Trisubstituted acridine derivative containing morpholine group as well as preparation method and application of trisubstituted acridine derivative

By developing tri-substituted acridine derivatives containing morpholin groups, using their high affinity and hydrogen bonding with G4-DNA, the problems of insufficient targeting of existing anti-tumor drugs and major toxic and side effects were solved, and high-efficiency and low-toxic anti-tumor effects were achieved.

CN120230035APending Publication Date: 2025-07-01WENZHOU MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510379640.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-07-01

AI Technical Summary

Technical Problem

The existing acridinium anti-tumor drugs have insufficient targeting, lack of selectivity and major toxic side effects, which limit their clinical application.

Method used

A trisubstituted acridine derivative containing morpholin groups was developed, the compound was prepared by nucleophilic substitution reaction, and the morpholin groups were used to enhance hydrogen bonding with G4-DNA, thereby improving its anti-tumor activity and selectivity.

Benefits of technology

The compound has excellent selectivity and stability on G4-DNA, displays a broad spectrum of anti-tumor activity, is effective against a variety of cancer cells, and has low toxic side effects, and improves the water solubility of the drug.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230035A_ABST
    Figure CN120230035A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of acridine derivatives, and discloses a trisubstituted acridine derivative containing a morpholine group as well as a preparation method and application of the trisubstituted acridine derivative. The preparation method comprises the following steps: mixing N, N '-(9-(4-(dimethylamino) phenylamino) acridine-3, 6-diyl) bis (3-chloropropionamide), morpholine, potassium iodide, potassium carbonate and absolute ethyl alcohol, and carrying out nucleophilic substitution reaction to obtain the trisubstituted acridine derivative containing the morpholine group. The trisubstituted acridine derivative containing the morpholine group has excellent selectivity and stability to a quadruplex structure (G4-DNA), has broad-spectrum antitumor activity including but not limited to ovarian cancer, prostatic cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer and the like, and has low toxic and side effects to normal cells and tissues.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of acridine derivatives, and more particularly to a trisubstituted acridine derivative containing a morpholino group, its preparation method, and its application. Background Technology

[0002] Cancer is one of the leading causes of death worldwide. According to the World Health Organization (WHO), more than 10 million people die from cancer each year. Among these, the incidence and mortality rates of malignant tumors such as lung cancer, liver cancer, breast cancer, ovarian cancer, and colorectal cancer continue to rise. Although chemotherapy, radiotherapy, and targeted therapy have been widely used, these therapies are often accompanied by problems such as drug resistance, serious side effects, and limited treatment efficacy. Therefore, developing novel, highly effective, and low-toxicity anti-tumor drugs remains a core challenge in the field of cancer treatment.

[0003] Acridine and its derivatives are an important class of antitumor drugs. Their core structure consists of an acridine nucleus, which exhibits strong DNA interaction capabilities, interfering with the proliferation and survival of tumor cells. Their main mechanisms of action include DNA intercalation, topoisomerase inhibition, and oxidative stress-induced DNA damage. Although acridine compounds have been shown to possess potent antitumor activity, their clinical application is severely limited due to insufficient targeting and lack of selectivity for tumor cells, leading to significant toxic side effects.

[0004] Telomere G-tetramer DNA (G4-DNA) is a special DNA secondary structure formed by the stacking of guanine (G)-rich telomeric DNA repetitive sequences via G-tetramers. Telomere G4-DNA is not only distinct from conventional double-helix DNA structures, but it can also inhibit telomerase activity and promote telomere shortening in cancer cells, making it a potential novel target for antitumor drugs. Therefore, researching acridine derivatives with high antitumor activity, selectivity, and low toxicity targeting G4-DNA is of great significance. Summary of the Invention

[0005] The purpose of this invention is to provide a trisubstituted acridine derivative containing a morpholine group, its preparation method, and its application, thereby solving the aforementioned problems existing in the prior art.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides a trisubstituted acridine derivative containing a morpholine group, wherein the structural formula of the trisubstituted acridine derivative containing the morpholine group is as follows:

[0008]

[0009] This invention also provides a method for preparing a trisubstituted acridine derivative containing a morpholino group, comprising the following steps:

[0010] N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide), morpholine, potassium iodide, potassium carbonate, and anhydrous ethanol were mixed and subjected to a nucleophilic substitution reaction to obtain a trisubstituted acridine derivative containing a morpholine group.

[0011] Preferably, in the above-mentioned method for preparing a trisubstituted acridine derivative containing a morpholine group, the structural formula of N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide) is:

[0012]

[0013] Preferably, in the above-mentioned method for preparing a trisubstituted acridine derivative containing a morpholine group, the molar ratio of N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide), morpholine, potassium iodide, and potassium carbonate is 1:4-6:0.4-0.6:0.4-0.6.

[0014] Preferably, in the above-mentioned method for preparing a trisubstituted acridine derivative containing a morpholine group, the temperature of the nucleophilic substitution reaction is 80-100°C, and the time of the nucleophilic substitution reaction is 0.5-2.5 h.

[0015] This invention also provides the application of a trisubstituted acridine derivative containing a morpholine group in the preparation of antitumor drugs.

[0016] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects:

[0017] The trisubstituted acridine derivatives containing morpholine groups of the present invention exhibit excellent selectivity and stability for quadruplex structures (G4-DNA). The morpholine groups contain oxygen and nitrogen, which can enhance the formation of more hydrogen bonds between the trisubstituted acridine derivatives and the loop strand of G4-DNA, making the interaction stronger. At the same time, they have broad-spectrum antitumor activity, including but not limited to ovarian cancer, prostate cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, etc., and have low toxicity to normal cells and tissues. Furthermore, the morpholine groups in the trisubstituted acridine derivatives are hydrophilic groups, which can improve the water solubility of the drug. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0019] Figure 1The trisubstituted acridine derivative containing a morpholino group prepared in Example 1 1 HNMR nuclear magnetic resonance spectrum;

[0020] Figure 2 The effect of the trisubstituted acridine derivative containing a morpholine group prepared in Example 1 on the activity of tumor cells. Detailed Implementation

[0021] This invention provides a trisubstituted acridine derivative containing a morpholine group, wherein the structural formula of the trisubstituted acridine derivative containing the morpholine group is as follows:

[0022]

[0023] This invention also provides a method for preparing a trisubstituted acridine derivative containing a morpholino group, comprising the following steps:

[0024] N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide), morpholine, potassium iodide, potassium carbonate, and anhydrous ethanol were mixed and subjected to a nucleophilic substitution reaction to obtain a trisubstituted acridine derivative containing a morpholine group.

