Variant of herbicide-resistant gene PPO as well as encoding protein and application thereof

Abstract

The invention provides a herbicide-resistant gene PPO variant as well as an encoding protein and application thereof, and belongs to the technical field of crop breeding. The coding amino acid sequence of the variant of the herbicide-resistant gene PPO is as shown in SEQ ID NO.2, and the nucleotide sequence of the variant of the herbicide-resistant gene PPO is as shown in SEQ ID NO.1. According to the variant of the herbicide-resistant gene PPO, the variant of the herbicide-resistant gene PPO for increasing chloroplast signal peptide is transferred into plants, the tolerance of the plants to PPO herbicides can be improved, the yield of the plants sprayed with the PPO herbicides is higher than that of the plants not sprayed with the PPO herbicides, and the variant of the herbicide-resistant gene PPO can be applied to crop breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of crop breeding, and particularly to a variant of the herbicide-tolerant gene PPO, its encoded protein, and applications thereof. Background Art

[0002] Weeds are one of the core factors affecting crop yields in agricultural production. Herbicides are the main technical means for controlling weeds. In plants, protoporphyrinogen oxidase (PPO) is an important target of herbicides. Inhibiting protoporphyrinogen oxidase in plants will cause the accumulation of the substrate protoporphyrinogen in cells for this reaction. The accumulation of protoporphyrinogen in chloroplasts and mitochondria in cells will cause the non-enzymatic oxidation of protoporphyrinogen by O2. Under light conditions, the non-enzymatic oxidation of protoporphyrinogen will generate singlet oxygen. Singlet oxygen will cause the oxidation of lipids in the intracellular membrane system and lead to the oxidative disintegration of these membrane systems, thereby killing plant cells. There are generally at least two PPO genes in plants, named PPO1 and PPO2 respectively. Among them, PPO1 is generally located in the chloroplasts of plants, while PPO2 is generally located in the mitochondria of plant cells. Since the 1960s, herbicides that inhibit protoporphyrinogen oxidase (referred to herein as Protox or PPO; EC: 1.3.3.4) (a key enzyme in the biosynthesis of protoporphyrin IX) have been used for selective control of weeds. PPO catalyzes the last common step in the biosynthesis of chlorophyll and heme, that is, the oxidation of protoporphyrinogen IX to protoporphyrin IX. (Matringe et al., 1989. Biochem. J. 260: 231).

[0003] Applying PPO-inhibiting herbicides causes the accumulation of protoporphyrinogen IX in chloroplasts and mitochondria. Protoporphyrinogen IX leaks into the cytoplasm, where it is oxidized by peroxidase. When exposed to light, protoporphyrin IX causes the formation of singlet oxygen and other reactive oxygen species in the cytoplasm, which may cause lipid peroxidation and membrane rupture, leading to rapid cell death (Lee et al., 1993. Plant Physiol. 102: 881).

[0004] Currently, there has been no report on plants tolerant to PPO-inhibiting herbicides in the prior art. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a variant of the herbicide-tolerant gene PPO, its encoded protein, and applications thereof. Transferring the variant of the herbicide-tolerant gene PPO into plants can improve the tolerance of plants to PPO herbicides, and the yield of plants after spraying PPO herbicides is higher than that of plants without spraying PPO herbicides.

[0006] Furthermore, the present invention develops a new type of corn seed that can resist PPO inhibitor herbicides. The flupropacil and glufosinate-ammonium mixed herbicide, and the benzobicyclon herbicide involved in the present invention are obtained by market collection.

[0007] To solve the existing problems of weed elimination and plant tolerance to PPO inhibitors, the present invention makes improvements to specific sites of the PPO amino acids of Lolium rigidum, and provides a method / application / product of a plant that can have enhanced tolerance to PPO inhibitors, achieving the effect of improving the tolerance of plants containing the gene of the present invention to specific herbicide categories.

