Klebsiella sp. TYF-NHY-Klk002 as well as application and microbial agent thereof

Abstract

The invention relates to the technical field of microbial denitrification, in particular to a Klebsiella sp. TYF-NHY-Klk002 strain as well as an application and a microbial agent of the Klebsiella sp. TYF-NHY-Klk002 strain. The Klebsiella sp. TYF-NHY-Klk002 is preserved in the China General Microbiological Culture Collection Center on November 06, 2024, and the preservation number of the Klebsiella sp. TYF-NHY-Klk002 is CGMCC (China General Microbiological Culture Collection Center) NO.32523. The Klebsiella TYF-NHY-Klk002 strain can grow by using nitroglycerin as a sole nitrogen source, the nitroglycerin and intermediate products thereof can be synchronously removed, and the removal efficiency is high.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial denitrification, and particularly to a strain of Klebsiella sp. TYF-NHY-Klk002, its application, and a microbial agent. Background Art

[0002] Nitroglycerin (NG) is an organic nitrate widely used in the military industry. Since it does not occur naturally and has potential explosion hazards and high toxicity and pollution, it cannot be directly discharged into the environment.

[0003] Currently, there are generally three treatment methods for a large amount of nitrate ester-containing energetic waste generated during ammunition retirement or manufacturing processes internationally: one is to use traditional methods such as incineration, blasting, and recovering heat energy; the second is to actively develop various recycling technologies; the third is to consider its R3 (re-recovery / re-recycling / re-reuse) characteristics when designing new solid propellants and take it as the design goal of new propellants, which is more in line with the concept of green environmental protection. Physical and chemical methods have obvious limitations in treating nitroglycerin wastewater, such as low efficiency, high cost, and possible secondary pollution problems. Microbial treatment methods have attracted much attention due to their environmental friendliness and high-efficiency degradation characteristics.

[0004] By deeply studying the biodegradation mechanism of nitroglycerin and developing more efficient and stable wastewater treatment technologies. It is urgent to find microbial populations or enzymes that can completely degrade nitroglycerin to achieve the high efficiency and safety of wastewater treatment. Therefore, it is particularly important to screen out a strain of nitroglycerin highly degrading bacteria. Summary of the Invention

[0005] To solve the above problems, the present invention provides a strain of Klebsiella sp. TYF-NHY-Klk002, its application, and a microbial agent. The Klebsiella TYF-NHY-Klk002 provided by the present invention can remove nitroglycerin and its metabolic intermediate products in a highly toxic environment where nitroglycerin exists.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a strain of Klebsiella sp. TYF-NHY-Klk002, and the Klebsiella TYF-NHY-Klk002 was deposited with the China General Microbiological Culture Collection Center on November 06, 2024, with the deposit number CGMCC NO. 32523.

[0008] The present invention also provides the application of Klebsiella sp. TYF-NHY-Klk002 described in the above technical solution in the degradation of nitroglycerin.

[0009] The present invention also provides the application of Klebsiella sp. TYF-NHY-Klk002 described in the above technical solution in the degradation of intermediate products of nitroglycerin metabolism.

[0010] Preferably, the intermediate products of nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin.

[0011] The present invention also provides a microbial inoculum for degrading nitroglycerin and / or intermediate products of nitroglycerin metabolism, wherein the microbial inoculum contains Klebsiella sp. TYF-NHY-Klk002 described in the above technical solution 1;

[0012] The intermediate products of nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin.

[0013] Preferably, the effective viable count of Klebsiella sp. TYF-NHY-Klk002 in the microbial inoculum is 1×10 5 CFU / mL.

[0014] The present invention also provides the application of the microbial inoculum described in the above technical solution in the degradation of wastewater containing nitroglycerin and / or intermediate products of nitroglycerin metabolism;

[0015] The intermediate products of nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin.

[0016] Preferably, the application includes the following steps: adding the microbial inoculum to the wastewater for degradation.

[0017] Preferably, the volume ratio of the microbial inoculum to the wastewater is 0.8 - 20:100.

[0018] Preferably, the degradation conditions include: temperature is 30°C and rotation speed is 140 rpm.