[0025] In this invention, the structural formula of N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide) is:

[0026]

[0027] In this invention, the preparation method of N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide) is described in patent 202411775752.5, and includes the following steps:

[0028] (1) 2-Chloro-4-aminobenzoic acid and acetic anhydride were subjected to a condensation reaction to obtain a condensation intermediate;

[0029] (2) Mix the condensation intermediate, m-aminoacetanilide, copper powder, cuprous oxide, potassium carbonate and ethylene glycol ethyl ether, and carry out the Ullmann reaction to obtain the benzoic acid intermediate.

[0030] (3) The benzoic acid intermediate and sulfuric acid were subjected to a cyclization reaction to obtain acridinone intermediate 1;

[0031] (4) Acridone intermediate 1 and butyric anhydride were subjected to a condensation reaction to obtain aridone intermediate 2;

[0032] (5) Acridinone intermediate 2 and phosphorus oxychloride were subjected to an electrophilic substitution reaction to obtain acridinium intermediate;

[0033] (6) The acridine intermediate, N,N-dimethyl-p-phenylenediamine and phenol were mixed and subjected to a nucleophilic substitution reaction to obtain trisubstituted acridine intermediate 1;

[0034] (7) The trisubstituted acridine intermediate 1 was hydrolyzed with sulfuric acid to obtain the trisubstituted acridine intermediate 2;

[0035] (8) The trisubstituted acridine intermediates 2,3-chloropropionyl chloride, triethylamine and N,N-dimethylformamide were mixed and subjected to a nucleophilic addition reaction to obtain N,N'-(9-(4-(dimethylamino)phenylamino)acidine-3,6-diyl)bis(3-chloropropionamide).

[0036] In this invention, the preferred synthetic route for the trisubstituted acridine derivative containing a morpholine group is as follows:

[0037]

[0038] In this invention, the molar volume ratio of 2-chloro-4-aminobenzoic acid and acetic anhydride in step (1) is preferably 110-120 mmol:30 mL, more preferably 112-118 mmol:30 mL, and even more preferably 116.6 mmol:30 mL; the temperature of the condensation reaction is preferably 90-110°C, more preferably 95-105°C, and even more preferably 100°C; the time of the condensation reaction is preferably 20-40 min, more preferably 25-35 min, and even more preferably 30 min.

[0039] In this invention, stirring is preferably carried out during the condensation reaction in step (1), and the stirring speed is preferably 700-900 rpm, and more preferably 800 rpm.

[0040] In this invention, after the condensation reaction in step (1) is completed, dichloromethane is preferably added first to precipitate the product, followed by filtration and washing to obtain the condensation intermediate; the volume ratio of dichloromethane to acetic anhydride is preferably 2-4:1, more preferably 3:1; the washing reagent is preferably dichloromethane, and the number of washings is preferably 2-4 times, more preferably 3 times. The purpose of filtration is to remove excess acetic anhydride, the byproduct acetic acid, and dichloromethane.

[0041] In this invention, the condensation intermediate in step (1) is 4-(acetamido)-2-chlorobenzoic acid, with the following structural formula:

[0042] In this invention, the molar ratio of the condensation intermediate, m-aminoacetanilide, copper powder, cuprous oxide, and potassium carbonate in step (2) is preferably 1:0.8-1.2:0.08-0.12:0.08-0.12:0.2-0.8, more preferably 1:0.9-1.1:0.09-0.11:0.09-0.11:0.3-0.6, and even more preferably 1:1.0:0.098:0.092:0.5; the molar volume ratio of the condensation intermediate to ethylene glycol ethyl ether is preferably 1 mmol:1-2.5 mL, more preferably 1 mmol:1.3-2 mL, and even more preferably 1 mmol:1.7 mL; the temperature of the Ullmann reaction is preferably 125-145°C, more preferably 130-140°C, and even more preferably 135°C; the time of the Ullmann reaction is preferably 4-6 h, more preferably 4.5-5.5 h, and even more preferably 5 h.

[0043] In this invention, stirring is preferably performed during the Ullman reaction in step (2), and the stirring speed is preferably 400-600 rpm, more preferably 500 rpm.

[0044] In this invention, after the Ullman reaction in step (2), the quenching reaction, filtration, recrystallization, and drying are preferably performed sequentially to obtain the benzoic acid intermediate. The reagent used in the quenching reaction is water, and the volume ratio of water to ethylene glycol ethyl ether is preferably 3-4:1, more preferably 3.75:1. The recrystallization is preferably performed by acidifying the filtrate with hydrochloric acid, where the volume ratio of HCl to water in the hydrochloric acid is preferably 2.5-3.5:1, more preferably 3:1. The acidification ends when the pH of the filtrate is 2-3. The drying temperature is preferably 40-60℃, more preferably 50℃. The drying time is preferably 20-28 hours, more preferably 24 hours. The purpose of filtration is to remove the copper catalyst powder and cuprous oxide.

[0045] In this invention, the benzoic acid intermediate in step (2) is 4-(acetamido)-2-(3-(acetamido)phenylamino)benzoic acid, with the following structural formula:

[0046] In this invention, the molar volume ratio of benzoic acid intermediate to sulfuric acid in step (3) is preferably 14-17 mmol:12 mL, more preferably 15-16 mmol:12 mL, and even more preferably 15.3 mmol:12 mL; the mass concentration of sulfuric acid is preferably 92-98%, more preferably 94-96%; the temperature of the cyclization reaction is preferably 125-145°C, more preferably 130-140°C, and even more preferably 135°C; the time of the cyclization reaction is preferably 2-4 h, more preferably 2.5-3.5 h, and even more preferably 3 h.

[0047] In this invention, stirring is preferably carried out during the cyclization reaction in step (3), and the stirring speed is preferably 400-600 rpm, and more preferably 500 rpm.