[0008] Specifically, the present invention provides a variant of the herbicide-tolerant gene PPO, and the variant of the herbicide-tolerant gene PPO encodes a herbicide-tolerant protein PPO variant with an amino acid sequence shown in SEQ ID NO.2. The nucleotide sequence of the variant of the herbicide-tolerant gene PPO is shown in SEQ ID NO.1. The original sequence of the present invention is derived from the wild-type PPO sequence of Lolium rigidum Lolium rigidum.

[0009] Furthermore, the present invention also provides a recombinant expression vector containing a chloroplast signal peptide and the variant of the herbicide-tolerant gene PPO. A recombinant bacterium or recombinant cell is provided, and the recombinant bacterium or recombinant cell contains the above recombinant expression vector. The recombinant expression vector with an increased chloroplast signal peptide can make the transformed transgenic plants have higher tolerance to herbicides compared to only containing the variant of the herbicide-tolerant gene PPO, so that the transformed transgenic plants have higher yields during the process of spraying herbicides for planting.

[0010] The present invention also provides a method for constructing a transgenic plant, and the construction method is to transfer the variant of the herbicide-tolerant gene PPO into the original plant. The construction method includes the following steps: (1) Construct a recombinant expression vector; (2) Transform the recombinant expression vector into Agrobacterium tumefaciens; (3) Use the Agrobacterium tumefaciens infection method to transform the recombinant expression vector into the original plant.

[0011] The present invention also provides the application of the variant of the herbicide-tolerant gene PPO in improving the tolerance of plants to PPO-inhibiting herbicides.

[0012] Furthermore, the variant of the herbicide-tolerant gene PPO is applied to crop breeding, and the crops include but are not limited to crops such as corn, soybean, rice, sorghum, wheat, etc.

[0013] Compared with the prior art, the beneficial effects of the present invention: The present invention provides a variant of the herbicide-tolerant gene PPO. Transferring the variant of the herbicide-tolerant gene PPO into plants can improve the tolerance of plants to PPO herbicides, and the yield after spraying PPO herbicides is higher than that of plants without spraying PPO herbicides. Brief Description of the Drawings

[0014] Figure 1 It is a schematic diagram of the vector of the present invention.

[0015] Figure 2 It is a graph showing the results of the tolerance of transgenic PPO to herbicides and the results of maize yield.

[0016] Figure 3 It is a graph showing the results of the tolerance of transgenic PPO to herbicides and the results of soybean yield. Detailed Embodiments

[0017] To better understand the technical content of the present invention, specific embodiments are provided below. Unless otherwise specified, the technical means used in the embodiments are all conventional methods. The reagents used in the embodiments can be obtained from commercial sources without special instructions. Example 1

[0018] 1. Construction, preservation and detection of recombinant expression vectors Nanjing Genscript Biotech Co., Ltd. synthesized a variant of the herbicide-tolerant gene PPO with the nucleotide sequence shown in SEQ ID NO.1 and the wild-type nucleotide sequence of the herbicide-tolerant gene PPO, respectively. The 5' end of the synthesized nucleotide sequence was also ligated with an NcoI restriction site, and the 3' end was also ligated with an EcoR I restriction site.

[0019] The synthesized nucleotide sequence shown in SEQ ID NO.1 was ligated into the cloning vector pEASY-T5 (TransGen Biotech Co., Ltd., Cat. No: CT501-01). The operation steps were carried out according to the pEASY-T5 vector product manual to obtain the LP01-T vector. Then, the recombinant cloning vector LP01-T was transformed into Escherichia coli T1 competent cells (TransGen Biotech Co., Ltd., Cat. No: CD501) by heat shock method. The heat shock conditions were as follows: 1) 50 μL of Escherichia coli T1 competent cells and 10 μL of plasmid DNA (recombinant cloning vector LP01-T) were incubated in a 42°C water bath for 30 s, followed by a 37°C water bath for 45 min (shaking on a shaker at 200 rpm), and then spread on an LB plate containing ampicillin (100 mg / L) (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L, pH adjusted to 7.5 with NaOH) and grown overnight.

[0020] 2) White colonies were picked and cultured overnight in LB liquid medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, ampicillin 100 mg / L, pH adjusted to 7.5 with NaOH) at 37°C.