[0019] Advantages of the present invention:

[0020] (1) The Klebsiella sp. TYF-NHY-Klk002 strain of the present invention can use nitroglycerin as the sole nitrogen source for growth, can achieve the synchronous removal of nitroglycerin and its intermediate products, and has a high removal efficiency;

[0021] (2) The strain of the present invention still maintains good degradation activity in a highly toxic environment and can be used for various explosive and pharmaceutical wastewaters;

[0022] (3) The culture medium components required for the activation and expansion culture of the strain of the present invention are simple, and the process for preparing the bacterial liquid is relatively easy, which is conducive to industrial production and subsequent applications.

[0023] Biological deposit description

[0024] Klebsiella sp. TYF-NHY-Klk002 was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on November 06, 2024, with the deposit number CGMCC NO. 32523. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, and the postal code is 100101. Description of the drawings

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0026] Figure 1 Phylogenetic tree of Klebsiella sp. TYF-NHY-Klk002;

[0027] Figure 2 Morphological characterization diagram of Klebsiella sp. TYF-NHY-Klk002;

[0028] Figure 3 Schematic diagram of nitroglycerin degradation by Klebsiella sp. TYF-NHY-Klk002 with nitroglycerin as the sole nitrogen source;

[0029] Figure 4 Schematic diagram of the degradation of dinitroglycerin and mononitroglycerin, the intermediate products of nitroglycerin, by Klebsiella sp. TYF-NHY-Klk002;

[0030] Figure 5 Schematic diagram of the co-occurrence network of Klebsiella sp. TYF-NHY-Klk002. Detailed implementation manners

[0031] The present invention provides a strain of Klebsiella sp. TYF-NHY-Klk002, which was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on November 06, 2024, with the deposit number CGMCC NO. 32523.

[0032] The present invention also provides the application of Klebsiella sp. TYF-NHY-Klk002 as described in the above technical solution in the degradation of nitroglycerin.

[0033] The present invention also provides the use of Klebsiella sp. TYF-NHY-Klk002 as described in the above technical solution in degrading the intermediate products of nitroglycerin metabolism. In the present invention, the intermediate products of nitroglycerin metabolism preferably include dinitroglycerin and / or mononitroglycerin.

[0034] The present invention also provides a microbial agent for degrading nitroglycerin and / or the intermediate products of nitroglycerin metabolism, and the microbial agent contains Klebsiella sp. TYF-NHY-Klk002 as described in the above technical solution; the intermediate products of nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin. In the present invention, the effective viable count of Klebsiella sp. TYF-NHY-Klk002 in the microbial agent is 1×10 5 CFU / mL. The present invention has no special limitation on the preparation method of the microbial agent, and the method for preparing a Klebsiella bacterium agent can be adopted, such as: inoculating Klebsiella sp. TYF-NHY-Klk002 into an inorganic salt medium containing nitroglycerin, and then placing it in a shaker at 30 °C and 140 rpm for activation. After it grows to the logarithmic phase, the activated bacterial liquid is inoculated into 100 ml of a liquid inorganic salt medium containing nitroglycerin at 5% by volume and cultured for 60 h, and the culture conditions are 30 °C and 140 rpm. In the present invention, the components of the liquid inorganic salt medium containing 120 mg / L nitroglycerin are: 1.4 g L -1 K2HPO4, 0.8 g L -1 KH2PO4, 0.5 g L -1 NaCl, 0.12 g L -1 MgSO4·7H2O, 1 ml / L trace element solution (0.1 g L -1 H3BO3, 0.24 g L -1 FeCl3·6H20, 0.31 g L -1 ZnSO4·7H20O, 0.03 g L -1 Na2MoO2·6H2O, 0.0228 g L -1 MnSO4·H2O, 0.06 g L -1 CuSO4·5H2O, 0.04 g L -1 CoCl2·6H2O, pH 7.0±0.2.