[0048] In this invention, after the cyclization reaction in step (3) is completed, the reaction solution is preferably placed in ice water to obtain a crude mixture. The crude mixture is then recrystallized, filtered, and dried sequentially to obtain acridinone intermediate 1. The temperature of the ice water is preferably -10 to 10°C, more preferably 0°C, and the volume ratio of ice water to sulfuric acid is preferably 100:10 to 15, more preferably 100:12. The recrystallization is preferably performed by adjusting the pH of the crude mixture to 12 to 13 using a saturated sodium hydroxide solution. The drying temperature is preferably 40 to 60°C, more preferably 50°C. The drying time is preferably 20 to 28 hours, more preferably 24 hours.

[0049] In this invention, the acridinone intermediate 1 in step (3) is 3,6-diamino-9(10H)-acridone, with the following structural formula:

[0050] In this invention, the molar volume ratio of acridinone intermediate 1 and butyric anhydride in step (4) is preferably 0.8-2.5 mmol:10 mL, more preferably 1-2 mmol:10 mL, and even more preferably 1.33 mmol:10 mL; the temperature of the condensation reaction is preferably 90-110°C, more preferably 95-105°C, and even more preferably 100°C; the time of the condensation reaction is preferably 1-3 h, more preferably 1.5-2.5 h, and even more preferably 2 h.

[0051] In this invention, stirring is preferably performed during the condensation reaction in step (4), and the stirring speed is preferably 400-600 rpm, more preferably 500 rpm.

[0052] In this invention, after the condensation reaction in step (4) is completed, recrystallization, filtration, and drying are preferably performed sequentially to obtain acridinone intermediate 2; the recrystallization is preferably performed by adjusting the pH value of the solution after the reaction to 12-13 with sodium hydroxide solution, the mass concentration of sodium hydroxide solution is preferably 37-43%, more preferably 40%; the drying temperature is preferably 40-60℃, more preferably 50℃; the drying time is preferably 20-28h, more preferably 24h.

[0053] In this invention, the acridinone intermediate 2 in step (4) is 3,6-bis(butyrylamino)-9(10H)-acridone, with the following structural formula:

[0054] In this invention, the molar volume ratio of acridinone intermediate 2 and phosphorus oxychloride in step (5) is preferably 12-15 mmol:20 mL, more preferably 13-14 mmol:20 mL, and even more preferably 13.7 mmol:20 mL; the temperature of the electrophilic substitution reaction is preferably 80-100°C, more preferably 85-95°C, and even more preferably 90°C; the time of the electrophilic substitution reaction is preferably 1-2 h, and even more preferably 1.5 h.

[0055] In this invention, stirring is preferably performed during the electrophilic substitution reaction in step (5), and the stirring speed is preferably 400-600 rpm, more preferably 500 rpm.

[0056] In this invention, after the electrophilic substitution reaction in step (5) is completed, the reaction solution is preferably cooled to room temperature, and then subjected to vacuum distillation, neutralization of phosphorus oxychloride, and extraction to obtain an organic layer. The organic layer is then subjected to drying, vacuum distillation, and silica gel column chromatography to obtain an acridine intermediate. The vacuum distillation temperature is preferably 50-60°C, more preferably 55°C; the vacuum distillation pressure is preferably 0.05-0.15 MPa, more preferably 0.1 MPa; and the vacuum distillation time is preferably 5-15 min, more preferably 10 min. The neutralization of phosphorus oxychloride is preferably achieved by placing the vacuum distillation product in ice water to obtain a crude product, using saturated sodium hydroxide. The pH of the crude product is adjusted to 12-13; the temperature of the ice water is preferably -10-10℃, more preferably 0℃, and the volume ratio of ice water to phosphorus oxychloride is preferably 100:15-25, more preferably 100:20; the reagent used for extraction is preferably dichloromethane and methanol, and the volume ratio of dichloromethane to methanol is preferably 9-11:1, more preferably 10:1; the number of extractions is preferably 2-4 times, more preferably 3 times; the reagent used for drying is preferably anhydrous magnesium sulfate; the reagent used for silica gel column chromatography is preferably dichloromethane and methanol, and the volume ratio of dichloromethane to methanol is preferably 20-40:1, more preferably 30:1. The purpose of the first vacuum distillation is to remove the solvent phosphorus oxychloride, and the purpose of the second vacuum distillation is to remove dichloromethane and methanol.

[0057] In this invention, the acridine intermediate in step (5) is 3,6-bis(butyrylamino)-9-chloroacridine, with the following structural formula:

[0058] In this invention, the molar volume ratio of the acridine intermediate, N,N-dimethyl-p-phenylenediamine, and phenol in step (6) is preferably 1 mmol: 3-5 mmol: 2-4 mL, more preferably 1 mmol: 3.5-4.5 mmol: 2.5-3.5 mL, and even more preferably 1 mmol: 4 mmol: 2.88 mL; the temperature of the nucleophilic substitution reaction is preferably 90-110 °C, more preferably 95-105 °C, and even more preferably 100 °C; the time of the nucleophilic substitution reaction is preferably 1-3 h, more preferably 1.5-2.5 h, and even more preferably 2 h.

[0059] In this invention, stirring is preferably performed during the nucleophilic substitution reaction described in step (6), and the stirring speed is preferably 400-600 rpm, more preferably 500 rpm.

[0060] In this invention, after the nucleophilic substitution reaction in step (6) is completed, a quenching reaction and extraction are preferably performed sequentially to obtain an organic layer. The organic layer is then sequentially dried, distilled under reduced pressure, and subjected to silica gel column chromatography to obtain the trisubstituted acridine intermediate 1. The reagent used in the quenching reaction is preferably water, and the volume ratio of water to phenol is preferably 100:10-15, more preferably 100:12. The reagent used in the extraction is preferably dichloromethane and a saturated sodium chloride solution, and the volume ratio of dichloromethane to the saturated sodium chloride solution is preferably 1-2:1, more preferably 1.5:1. The distillation process is preferably performed 2 to 4 times, more preferably 3 times; the reagent used for drying is preferably anhydrous magnesium sulfate; the temperature of the vacuum distillation is preferably 50 to 60°C, more preferably 55°C; the pressure of the vacuum distillation is preferably 0.05 to 0.15 MPa, more preferably 0.1 MPa; the time of the vacuum distillation is preferably 10 to 20 minutes, more preferably 15 minutes; the reagent used for silica gel column chromatography is preferably dichloromethane and methanol, and the volume ratio of dichloromethane to methanol is preferably 10 to 30:1, more preferably 20:1. The purpose of vacuum distillation is to remove dichloromethane and methanol.