[0021] 3) The plasmid was extracted by the alkaline lysis method: The bacterial solution was centrifuged at 12,000 rpm for 1 min, the supernatant was removed, and the precipitated cells were suspended in 100 μL of ice-precooled Solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH 8.0); 150 μL of freshly prepared Solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)) was added, the tube was inverted 4 times to mix, and placed on ice for 3 - 5 min; 150 μL of ice-cold Solution III (4 M potassium acetate, 2 M acetic acid) was added, immediately mixed thoroughly, and placed on ice for 5 - 10 min; centrifuged at 4°C and 12,000 rpm for 5 min, 2 volumes of absolute ethanol were added to the supernatant, mixed well and left at room temperature for 5 min; centrifuged at 4°C and 12,000 rpm for 5 min, the supernatant was discarded, the precipitate was washed with 70% ethanol by mass concentration and then air-dried; 30 μL of TE containing Rnase (20 μg / mL) (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) was added to dissolve the precipitate; incubated in a 37°C water bath for 30 min to digest RNA; stored at -20°C for further use.

[0022] After the extracted plasmid was identified by digestion with Nco I and EcoR I enzymes, the positive clones were verified by sequencing. The results showed that the nucleotide sequence inserted in the recombinant cloning vector LP01-T was the nucleotide sequence of the PPO variant shown in SEQ ID NO.1 in the sequence listing, that is, the PPO variant nucleotide sequence was correctly inserted.

[0023] The recombinant cloning vector LP01-T and the expression vector LP-BB1 (vector backbone: pCAMBIA3301 (available from CAMBIA)) were digested with the restriction endonucleases Nco I and EcoR I respectively. The excised PPO nucleotide sequence fragment was inserted between the Nco I and EcoR I sites of the expression vector LP-BB1 to construct the recombinant expression vector LP-PT03. The vector map is as shown in Figure 1 where KanR: kanamycin gene; Ori: pUC origin represents the replication region sequence of plasmid pUC, which can guide the double-stranded DNA replication process; RB: right border; pZmUbi1: promoter from the maize ubiquitin gene (SEQ ID NO.3); PPO: PPO variant nucleotide sequence (SEQ ID NO.1); Nos: terminator of nopaline synthase (SEQ ID NO.4); pZmUbi1: promoter from the maize ubiquitin gene (SEQ ID NO.3); PAT: phosphinothricin acetyltransferase, used for transformation screening and conferring glufosinate herbicide resistance to transgenic plants (SEQ ID NO.5); 35S: terminator from cauliflower mosaic virus (CaMV) (SEQ ID NO.6); LB: left border.

