on the expression vector.

8. Use of the recombinant vector of the GOLGA7 inhibitor according to claim 7 in the preparation of a drug for treating NRAS mutation-positive tumors.

9. A pharmaceutical composition for treating NRAS mutation-positive tumors, characterized in that, It includes an active ingredient and a pharmaceutically or immunologically acceptable excipient, carrier, or diluent. Wherein, the active ingredient is the GOLGA7 inhibitor according to any one of claims 1-5 or the recombinant vector of the GOLGA7 inhibitor according to claim 7.

Images