[0061] In this invention, the trisubstituted acridine intermediate 1 in step (6) is 3,6-bis(butyrylamino)-9-[4'-(N,N-dimethylamino)phenylamino]acridine, with the following structural formula:

[0062] In this invention, the molar volume ratio of the trisubstituted acridine intermediate 1 and sulfuric acid in step (7) is preferably 2-4 mmol:10 mL, more preferably 2.68-3.5 mmol:10 mL, and even more preferably 3 mmol:10 mL; the mass concentration of sulfuric acid is preferably 92-98%, more preferably 94-96%; the temperature of the hydrolysis reaction is preferably 90-110°C, more preferably 95-105°C, and even more preferably 100°C; the time of the hydrolysis reaction is preferably 20-40 min, more preferably 25-35 min, and even more preferably 30 min.

[0063] In this invention, stirring is preferably performed during the hydrolysis reaction in step (7), and the stirring speed is preferably 400-600 rpm, more preferably 500 rpm.

[0064] In this invention, after the hydrolysis reaction in step (7) is completed, the reaction solution is preferably cooled to room temperature, and then neutralized with sulfuric acid, recrystallized, filtered, and dried sequentially to obtain the trisubstituted acridine intermediate 2; the neutralization with sulfuric acid is preferably done by placing the reaction solution in ice water to obtain a crude mixture; the temperature of the ice water is preferably -10 to 10°C, more preferably 0°C, and the volume ratio of ice water to sulfuric acid is preferably 50:8 to 12, more preferably 50:10; the recrystallization is preferably done by adjusting the pH value of the crude mixture to 12 to 13 with a saturated sodium hydroxide solution; the drying temperature is preferably 40 to 50°C, more preferably 45°C; the drying time is preferably 20 to 28 hours, more preferably 24 hours.

[0065] In this invention, the trisubstituted acridine intermediate 2 in step (7) is 3,6-diamino-9-[4'-(N,N-dimethylamino)phenylamino]acridine, with the following structural formula:

[0066] The preferred molar volume ratio of the trisubstituted acridine intermediate 2, 3-chloropropionyl chloride, triethylamine and N,N-dimethylformamide in step (8) is 1 mmol: 4-6 mmol: 0.3-0.6 mL: 1-3 mL, more preferably 1 mmol: 4.5-5.5 mmol: 0.4-0.5 mL: 1.67-2.5 mL, and even more preferably 1 mmol: 5 mmol: 0.42 mL: 2 mL; the preferred temperature for the nucleophilic addition reaction is 50-70 °C, more preferably 55-65 °C, and even more preferably 60 °C; the preferred time for the nucleophilic addition reaction is 1-3 h, more preferably 1.5-2.5 h, and even more preferably 2 h.

[0067] In this invention, stirring is preferably performed during the nucleophilic addition reaction in step (8), and the stirring speed is preferably 400-600 rpm, more preferably 500 rpm.

[0068] In this invention, the mixing in step (8) preferably involves first mixing the trisubstituted acridine intermediate 2 and triethylamine, and then sequentially adding N,N-dimethylformamide and 3-chloropropionyl chloride.

[0069] In this invention, after the nucleophilic addition reaction in step (8) is completed, a quenching reaction, vacuum distillation, and extraction are performed sequentially to obtain an organic layer. The organic layer is then dried, vacuum distilled, and subjected to silica gel column chromatography to obtain N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide). The reagent used in the quenching reaction is water, and the volume ratio of water to N,N-dimethylformamide is preferably 20-30:1, more preferably 25:1. The vacuum distillation temperature is preferably 60-70°C, more preferably 65°C. The vacuum distillation pressure is preferably 0.05-0.1 ppm. The pressure is 5 MPa, more preferably 0.1 MPa; the vacuum distillation time is preferably 20-30 min, more preferably 25 min; the reagent used for extraction is preferably dichloromethane and saturated sodium chloride solution, and the volume ratio of dichloromethane to saturated sodium chloride solution is preferably 1-2:1, more preferably 1.5:1; the number of extractions is preferably 2-4 times, more preferably 3 times; the reagent used for drying is preferably anhydrous magnesium sulfate; the reagent used for silica gel column chromatography is preferably dichloromethane and methanol, and the volume ratio of dichloromethane to methanol is preferably 10-30:1, more preferably 20:1.

[0070] In this invention, the molar ratio of N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide), morpholine, potassium iodide, and potassium carbonate is preferably 1:4-6:0.4-0.6:0.4-0.6, more preferably 1:4.5-5.5:0.45-0.55:0.45-0.55, and even more preferably 1:5:0.5:0.5.

[0071] In this invention, the temperature of the nucleophilic substitution reaction is preferably 80-100°C, more preferably 85-95°C, and even more preferably 90°C; the time of the nucleophilic substitution reaction is preferably 0.5-2.5 h, more preferably 1.5-2.5 h, and even more preferably 2 h.

[0072] In this invention, stirring is preferably performed during the nucleophilic substitution reaction, and the stirring speed is preferably 400-600 rpm, more preferably 500 rpm.

[0073] In this invention, the mixing process preferably involves first mixing N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide), potassium iodide, and potassium carbonate, and then sequentially adding anhydrous ethanol and morpholine.

[0074] In this invention, after the nucleophilic substitution reaction is completed, a quenching reaction, vacuum distillation, and extraction are sequentially performed to obtain an organic layer. The organic layer is then sequentially dried, vacuum distilled, and subjected to silica gel column chromatography to obtain a trisubstituted acridine derivative containing a morpholine group. The reagent used in the quenching reaction is water, and the volume ratio of water to anhydrous ethanol is preferably 20–30:3, more preferably 20:3. The vacuum distillation temperature is preferably 45–55°C, more preferably 50°C. The vacuum distillation pressure is preferably 0.05–0.15 MPa, more preferably 0.1 MPa. The preferred time for vacuum distillation is 20-30 min, more preferably 25 min; the preferred reagent for extraction is dichloromethane and saturated sodium chloride solution, with a volume ratio of 1-2:1, more preferably 1:1; the preferred number of extractions is 2-4, more preferably 3; the preferred reagent for drying is anhydrous magnesium sulfate; the preferred reagent for silica gel column chromatography is dichloromethane and methanol, with a volume ratio of 20-40:1, more preferably 30:1.

