Klebsiella sp. TYF-NHY-Klk001 as well as application and microbial agent thereof

By using Klebsiella TYF-NHY-Klk001 to treat nitroglycerin wastewater, the problems of low efficiency and high cost of traditional methods are solved, and the wastewater treatment effect of efficiently removing nitroglycerin and its intermediate products is achieved.

CN120230672AInactive Publication Date: 2025-07-01TAIYUAN UNIVERSITY OF TECHNOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510378100.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-07-01
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

The prior art is difficult to effectively treat nitroglycerin wastewater, and traditional physical and chemical methods have problems such as low efficiency, high cost and possible secondary pollution.

Method used

A strain of Klebsiella sp. TYF-NHY-Klk001 was provided, which can remove nitroglycerin and its metabolic intermediates in a highly toxic environment, and is used to prepare microbial agents for wastewater treatment.

Benefits of technology

This strain can efficiently remove nitroglycerin and its intermediate products, has high degradation efficiency, is suitable for the treatment of a variety of explosives and pharmaceutical wastewater, and the preparation process of bacterial agents is relatively simple and easy to be produced in industrial use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230672A_ABST
    Figure CN120230672A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of microbial denitrification, in particular to a Klebsiella sp. TYF-NHY-Klk001 strain as well as an application and a microbial agent of the Klebsiella sp. TYF-NHY-Klk001 strain. The Klebsiella sp. TYF-NHY-Klk001 is preserved in the China General Microbiological Culture Collection Center on November 06, 2024, and the preservation number of the Klebsiella sp. TYF-NHY-Klk001 is CGMCC (China General Microbiological Culture Collection Center) NO.32522. The Klebsiella TYF-NHY-Klk001 strain can grow by using nitroglycerin as a sole nitrogen source, can realize synchronous removal of nitroglycerin and intermediate products thereof, and is high in removal efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microbial denitrification, and particularly to a strain of Klebsiella sp. TYF-NHY-Klk001, its application, and a microbial agent. Background Art

[0002] Nitroglycerin, also known as glyceryl trinitrate (GTN), is an important chemical substance. It is widely used as a vasodilator in the medical field and also plays a crucial role in the explosive manufacturing industry. However, a large amount of wastewater is generated during the production and use of nitroglycerin. This wastewater contains a high concentration of nitroglycerin components, posing a serious threat to the environment.

[0003] Nitroglycerin wastewater not only may cause direct harm to the ecosystem due to its toxicity, but also due to its explosive and difficult-to-degrade characteristics, traditional wastewater treatment methods face huge challenges. Physical and chemical methods have obvious limitations in treating nitroglycerin wastewater, such as low efficiency, high cost, and potential secondary pollution problems.

[0004] Therefore, people have begun to explore safer, more economical, and effective wastewater treatment methods. Among them, the microbial treatment method has attracted much attention due to its environmental friendliness and high-efficiency degradation characteristics. The degradation of nitroglycerin may be a co-metabolic process, which means that sufficient growth substrates need to be provided during the treatment process, undoubtedly increasing the complexity of the treatment.

[0005] By deeply studying the biodegradation mechanism of nitroglycerin, developing more efficient and stable wastewater treatment technologies. It is urgent to find microbial populations or enzymes that can completely degrade nitroglycerin to achieve the high efficiency and safety of wastewater treatment. At the same time, the improvement and innovation of nitroglycerin wastewater treatment technology will also help reduce environmental pollution and protect the health of humans and the ecosystem. Summary of the Invention

[0006] To solve the above problems, the present invention provides a strain of Klebsiella sp. TYF-NHY-Klk001, its application, and a microbial agent. The Klebsiella TYF-NHY-Klk001 provided by the present invention can remove nitroglycerin and its metabolic intermediate products in a highly toxic environment caused by nitroglycerin.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides a strain of Klebsiella sp. TYF-NHY-Klk001, which was deposited with the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on November 06, 2024, and the deposit number is CGMCC NO. 32522.

[0009] The present invention also provides the application of the Klebsiella sp. TYF-NHY-Klk001 described in the above technical solution in degrading nitroglycerin.

[0010] The present invention also provides the application of the Klebsiella sp. TYF-NHY-Klk001 described in the above technical solution in degrading the intermediate products of nitroglycerin metabolism.