[0035] The present invention also provides an application of the microbial inoculum described in the above technical solution in degrading wastewater containing nitroglycerin and / or nitroglycerin metabolic intermediate products; the nitroglycerin metabolic intermediate products include dinitroglycerin and / or mononitroglycerin. In the present invention, the application preferably includes the following steps: adding the microbial inoculum to the wastewater for degradation. In the present invention, the volume ratio of the microbial inoculum to the wastewater is preferably 0.8 to 20:100. In the present invention, the conditions for degradation preferably include: the temperature is 30°C and the rotation speed is 140 rpm.

[0036] To further illustrate the present invention, the present invention will be described in detail below in conjunction with embodiments, but they cannot be construed as limiting the protection scope of the present invention.

[0037] (1) Strain source:

[0038] The strains screened in the experiment were derived from the aerobic tank packing and wastewater samples of Shanxi North Xing'an Wastewater Treatment Plant in Taiyuan City, Shanxi Province.

[0039] (2) Culture medium:

[0040] Beef extract peptone medium: beef extract 5 g / L, peptone 10 g / L, NaCl 5 g / L, pH 7.0 ± 0.2.

[0041] Inorganic salt medium (MSM): 1.4 g / L -1 K2HPO4, 0.8 g / L -1 KH2PO4, 0.5 g / L -1 NaCl, 0.12 g / L - 1 MgSO4·7H2O, 1 ml / L trace element solution (0.1 g / L -1 H3BO3, 0.24 g / L -1 FeCl3·6H20, 0.31 g / L -1 ZnSO4·7H20O, 0.03 g / L -1 Na2MoO2·6H2O, 0.0228 g / L -1 MnSO4·H2O, 0.06 g / L -1 CuSO4·5H2O, 0.04 g / L - 1 CoCl2·6H2O, pH 7.0 ± 0.2.

[0042] Phosphate buffer: 8 g / L -1 NaCl, 0.2 g / L -1 KCl, 0.24 g / L -1 KH2PO4, 1.44 g / L -1Na2HPO4, pH 7.0 ± 0.2.

[0043] Solid medium is added with 2%-2.5% agar on the basis of the above medium. All media need to be sterilized by moist heat under high pressure at 121 °C for 30 min before use, and then cooled to room temperature for subsequent experiments.

[0044] (3) Main experimental instruments:

[0045] Constant temperature biochemical incubator, high-speed refrigerated centrifuge, constant temperature shaker, ultra-clean workbench, vertical pressure steam sterilizer, full-wavelength microplate reader, PCR instrument, etc.

[0046] Example 1

[0047] Screening of Klebsiella sp. TYF-NHY-Klk002.

[0048] (1) Enrichment of strains

[0049] 10 mL each of the retrieved packing material and wastewater sample were inoculated into a conical flask containing 90 mL of sterilized beef extract peptone medium, and cultured at 120 r / min and 30 °C for 5 d.

[0050] (2) Isolation and preservation of strains

[0051] In the ultra-clean workbench, the enriched culture solution was serially diluted with sterile water and then spread on the inorganic salt solid medium containing nitroglycerin. After standing for 30 min, the petri dish was inverted and placed in a constant temperature incubator at 30 °C for more than 48 h. Single colonies with different morphological characteristics were picked and inoculated into the inorganic salt liquid medium containing nitroglycerin. After culturing at 140 r / min and 30 °C for 48 h, it was continuously streaked and purified on the plate. After repeating 3 times, the grown single colonies were inoculated into the nitrification liquid medium and cultured under the same conditions for 48 h, and then inoculated into the paraffin slant medium and stored refrigerated in a 4 °C refrigerator. At the same time, 500 μL of the bacterial solution was mixed with 50% glycerol at a ratio of 1:1 and stored frozen in an -80 °C refrigerator. Samples were taken to measure the nitroglycerin content in the culture solution, and strains that could efficiently degrade nitroglycerin were further screened for the next experiment.

[0052] (3) Re-screening of strains at higher nitroglycerin concentrations

[0053] The strains to be re-screened were inoculated into the liquid medium containing 200 mg / L nitroglycerin, and the strains to be re-screened were cultured under suitable conditions (30 °C, 140 rpm). At regular intervals (12 hours), the OD 600 value was measured using a microplate reader, the growth of the strains was recorded, the growth curves of the strains at this concentration were compared, and strains that could grow well at higher nitroglycerin concentrations were screened out.