[0075] This invention also provides the application of a trisubstituted acridine derivative containing a morpholine group in the preparation of antitumor drugs.

[0076] In this invention, the antitumor drug is preferably in the form of injection, tablet, capsule, aerosol, suppository, film, drop pill, ointment, controlled release agent, sustained release agent, or nano-formulation.

[0077] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0078] Example 1

[0079] 116.6 mmol of 2-chloro-4-aminobenzoic acid and 30 mL of acetic anhydride were mixed and stirred at 800 rpm for 30 min at 100 °C to carry out a condensation reaction, yielding a clear solution. 90 mL of dichloromethane was added to the clear solution to precipitate the product, which was then filtered through a sintered glass funnel to obtain a solid product. The solid product was washed three times with dichloromethane to obtain the condensation intermediate: 4-(acetamido)-2-chlorobenzoic acid. The condensation intermediate was a white solid with a mass of 17.2 g, and a yield of 69.1%.

[0080] 2.34 mmol anhydrous potassium carbonate, 0.46 mmol copper powder, 0.43 mmol cuprous oxide, 4.68 mmol condensation intermediate, 5.15 mmol m-aminoacetanilide, and 8 mL ethylene glycol ethyl ether were mixed and stirred at 500 rpm for 5 h at 135 °C to carry out the Ullmann reaction, yielding a reaction mixture. The reaction mixture was poured into 30 mL of distilled water and filtered through a diatomaceous earth filter to obtain a filtrate. Hydrochloric acid (HCl to water volume ratio of 3:1) was added to the filtrate for acidification until the pH of the filtrate reached 2.5, at which point the acidification was stopped, and the mixture was filtered again to obtain a crude product. The crude product was dried at 50 °C for 24 h to obtain the benzoic acid intermediate: 4-(acetamido)-2-(3-(acetamido)phenylamino)benzoic acid. The benzoic acid intermediate was a gray solid with a mass of 420 mg and a yield of 27.4%.

[0081] 12 mL of 96% sulfuric acid was added dropwise to 15.3 mmol of benzoic acid intermediate at a rate of 1 drop / s. The mixture was stirred at 500 rpm for 2 h at 135 °C to carry out the cyclization reaction. After the reaction was completed, the mixture was cooled to room temperature to obtain a reaction mixture. The reaction mixture was poured into 100 mL of ice water at 0 °C to obtain a crude mixture. The pH of the crude mixture was adjusted to 12.5 with saturated sodium hydroxide solution, and then filtered through a sintered glass funnel to obtain a filter residue. The filter residue was dried at 50 °C for 24 h to obtain acridinone intermediate 1: 3,6-diamino-9(10H)-acridone. Acridinone intermediate 1 was a yellow-green solid and did not require further purification; it was directly used in the next reaction step.

[0082] 1.33 mmol of acridinone intermediate 1 was placed in a 100 mL round-bottom flask, and 10 mL of butyric anhydride was added. The mixture was stirred at 500 rpm for 2 h at 100 °C to carry out a condensation reaction, yielding a reaction mixture. The pH of the reaction mixture was adjusted to 12.5 using a 40% sodium hydroxide solution, and then filtered through a sintered glass funnel to obtain the residue. The residue was dried at 50 °C for 24 h to obtain acridinone intermediate 2: 3,6-bis(butyrylamino)-9(10H)-acridone. Acridinone intermediate 2 was a gray solid and did not require further purification; it was directly used in the next reaction step.

[0083] 20 mL of phosphorus oxychloride was added to 13.7 mmol of acridinone intermediate 2, and the mixture was stirred at 500 rpm for 1.5 h at 90 °C to carry out an electrophilic substitution reaction. After the reaction was completed, the mixture was cooled to room temperature to obtain a reaction mixture. The reaction mixture was placed in a rotary evaporator and distilled under reduced pressure at 55 °C and 0.1 MPa for 10 min. The product obtained by reduced pressure distillation was poured into 100 mL of ice water at 0 °C to obtain a crude product. The pH of the crude product was adjusted to 12.5 with saturated sodium hydroxide solution to obtain a mixed solution. The mixed solution was extracted three times with a mixture of dichloromethane and methanol at a volume ratio of 10:1 to obtain an organic layer. The organic layer was dried with anhydrous magnesium sulfate and then placed in a rotary evaporator and distilled under reduced pressure at 55 °C and 0.1 MPa for 15 min. The product from vacuum distillation was subjected to silica gel column chromatography using dichloromethane and methanol in a volume ratio of 30:1 (dropping rate of 5 drops / s) to obtain the acridine intermediate: 3,6-bis(butyrylamino)-9-chloroacridine. The acridine intermediate was a bright yellow solid with a mass of 1.6 g and a yield of 30.5%.

[0084] 4.16 mmol of acridine intermediate, 16.66 mmol of N,N-dimethyl-p-phenylenediamine, and 12 mL of phenol were mixed and stirred at 500 rpm for 2 h at 100 °C to carry out a nucleophilic substitution reaction, yielding a reaction mixture. The reaction mixture was poured into 100 mL of distilled water, and the pH of the reaction mixture was adjusted to 12.5 with saturated sodium hydroxide solution. Then, the mixture was extracted three times with a 1:1 volume ratio of dichloromethane and saturated sodium chloride solution to obtain an organic layer. The organic layer was dried with anhydrous magnesium sulfate and then placed in a rotary evaporator for vacuum distillation at 55 °C and 0.1 MPa for 15 min. The product of vacuum distillation was subjected to silica gel column chromatography with a 20:1 volume ratio of dichloromethane and methanol (dropping rate of 5 drops / s) to obtain the trisubstituted acridine intermediate 1:3,6-bis(butyrylamino)-9-[4'-(N,N-dimethylamino)phenylamino]acridine. The trisubstituted acridine intermediate 1 is a reddish-brown solid with a mass of 1.3 g and a yield of 64.7%.