[0011] Preferably, the intermediate products of nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin.

[0012] The present invention also provides a microbial inoculant for degrading nitroglycerin and / or the intermediate products of nitroglycerin metabolism, and the microbial inoculant contains the Klebsiella sp. TYF-NHY-Klk001 described in the above technical solution;

[0013] The intermediate products of nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin.

[0014] Preferably, the effective viable count of Klebsiella sp. TYF-NHY-Klk001 in the microbial inoculant is 10 5 CFU / mL.

[0015] The present invention also provides the application of the microbial inoculant described in the above technical solution in degrading wastewater containing nitroglycerin and / or the intermediate products of nitroglycerin metabolism;

[0016] The intermediate products of nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin.

[0017] Preferably, the application includes the following steps: adding the microbial inoculant to the wastewater for degradation.

[0018] Preferably, the volume ratio of the microbial inoculant to the wastewater is 0.8 - 20:100.

[0019] Preferably, the degradation conditions include: the temperature is 28.2°C and the rotation speed is 140 rpm.

[0020] The beneficial effects of the present invention:

[0021] (1) The Klebsiella sp. strain TYF-NHY-Klk001 of the present invention can grow using nitroglycerin as the sole nitrogen source, can achieve the synchronous removal of nitroglycerin and its intermediate products, and has a high removal efficiency.

[0022] (2) The strain of the present invention still maintains good degradation activity in a highly toxic environment and can be used for various explosive and pharmaceutical wastewaters.

[0023] (3) The culture medium components required for the activation and expansion culture of the strain of the present invention are simple, and the process for preparing the bacterial liquid is relatively easy, which is beneficial to industrial production and subsequent applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0025] Figure 1 It is a phylogenetic tree of Klebsiella sp. TYF-NHY-Klk001;

[0026] Figure 2 It is a morphological characterization diagram of Klebsiella sp. TYF-NHY-Klk001;

[0027] Figure 3 It is a schematic diagram of nitroglycerin degradation by Klebsiella sp. TYF-NHY-Klk001 when using nitroglycerin as the sole nitrogen source;

[0028] Figure 4 It is a three-dimensional response surface diagram of the interactive effects of temperature, rotation speed, and initial nitroglycerin concentration on the degradation of nitroglycerin by Klebsiella sp. TYF-NHY-Klk001.

[0029] BIOLOGICAL DEPOSIT DESCRIPTION

[0030] Klebsiella sp. TYF-NHY-Klk001, with the Latin name Klebsiella sp.), was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on November 06, 2024, with the deposit number CGMCC NO. 32522, and the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, Postcode: 100101. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The present invention provides a strain of Klebsiella sp. TYF-NHY-Klk001, which was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on November 06, 2024, with the deposit number CGMCC NO. 32522.

[0032] The present invention also provides the application of Klebsiella sp. TYF-NHY-Klk001 described in the above technical solution in degrading nitroglycerin.

[0033] The present invention also provides the application of Klebsiella sp. TYF-NHY-Klk001 described in the above technical solution in degrading the intermediate products of nitroglycerin metabolism. In the present invention, the intermediate products of nitroglycerin metabolism preferably include dinitroglycerin and / or mononitroglycerin.

[0034] The present invention also provides a microbial agent for degrading nitroglycerin and / or the intermediate products of nitroglycerin metabolism, wherein the microbial agent contains Klebsiella sp. TYF-NHY-Klk001 described in the above technical solution; the intermediate products of nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin. In the present invention, the effective viable count of Klebsiella sp. TYF-NHY-Klk001 in the microbial agent is 1×10 5 CFU / mL. The present invention has no special limitation on the preparation method of the microbial agent, and the method for preparing a Klebsiella bacterium agent can be adopted, such as: inoculating Klebsiella sp. TYF-NHY-Klk001 into an inorganic salt medium containing nitroglycerin, and then placing it in a shaker at 30 °C and 140 rpm for activation. After it grows to the logarithmic phase, the activated bacterial liquid is inoculated into 100 ml of a liquid inorganic salt medium containing nitroglycerin at 5% by volume and cultured for 60 h, and the culture conditions are 30 °C and 140 rpm. In the present invention, the composition of the liquid inorganic salt medium containing 100 mg / L nitroglycerin is: 1.4 g L -1 K2HPO4, 0.8 g L -1 KH2PO4, 0.5 g L -1 NaCl, 0.12 g L -1 MgSO4·7H2O, 1 ml / L trace element solution (0.1 g L -1 H3BO3, 0.24 g L -1 FeCl3·6H20, 0.31 g L -1 ZnSO4·7H20O, 0.03 g L - 1 Na2MoO2·6H2O, 0.0228 g L -1 MnSO4·H2O, 0.06 g L -1 CuSO4·5H2O, 0.04 g L -1 CoCl2·6H2O, pH 7.0 ± 0.2.