[0054] (4) Rescreening of strains under low-temperature conditions

[0055] Inoculate each strain into a higher-concentration 200 mg / L nitroglycerin inorganic salt medium at an inoculation amount of 5%, removing the original medium, and adjusting the initial concentration of the bacterial liquid and sludge samples to be the same. Add sludge to the blank medium as a control, and culture at 30 °C and 140 r / min for 48 h. Sample every 12 h to measure the nitroglycerin concentration, and set three parallel samples for each group. Finally, determine the strain TYF-NHY-Klk002 with the best nitroglycerin degradation effect as the target strain, and its colony morphology on the solid medium is as Figure 2 shown.

[0056] Example 2

[0057] Molecular biological identification of strains

[0058] Inoculate the purified strain into the basic medium, culture at 140 r / min and 30 °C for more than 24 h. Use the bacterial liquid as a template, and select the universal primer pair 27F / 1492R. The reaction conditions for PCR amplification are pre-denaturation at 95 °C for 5 min, denaturation at 94 °C for 30 s, renaturation at 57 °C for 30 s, extension at 72 °C for 90 s. Start cycling 30 times from the second step, then extend at 72 °C for 5 - 10 min, and finally store at 4 °C for 15 min.

[0059] The upstream primer is 27F (SEQ ID No.1): 5’AGAGTTTGATCCTGGCTCAG 3’;

[0060] The downstream primer is 1492R (SEQ ID No.2): 5TACGGCTACCTTGTACGACTT 3’;

[0061] Entrust the 16S rDNA product obtained by PCR amplification to Sangon Biotech Co., Ltd. for first-generation sequencing. Submit the obtained sequence to the NCBI website and compare and analyze it with the existing strain data in the GenBank database. Then use BLAST (http: / / www.ncbi.nlm.nih.gov / blast / ) to search for strains with higher similarity. The homology of the strain to Klebsiella is as high as 99%. Then use the MEGA 11.0 software to construct a phylogenetic tree in the Neighbor Joining manner, as Figure 1 shown, and further analyze the genus and species of the strain.

[0062] The 16S rDNA sequence of Klebsiella TYF-NHY-Klk002 is as shown in SEQ ID No.3:

[0063]

[0064] Example 3

[0065] Performance test of Klebsiella sp. TYF-NHY-Klk002 for removing nitroglycerin as the sole nitrogen source:

[0066] The TYF-NHY-Klk002 strain stored in a -80 °C refrigerator in Example 1 was inoculated into an inorganic salt medium containing 100 mg / L nitroglycerin, and then placed in a shaker at 30 °C for activation. After it grew to the logarithmic phase, the activated bacterial solution was inoculated into 100 mL of simulated wastewater with nitroglycerin as the sole nitrogen source (concentration of 100 mg / L) at 5% by volume and cultured for 48 h. The culture conditions were 30 °C and 140 r / min. Samples were taken at 0, 12, 24, 36, and 48 h respectively. After centrifugation and filtration, the performance of the strain in degrading nitroglycerin was tested. The formula of the simulated wastewater was the same as that of the inorganic salt medium containing nitroglycerin described above. The method used to test the nitroglycerin content was liquid chromatography.

[0067] As Figure 3 shown, the removal efficiency of this strain for nitroglycerin reached the highest 83.6% at 36 h.

[0068] Example 4

[0069] Performance test of Klebsiella sp. TYF-NHY-Klk002 for degrading the intermediate products of nitroglycerin, dinitroglycerin and mononitroglycerin