[0085] 10 mL of 96% sulfuric acid was added dropwise to 2.68 mmol of trisubstituted acridine intermediate 1 at a rate of 1 drop / s. The mixture was stirred at 500 rpm for 0.5 h at 100 °C to carry out hydrolysis. After the reaction was completed, the mixture was cooled to room temperature to obtain a reaction mixture. The reaction mixture was poured into 50 mL of ice water at 0 °C to obtain a crude product. The pH of the crude product was adjusted to 12.5 with saturated sodium hydroxide solution, and then filtered through a sintered glass funnel to obtain a filter residue. The filter residue was dried at 45 °C for 24 h to obtain trisubstituted acridine intermediate 2: 3,6-diamino-9-[4'-(N,N-dimethylamino)phenylamino]acridine. Trisubstituted acridine intermediate 2 was a reddish-brown solid and did not require further purification; it was directly used in the next reaction step.

[0086] 2.39 mmol of trisubstituted acridine intermediate 2 and 1 mL of triethylamine were mixed, followed by the sequential addition of 4 mL of N,N-dimethylformamide and 11.95 mmol of 3-chloropropionyl chloride. The mixture was stirred at 500 rpm for 2 h at 60 °C to induce a nucleophilic addition reaction, yielding a reaction mixture. The reaction mixture was then poured into 100 mL of distilled water and placed in a rotary evaporator for distillation under reduced pressure at 65 °C and 0.1 MPa for 25 min. The product from the reduced pressure distillation was extracted three times using a 1:1 volume ratio of dichloromethane and saturated sodium chloride solution to obtain an organic layer. This organic layer was dried with anhydrous magnesium sulfate and then distilled under reduced pressure at 60 °C and 0.1 MPa for 20 min in a rotary evaporator. The product obtained by vacuum distillation was subjected to silica gel column chromatography with dichloromethane and methanol in a volume ratio of 20:1 (dropping rate of 5 drops / s) to obtain N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide), which was a reddish-brown solid with a mass of 550 mg and a yield of 44.7%.

[0087] 1.05 mmol N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide), 0.5 mmol potassium iodide, and 0.5 mmol potassium carbonate were mixed, followed by the sequential addition of 15 mL anhydrous ethanol and 5.24 mmol morpholine. The mixture was stirred at 500 rpm for 2 h at 90 °C to induce a nucleophilic substitution reaction, yielding a reaction mixture. The reaction mixture was then added to 100 mL of distilled water and distilled under reduced pressure at 50 °C and 0.1 MPa for 25 min in a rotary evaporator. The product from the reduced pressure distillation was extracted three times with a 1:1 volume ratio of dichloromethane and saturated sodium chloride solution to obtain an organic layer. The organic layer was dried with anhydrous magnesium sulfate and then distilled under reduced pressure at 50 °C and 0.1 MPa for 15 min in a rotary evaporator. The product obtained by vacuum distillation was subjected to silica gel column chromatography with dichloromethane and methanol at a volume ratio of 30:1 (dropping rate of the product was 5 drops / s) to obtain a trisubstituted acrylidine derivative containing a morpholine group: N,N'-(9-((4-(dimethylamino)phenyl)amino)acridin-3,6-diyl)bis(3-morpholinopropionamide). The trisubstituted acrylidine derivative containing a morpholine group was a reddish-brown solid with a mass of 100 mg and a yield of 15.24%.

[0088] Example 2

[0089] 110 mmol of 2-chloro-4-aminobenzoic acid and 30 mL of acetic anhydride were mixed and stirred at 800 rpm for 20 min at 110 °C to carry out a condensation reaction, yielding a clear solution. 120 mL of dichloromethane was added to the clear solution to precipitate the product, which was then filtered through a sintered glass funnel to obtain a solid product. The solid product was washed three times with dichloromethane to obtain the condensation intermediate: 4-(acetamido)-2-chlorobenzoic acid.

[0090] 3.74 mmol anhydrous potassium carbonate, 0.56 mmol copper powder, 0.56 mmol cuprous oxide, 4.68 mmol condensation intermediate, 3.75 mmol m-aminoacetanilide, and 9.5 mL ethylene glycol ethyl ether were mixed and stirred at 600 rpm for 4 h at 145 °C to carry out the Ullmann reaction, yielding a reaction mixture. The reaction mixture was poured into 38 mL of distilled water and filtered through a diatomaceous earth filter to obtain the filtrate. Hydrochloric acid (HCl to water volume ratio of 3:1) was added to the filtrate for acidification until the pH of the filtrate reached 2.5, at which point the acidification was stopped, and the mixture was filtered again to obtain the crude product. The crude product was dried at 40 °C for 28 h to obtain the benzoic acid intermediate: 4-(acetamido)-2-(3-(acetamido)phenylamino)benzoic acid.

[0091] 12 mL of 92% sulfuric acid was added dropwise to 17 mmol of benzoic acid intermediate at a rate of 1 drop / s. The mixture was stirred at 400 rpm for 4 h at 125 °C to carry out the cyclization reaction. After the reaction was completed, the mixture was cooled to room temperature to obtain a reaction mixture. The reaction mixture was poured into 80 mL of ice water at 0 °C to obtain a crude mixture. The pH of the crude mixture was adjusted to 12 with saturated sodium hydroxide solution, and then filtered through a sintered glass funnel to obtain a filter residue. The filter residue was dried at 40 °C for 28 h to obtain acridinone intermediate 1: 3,6-diamino-9(10H)-acridone. Acridinone intermediate 1 was a yellow-green solid and did not require further purification; it was directly used in the next reaction step.

[0092] 2 mmol of acridinone intermediate 1 was placed in a 100 mL round-bottom flask, and 10 mL of butyric anhydride was added. The mixture was stirred at 400 rpm for 3 h at 90 °C to carry out a condensation reaction, yielding a reaction mixture. The pH of the reaction mixture was adjusted to 13 using a 43% sodium hydroxide solution, and then filtered through a sintered glass funnel to obtain the residue. The residue was dried at 60 °C for 20 h to obtain acridinone intermediate 2: 3,6-bis(butyrylamino)-9(10H)-acridone. Acridinone intermediate 2 was a gray solid and did not require further purification; it was directly used in the next reaction step.