[0035] The present invention also provides an application of the microbial inoculant as described in the above technical solution in degrading wastewater containing nitroglycerin and / or metabolic intermediates of nitroglycerin; the metabolic intermediates of nitroglycerin include dinitroglycerin and / or mononitroglycerin. In the present invention, the application preferably includes the following steps: adding the microbial inoculant to the wastewater for degradation. In the present invention, the volume ratio of the microbial inoculant to the wastewater is preferably 0.8-20:100. In the present invention, the conditions for degradation preferably include: the temperature is 28.2 °C and the rotation speed is 140 rpm.

[0036] In order to further illustrate the present invention, the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0037] (1) Strain source:

[0038] The strains screened in the experiment were derived from the aerobic tank packing and wastewater samples of Shanxi North Xing'an Wastewater Treatment Plant in Taiyuan City, Shanxi Province.

[0039] (2) Culture medium:

[0040] Beef extract peptone medium: beef extract 5 g / L, peptone 10 g / L, NaCl 5 g / L, pH 7.0 ± 0.2.

[0041] Inorganic salt medium (MSM): 1.4 g / L -1 K2HPO4, 0.8 g / L -1 KH2PO4, 0.5 g / L -1 NaCl, 0.12 g / L - 1 MgSO4·7H2O, 1 ml / L trace element solution (0.1 g / L -1 H3BO3, 0.24 g / L -1 FeCl3·6H20, 0.31 g / L -1 ZnSO4·7H20O, 0.03 g / L -1 Na2MoO2·6H2O, 0.0228 g / L -1 MnSO4·H2O, 0.06 g / L -1 CuSO4·5H2O, 0.04 g / L - 1 CoCl2·6H2O, pH 7.0 ± 0.2.

[0042] Phosphate buffer: 8 g / L -1 NaCl, 0.2 g / L -1 KCl, 0.24 g / L -1 KH2PO4, 1.44 g / L -1Na2HPO4, pH 7.0 ± 0.2.

[0043] Solid medium is added with 2% - 2.5% agar on the basis of the above medium. All media need to be sterilized by moist heat under high pressure at 121 °C for 30 min before use, and then cooled to room temperature for subsequent experiments.

[0044] (3) Main experimental instruments:

[0045] Constant temperature biochemical incubator, high-speed refrigerated centrifuge, constant temperature shaker, ultra-clean workbench, vertical pressure steam sterilizer, full-wavelength microplate reader, PCR instrument, etc.

[0046] Example 1

[0047] Screening of Klebsiella sp. TYF-NHY-Klk001.

[0048] (1) Enrichment of strains

[0049] 10 mL each of the retrieved packing material and wastewater sample were inoculated into a conical flask containing 90 mL of sterilized beef extract peptone medium, and cultured at 120 r / min and 30 °C for 5 d.

[0050] (2) Isolation and preservation of strains

[0051] In the ultra-clean workbench, the enriched culture solution was gradient-diluted with sterile water and then spread on the inorganic salt solid medium containing nitroglycerin. After standing for 30 min, the petri dish was inverted and placed in a constant temperature incubator at 30 °C for more than 48 h. Single colonies with different morphological characteristics were picked and inoculated into the inorganic salt liquid medium containing 100 mg / L nitroglycerin. After culturing at 140 r / min and 30 °C for 48 h, it was continuously streaked and purified on the plate. After repeating 3 times, the grown single colonies were inoculated into the nitrification liquid medium and cultured under the same conditions for 48 h, and then inoculated into the paraffin slant medium and stored refrigerated in a 4 °C refrigerator. At the same time, 500 μL of the bacterial solution was mixed with glycerol in a volume ratio of 1:1 and then stored frozen in an -80 °C refrigerator. Samples were taken to measure the nitroglycerin content in the culture solution, and strains that could efficiently degrade nitroglycerin were further screened for the next experiment.