[0070] The TYF-NHY-Klk002 strain stored in a -80 °C refrigerator in Example 1 was inoculated into an inorganic salt medium containing 100 mg / L nitroglycerin, and then placed in a shaker at 30 °C for activation. After it grew to the logarithmic phase, the activated bacterial solution was inoculated into 100 mL of simulated wastewater with nitroglycerin as the sole nitrogen source (concentration of 100 mg / L) at 5% by volume and cultured for 48 h. The culture conditions were 30 °C and 140 r / min. Samples were taken at 0, 12, 24, 36, and 48 h respectively. After centrifugation and filtration, the contents of dinitroglycerin and mononitroglycerin, which might appear during the degradation process, were detected. The formula of the simulated wastewater was the same as that of the inorganic salt medium containing nitroglycerin described above. The method used to test the contents of dinitroglycerin and mononitroglycerin was liquid chromatography. The high performance liquid chromatography analysis conditions were as follows: a 4.6×250 mm Unitary C18 chromatographic column was used, the mobile phase was water:acetonitrile, with a ratio of 50:50, the total flow rate was 0.8 mL / min. The ultraviolet wavelength was 214 nm, and the peak time of nitroglycerin was 2.5 min.

[0071] As Figure 4As shown, the removal efficiencies of this strain for dinitroglycerin and mononitroglycerin reached a maximum of 72.6% and 58.3% respectively within 48 h.

[0072] The formula for the removal efficiency is as follows:

[0073] (C1 - C2) / C1

[0074] C1 is the initial concentration of dinitroglycerin and mononitroglycerin

[0075] C2 is the concentration of dinitroglycerin and mononitroglycerin at 48 h

[0076] When nitroglycerin is the sole nitrogen source in the culture medium, the said strain can well reduce the concentration of nitroglycerin, and at the same time also degrade the intermediate products dinitroglycerin and mononitroglycerin.

[0077] Example 5

[0078] Schematic diagram of the co-occurrence network of Klebsiella sp. TYF-NHY-Klk002

[0079] By constructing a microbial co-occurrence network model, the functional metabolic profile of the nitroglycerin-degrading bacterium TYF-NHY-Klk002 was determined. As Figure 5 shown, it is the co-occurrence network of Klebsiella sp. TYF-NHY-Klk002, where each node represents a different type of carbon source, and the size of the node is proportional to the number of connections. The number of connections in the Klebsiella sp. TYF-NHY-Klk002 network is relatively high, and the modularity value is relatively small, being 420 and 0.018 respectively. The high connectivity of TYF-NHY-Klk002 may mean that TYF-NHY-Klk002 plays a core role in the co-metabolism process and can utilize a variety of carbon sources to obtain energy and nutrients.

[0080] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments without creative efforts based on this embodiment, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Klebsiella sp. TYF-NHY-Klk002, characterized in that: The Klebsiella TYF-NHY-Klk002 was deposited in the General Microbiology Center of the China Microbiological Culture Management Committee on November 6, 2024, with the deposit number CGMCC NO.32523.

2. Use of Klebsiella TYF-NHY-Klk002 according to claim 1 in degrading nitroglycerin.

3. Use of the Klebsiella TYF-NHY-Klk002 according to claim 1 in degrading intermediates of nitroglycerin metabolism.

4. The use according to claim 3, characterized in that: The intermediate products of nitroglycerin metabolism include dinitroglycerin and / or mononitroglycerin.

5. A microbial agent for degrading nitroglycerin and / or nitroglycerin metabolic intermediates, characterized in that: The microbial agent contains the Klebsiella TYF-NHY-Klk002 according to claim 1; The nitroglycerin metabolic intermediates include dinitroglycerin and / or mononitroglycerin.

6. The microbial agent according to claim 5, characterized in that: The effective viable count of Klebsiella TYF-NHY-Klk002 in the microbial agent is 1×10 5 CFU / mL.

7. Use of the microbial agent according to claim 5 or 6 in degrading wastewater containing nitroglycerin and / or nitroglycerin metabolic intermediates; The nitroglycerin metabolic intermediates include dinitroglycerin and / or mononitroglycerin.

8. The use according to claim 7, characterized in that: The application comprises the following steps: adding the microbial agent into wastewater for degradation.

9. The use according to claim 8, characterized in that: The volume ratio of the microbial agent to the wastewater is 0.8 to 20:

100.

10. The use according to claim 8, characterized in that: The degradation conditions include: temperature of 30° C. and rotation speed of 140 rpm.

Images