[0093] 20 mL of phosphorus oxychloride was added to 15 mmol of acridinone intermediate 2, and the mixture was stirred at 600 rpm for 1 h at 100 °C to carry out an electrophilic substitution reaction. After the reaction was completed, the mixture was cooled to room temperature to obtain a reaction mixture. The reaction mixture was placed in a rotary evaporator and distilled under reduced pressure at 50 °C and 0.15 MPa for 15 min. The product obtained by reduced pressure distillation was poured into 80 mL of ice water at 0 °C to obtain a crude product. The pH of the crude product was adjusted to 12 with saturated sodium hydroxide solution to obtain a mixed solution. The mixed solution was extracted three times with a mixture of dichloromethane and methanol at a volume ratio of 9:1 to obtain an organic layer. The organic layer was dried with anhydrous magnesium sulfate and then placed in a rotary evaporator for distillation under reduced pressure at 50 °C and 0.15 MPa for 15 min. The product obtained from vacuum distillation was subjected to silica gel column chromatography using dichloromethane and methanol at a volume ratio of 40:1 (dropping rate of 5 drops / s) to obtain the acridine intermediate: 3,6-bis(butyrylamino)-9-chloroacridine. The acridine intermediate was a bright yellow solid.

[0094] 4.16 mmol of acridine intermediate, 20 mmol of N,N-dimethyl-p-phenylenediamine, and 16.5 mL of phenol were mixed and stirred at 400 rpm for 3 h at 90 °C to carry out a nucleophilic substitution reaction, yielding a reaction mixture. The reaction mixture was poured into 110 mL of distilled water, and the pH of the reaction mixture was adjusted to 12 with saturated sodium hydroxide solution. Then, the mixture was extracted three times with dichloromethane and saturated sodium chloride solution at a volume ratio of 2:1 to obtain an organic layer. The organic layer was dried with anhydrous magnesium sulfate and then placed in a rotary evaporator for vacuum distillation at 50 °C and 0.15 MPa for 10 min. The product of vacuum distillation was subjected to silica gel column chromatography with dichloromethane and methanol at a volume ratio of 10:1 (dropping rate of 5 drops / s) to obtain the trisubstituted acridine intermediate 1:3,6-bis(butyrylamino)-9-[4'-(N,N-dimethylamino)phenylamino]acridine. The trisubstituted acridine intermediate 1 is a reddish-brown solid.

[0095] 10 mL of 92% sulfuric acid was added dropwise to 4 mmol of trisubstituted acridine intermediate 1 at a rate of 1 drop / s. The mixture was stirred at 400 rpm for 40 min at 90 °C to carry out the hydrolysis reaction. After the reaction was completed, the mixture was cooled to room temperature to obtain a reaction mixture. The reaction mixture was poured into 42 mL of ice water at 0 °C to obtain a crude product. The pH of the crude product was adjusted to 13 with saturated sodium hydroxide solution, and then filtered through a sintered glass funnel to obtain a filter residue. The filter residue was dried at 40 °C for 28 h to obtain trisubstituted acridine intermediate 2: 3,6-diamino-9-[40-(N,N-dimethylamino)phenylamino]acridine. Trisubstituted acridine intermediate 2 was a reddish-brown solid and did not require further purification; it was directly used in the next reaction step.

[0096] 2.39 mmol of trisubstituted acridine intermediate 2 and 1.4 mL of triethylamine were mixed, followed by the sequential addition of 7 mL of N,N-dimethylformamide and 14 mmol of 3-chloropropionyl chloride. The mixture was stirred at 500 rpm for 2 h at 70 °C to induce a nucleophilic addition reaction, yielding a reaction mixture. The reaction mixture was poured into 140 mL of distilled water and placed in a rotary evaporator for vacuum distillation at 60 °C and 0.05 MPa for 20 min. The product from the vacuum distillation was extracted three times with a 1:1 volume ratio of dichloromethane and saturated sodium chloride solution to obtain an organic layer. This organic layer was dried with anhydrous magnesium sulfate and then placed in a rotary evaporator for vacuum distillation at 60 °C and 0.1 MPa for 15 min. The product of vacuum distillation was subjected to silica gel column chromatography with dichloromethane and methanol in a volume ratio of 30:1 (dropping rate of the product of vacuum distillation was 5 drops / s) to obtain N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide), which was a reddish-brown solid.

[0097] 1.05 mmol N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide), 0.5 mmol potassium iodide, and 0.5 mmol potassium carbonate were mixed, followed by the sequential addition of 15 mL anhydrous ethanol and 5.24 mmol morpholine. The mixture was stirred at 500 rpm for 2 h at 90 °C to carry out a nucleophilic substitution reaction, yielding a reaction mixture. The reaction mixture was added to 100 mL distilled water and placed in a rotary evaporator for vacuum distillation at 50 °C and 0.1 MPa for 25 min. The product obtained from the vacuum distillation was extracted three times with a 1:1 volume ratio of dichloromethane and saturated sodium chloride solution to obtain an organic layer. The organic layer was dried with anhydrous magnesium sulfate and then placed in a rotary evaporator for vacuum distillation at 50 °C and 0.1 MPa for 15 min. The product of vacuum distillation was subjected to silica gel column chromatography with dichloromethane and methanol in a volume ratio of 30:1 (dropping rate of the product of vacuum distillation was 5 drops / s) to obtain a trisubstituted acridine derivative containing a morpholine group: N,N'-(9-((4-(dimethylamino)phenyl)amino)acridin-3,6-diyl)bis(3-morpholinopropionamide). The trisubstituted acridine derivative containing a morpholine group was a reddish-brown solid.

[0098] The trisubstituted acridine derivative containing a morpholine group prepared in Example 1 was characterized by nuclear magnetic resonance. Figure 1 The trisubstituted acridine derivative containing a morpholino group prepared in Example 1 1 HNMR nuclear magnetic resonance spectrum.

[0099] Figure 1 income 1 HNMR is: 1HNMR(400MHz, Methanol-d4)δ8.34(d,J=2.0Hz,2H),7.95(d,J=9.3Hz,2H),7.21-7.11(m,4H),6.81(d,J=8 .5Hz,2H),3.73-3.66(m,8H),2.99(s,6H),2.77(t,J=6.9Hz,4H),2.64(t,J=6.9Hz,4H),2.57-2.46(m,8H).