[0052] (3) Re-screening of strains at higher nitroglycerin concentrations

[0053] The strains to be re-screened were inoculated into the liquid medium containing 200 mg / L nitroglycerin, and the strains to be re-screened were cultured under suitable conditions (30 °C, 140 rpm). At regular intervals (12 hours), the OD 600 value of each well was measured using a microplate reader, the growth situation of the strains was recorded, and the growth curves of the strains at this concentration were compared to screen out the strains that could grow well at higher nitroglycerin concentrations.

[0054] (4) Rescreening of strains under low temperature conditions

[0055] Inoculate each strain into the inorganic salt medium containing 200 mg / L nitroglycerin at an inoculation amount of 5%, and remove the original medium. Adjust the initial concentration of the bacterial liquid and sludge samples to the same. Add sludge to the blank medium as a control. Culture at 30 °C and 140 r / min for 48 h. Sample every 12 h to measure the nitroglycerin concentration, and set three parallel samples for each group. Finally, determine that the strain TYF-NHY-Klk001 with the best effect on degrading nitroglycerin is the target strain, and its colony morphology on the solid medium is as Figure 2 shown

[0056] Example 2

[0057] Molecular biological identification of strains

[0058] Inoculate the purified strain into the basic medium, culture at 140 r / min and 30 °C for more than 24 h. Use the bacterial liquid as a template, and select the universal primer pair 27F / 1492R as primers. The reaction conditions for PCR amplification are pre-denaturation at 95 °C for 5 min, denaturation at 94 °C for 30 s, renaturation at 57 °C for 30 s, extension at 72 °C for 90 s. Start cycling 30 times from the second step, then extend at 72 °C for 5 - 10 min, and finally store at 4 °C for 15 min

[0059] The upstream primer is 27F (SEQ ID No.1): 5’AGAGTTTGATCCTGGCTCAG 3’;

[0060] The downstream primer is 1492R (SEQ ID No.2): 5TACGGCTACCTTGTACGACTT 3’;

[0061] Entrust the 16S rDNA product obtained by PCR amplification to Sangon Biotech Co., Ltd. for first-generation sequencing. Submit the obtained sequence to the NCBI website and compare and analyze it with the existing strain data in the GenBank database. Then use BLAST (http: / / www.ncbi.nlm.nih.gov / blast / ) to search for strains with higher similarity. The homology of the strain to Klebsiella is as high as 99%. Then use the MEGA11.0 software to construct a phylogenetic tree in the Neighbor Joining manner, as Figure 1 shown, and further analyze the genus and species of the strain

[0062] The 16S rDNA sequence of Klebsiella TYF-NHY-Klk001 is as shown in SEQ ID No.3:

[0063]

[0064] Example 3

[0065] Performance test of Klebsiella sp. TYF-NHY-Klk001 for removing nitroglycerin as the sole nitrogen source

[0066] The TYF-NHY-Klk001 strain stored in a -80 °C refrigerator in Example 1 was inoculated into an inorganic salt medium containing 100 mg / L nitroglycerin, and then placed in a shaker at 30 °C for activation. After it grew to the logarithmic phase, the activated bacterial solution was inoculated into 100 mL of simulated wastewater with nitroglycerin as the sole nitrogen source (concentration of 100 mg / L) at 5% by volume and cultured for 48 h. The culture conditions were 30 °C and 140 r / min. Samples were taken at 0, 12, 24, 36, and 48 h respectively, and after centrifugation and filtration, the performance of the strain in degrading nitroglycerin was tested. The formula of the simulated wastewater was the same as that of the inorganic salt medium containing nitroglycerin described above. At the same time, the contents of possible products dinitroglycerin and mononitroglycerin during the degradation process were also detected. The method used to test the contents of nitroglycerin, dinitroglycerin, and mononitroglycerin was high performance liquid chromatography. The high performance liquid chromatography analysis conditions were as follows: a 4.6×250 mm Unitary C18 chromatographic column was used, the mobile phase was water:acetonitrile, with a ratio of 50:50, and the total flow rate was 0.8 mL / min. The ultraviolet wavelength was 214 nm, and the peak time of nitroglycerin was 2.5 min.

[0067] As Figure 3 shown, the removal efficiency of this strain for nitroglycerin reached the highest 85.5% at 36 h.

[0068] The removal efficiency formula is as follows:

[0069] (C1 - C2) / C1

[0070] C1 is the initial nitroglycerin concentration, and C2 is the nitroglycerin concentration at 36 h

[0071] When nitroglycerin is the sole nitrogen source in the medium, the strain can significantly reduce the concentration of nitroglycerin, and effectively decompose the intermediate products dinitroglycerin and mononitroglycerin during the degradation process. Among them, the degradation rate of dinitroglycerin reaches 54.2%, and the degradation rate of mononitroglycerin is 48.61%.

[0072] Example 4

[0073] Optimization of the conditions for Klebsiella sp. TYF-NHY-Klk001 to degrade nitroglycerin

[0074] By studying parameters such as temperature, rotation speed, and initial concentration of nitroglycerin, the optimal degradation efficiency of strain TYF-CJJ-P06 on nitroglycerin was investigated. The response surface method based on Box-Behnken design was used to derive the optimal values of these three parameters. In this example, the experimental design of these three parameters is shown in Table 1, and an inorganic salt medium containing 100 mg / L nitroglycerin was used. X1, X2, and X3 represent temperature, rotation speed, and initial concentration of nitroglycerin respectively, and they are each encoded as -1, 0, and 1 to represent different levels. Specifically, the three levels of temperature are 25 °C, 30 °C, and 35 °C; the three levels of rotation speed are 120 r / min, 150 r / min, and 180 r / min; and the three levels of the initial concentration of nitroglycerin are 0.6 mmol, 0.8 mmol, and 1.0 mmol. Design-Expert software (version 11) processed the results of 17 treatments. Design-Expert software was used to generate three-dimensional (3D) response surface plots. As Figure 4 shown, the optimization results indicate that when the time is 36 h, the temperature is 28.2 °C, the rotation speed is 140 rpm, and the initial concentration of nitroglycerin is 0.863 mM, the degradation rate of nitroglycerin is the highest, reaching 85.524%.

[0075] Table 1 Condition optimization design

[0076]

[0077]

[0078] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on this example without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Klebsiella sp. TYF-NHY-Klk001, characterized in that: The Klebsiella TYF-NHY-Klk001 was deposited in the General Microbiology Center of the China Microbiological Culture Management Committee on November 6, 2024, with the deposit number CGMCC NO.32522.

2. Use of the Klebsiella TYF-NHY-Klk001 according to claim 1 in degrading nitroglycerin.

3. Use of the Klebsiella TYF-NHY-Klk001 according to claim 1 in degrading intermediates of nitroglycerin metabolism.

4. The use according to claim 3, characterized in that: The intermediate products of nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin.

5. A microbial agent for degrading nitroglycerin and / or nitroglycerin metabolic intermediates, characterized in that: The microbial agent contains the Klebsiella TYF-NHY-Klk001 described in claim 1; The nitroglycerin metabolic intermediates include dinitroglycerin and / or mononitroglycerin.

6. The microbial agent according to claim 5, characterized in that: The effective viable count of Klebsiella TYF-NHY-Klk001 in the microbial agent is 1×10 5 CFU / mL.

7. Use of the microbial agent according to claim 5 or 6 in degrading wastewater containing nitroglycerin and / or nitroglycerin metabolic intermediates; The nitroglycerin metabolic intermediates include dinitroglycerin and / or mononitroglycerin.

8. The use according to claim 7, characterized in that: The application comprises the following steps: adding the microbial agent into wastewater for degradation.

9. The use according to claim 8, characterized in that: The volume ratio of the microbial agent to the wastewater is 0.8 to 20:

100.

10. The use according to claim 8, characterized in that: The degradation conditions include: a temperature of 28.2° C. and a rotation speed of 140 rpm.