[0100] Depend on Figure 1 It can be seen that the trisubstituted acridine derivative containing a morpholine group prepared in Example 1 of the present invention is N,N'-(9-((4-(dimethylamino)phenyl)amino)acridin-3,6-diyl)bis(3-morpholinopropionamide).

[0101] The effect of a 10 μM concentration of the trisubstituted acridine derivative containing a morpholine group prepared in Example 1 on the activity of various tumor cells was determined using the MTT assay, thereby evaluating its antitumor activity. The specific steps are as follows: The tumor cells required for resuscitation were: human ovarian cancer cells ES2, human colorectal cancer cells HCT116, human breast cancer cells MDA-MB-231, human glioma cells U87, human liver cancer cells Huh-7, and human non-small cell lung cancer cells H1581. One day in advance, tumor cells were seeded into 96-well plates at a density of 5000 cells per well (160 μL / well), with three replicates per experiment. After complete cell adhesion, the control group was treated with complete culture medium containing 0.1% DMSO, and the treatment group was treated with complete culture medium containing 10 μM of the trisubstituted acridine derivative containing a morpholine group; the volume added was 40 μL / well for both groups. A blank group consisted of wells containing neither cells nor culture medium. Incubate the cells at 37°C and 5% CO2 for another 48 hours. Then, add 5 mg / mL MTT working solution (20 μL / well) and incubate for another 4 hours. Carefully aspirate and discard the supernatant under dark conditions. Next, add 100 μL DMSO to each well and shake on a horizontal shaker for 10 minutes to ensure complete dissolution of the purple formazan crystals. Measure the absorbance of each well at 570 nm using a microplate reader. Finally, determine cell viability using the following formula: Cell viability (%) = (OD200) / (OD200) * ... 给药组 -OD 空白组 ) / (OD 对照组 -OD 空白组 )×100%. Experimental results are as follows: Figure 2As shown, the 10 μM trisubstituted acridine derivative containing the morpholine group exhibited good antitumor activity against all tested tumor cell lines: the 10 μM trisubstituted acridine derivative containing the morpholine group inhibited the cell activity of ES2 cells, HCT116 cells, MDA-MB-231 cells, U87 cells and H1581 cells by about 40%, and inhibited the cell activity of Huh-7 cells by about 60%.

[0102] FRET (Fluorescence Resonance Energy Transfer) is a photophysical technique developed by utilizing the photophysical phenomenon that the energy transfer between a fluorescent donor and a fluorescent acceptor changes with the distance between them. This technique has been widely used in the study of the interaction between small molecule compounds and G4-DNA. Therefore, this invention uses FRET experiments to detect the affinity of the trisubstituted acridine derivative containing a morpholine group prepared in Example 1 for telomere G-tetramers, using the chlorinated trisubstituted acridine derivative: N,N'-(9-(4-(dimethylamino)phenylamino)acridin-3,6-diyl)bis(3-chloropropionamide) as a comparison. The telomere G repeat sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and its sequence is shown in SEQ ID NO.1: 5'-FAM-d(GGGTTAGGGTTAGGGTTAGGG)-TAMRA-3'. The fluorescent donor FAM is 6-carboxyfluorescein, and the fluorescent acceptor TAMRA is 6-carboxy-tetramethylrhodamine. Their concentrations were determined according to the dilution method provided with the product instructions. Before use, the DNA was diluted to 400 nM with 60 mM potassium arsenate (KAsO4) buffer at pH 7.4. The mixture was then heated at 95°C for 5 min, followed by slow cooling to room temperature (this process was carried out overnight in an insulated container to prevent rapid cooling). The annealed DNA was stored at 4°C for later use. Next, a stock solution of the trisubstituted acridine derivative with an initial concentration of 3 mM was prepared using buffer solution and diluted with buffer solution as needed for the experiment. Finally, 12.5 μL of 400 nM telomere G4-DNA was mixed with 12.5 μL of trisubstituted acridine derivative solutions of different concentrations (2 × final concentration) in a Roche (LightCycler) PCR tube. After standing for 1 h, the mixture was tested using a Roche real-time quantitative PCR instrument (LightCycler 2). The temperature range was 37–99 °C, with a heating interval of 1 °C / min. After heating, the samples were taken after equilibration for 30 s. The Tm value was provided by the instrument's built-in melting point analysis program. The experimental results showed that at a dose of 0.5 μM, the ΔT value of the trisubstituted acridine derivative containing the morpholine group in Example 1 on telomere G4-DNA was [not specified]. m The temperature was 27.6℃, while the ΔT of chlorinated trisubstituted acridine derivatives on G4-DNA was... mThe temperature was 18.2℃; the results showed that the trisubstituted acridine derivative containing a morpholine group of the present invention has a higher affinity for telomere G-quadruplex DNA.

[0103] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A trisubstituted acridine derivative containing a morpholine group, characterized in that: The structural formula of the trisubstituted acridine derivative containing a morpholine group is:

2. The method for preparing a trisubstituted acridine derivative containing a morpholine group according to claim 1, characterized in that: The following steps are involved: N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide), morpholine, potassium iodide, potassium carbonate and anhydrous ethanol are mixed and subjected to a nucleophilic substitution reaction to obtain a trisubstituted acridine derivative containing a morpholine group.

3. The method for preparing a trisubstituted acridine derivative containing a morpholine group according to claim 2, characterized in that: The structural formula of the N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide) is:

4. The method for preparing a trisubstituted acridine derivative containing a morpholine group according to claim 3, characterized in that: The molar ratio of N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide), morpholine, potassium iodide and potassium carbonate is 1:4-6:0.4-0.6:0.4-0.

6.

5. The method for preparing a trisubstituted acridine derivative containing a morpholine group according to claim 4, characterized in that: The temperature of the nucleophilic substitution reaction is 80-100° C., and the time of the nucleophilic substitution reaction is 0.5-2.5 h.

6. Use of a trisubstituted acridine derivative containing a morpholine group according to claim 1 in the preparation of antitumor drugs.

Citation Information

Patent Citations

  • Tri-substituted acridine derivative as well as preparation method and application thereof

    CN119241433A