[0024] The nucleotide sequence of the PPO variant gene SEQ ID NO:1 is as follows: The amino acid sequence of the PPO variant protein, SEQ ID NO:2, is as follows: MVGASMALATVTAALPLRVRVPGRSRRGQARCAVASDATEAPAAPSARLSADCVIVGGGISGLCTAQALATKYGVSDLLVTEARARPGGNITTVERPDEGYLWEEGPNSFQPSDPVLTMAVDSGLKDELVFGDPNAPAFVLWEGKLRPVPSKPGDLPFFDLMSIPGKLRAGLGALGIRPPPPGREESVEEFVRRNLGAEVFERLIEPFCSGVYAGDPSKLSMRAAFGKVWRLEENGGSIIGGTIKAIQDKGKNPKPPRDPRLPAPKGQTVASFRKGLAMLPNAIASRLGSKVKLSWKLTSITKSENQGYVLGYETPEGVVSVQAKSVIMTIPSYIASDILRPLSSDAADGLSKFYYPPVAAVTVSYPKEAIRKECLIDGELQGFGQLHPRSQGVETLGTIYSSSLFPNRAPAGRVLLLNVIGGATNTGIVSKTESDLVEAVDRDLRKMLINPRAADPLALGVRVWPQAIPQFLIGHLDRLDAAKSALVRSGCSGLFLGGNYVAGVALGRCIEGAYDSASEVTDFINKYAYK** The sequence of the maize ubiquitin gene promoter, SEQ ID NO:3, is as follows: The sequence of the tNOS terminator, SEQ ID NO:4, is as follows: Gatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatc The sequence of PAT, SEQ ID NO:5, is as follows: atgtctccggagaggagaccagttgagattaggccagctacagcagctgatatggccgcggtttgtgatatcgttaaccattacattgagacgtctacagtgaactttaggacagagccacaaacaccacaagagtggattgatgatctagagaggttgcaagatagatacccttggttggttgctgaggttgagggtgttgtggctggtattgcttacgctgggccctggaaggctaggaacgcttacgattggacagttgagagtactgtttacgtgtcacataggcatcaaaggttgggcctaggatccacattgtacacacatttgcttaagtctatggaggcgcaaggttttaagtctgtggttgctgttataggccttccaaacgatccatctgttaggttgcatgaggctttgggatacacagcccggggtacattgcgcgcagctggatacaagcatggtggatggcatgatgttggtttttggcaaagggattttgagttgccagctcctccaaggccagttaggccagttacccagatctga The sequence of the 35s terminator, SEQ ID NO:6, is as follows: Ctgaaatcaccagtctctctctacaaatctatctctctctataataatgtgtgagtagttcccagataagggaattagggttcttatagggtttcgctcatgtgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtgg; The original sequence of Lolium rigidum PPO1, SEQ ID NO.11, is as follows:: MVGATMATATITTALPLRLRVPARSRRGQTRCAVASDATEAPAAPSARLSADCVIVGGGISGLCTAQALATKYGVSDLLVTEARARAGGNITTVERPDEGYLWEEGPNSFQPSDPVLTMAVDSGLKDDLVFGDPNAPRFVLWQGKLRPVPSKPGDLPFFDLMSIPGKLRAGLGALGIRPPPPGREESVEEFVRRNLGAEVFERLIEPFCSGVYAGDPSKLSMRAAFGKVWRLEENGGSIIGGTIKAIQDRGKNPKPPRDPRLPTPKGQTVASFRKGLAMLPNAIASRLGSKVKLSWKLTSITKSDNQGYVLAYETPEGVVSVQAKSVIMTIPSYIASEILRPLSSDAADGLSKFYYPPVAAVTVSYPTEAIRKECLIDGELQGFGQLHPRSQGVETLGTIYSSSLFPNRAPAGRVLLLNYIGGATNTGIVSKTESDLVEAVDRDLRKMLINPTAPDPLALGVRVWPQAIPQFLIGHLDRLDAAKSALARGGCSGLFLGGNYVAGVALGRCIEGAYESASEVSDFLTKYAYK The sequence of the chloroplast signal peptide sequence ZmCTP, SEQ ID NO:12, is as follows tctagaggatcagcatggcgcccaccgtgatgatggcctcgtcggccaccgccgtcgctccgttccaggggctcaagtccaccgccagcctccccgtcgcccgccgctcctccagaagcctcggcaacgtcagcaacggcggaaggatccggtgcatgcaggtaacaaatgcatcctagctagtagttctttgcattgcagcagctgcagctagcgagttagtaataggaagggaactgatgatccatgcatggactgatgtgtgttgcccatcccatcccaattcccaaccccaaacgaaccaaaacacacgtactacgtgcaggtgtggccggcctacggcaacaagaagttcgagacgctgtcgtacctgccgccgctgtcgaccggcgggcgcatccgctgcatgcaggcc Example 2

[0025] 2.1 Plant transformation and detection Transformation was carried out using the conventional Agrobacterium infection method. The sterile cultured transgenic maize / soybean immature embryos were co-cultured with the Agrobacterium described in Example 1 of the present invention to transfer the T-DNA in the constructed recombinant expression vector LP-PT03 into the plant chromosome group to generate transgenic maize events.

[0026] For Agrobacterium-mediated maize transformation, immature embryos are isolated from maize and contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transferring the nucleic acid sequence of the PPO gene and the nucleic acid sequence of the PAT gene to at least one cell of one of the immature embryos (Step 1: Infection step). In this step, the immature embryos are specifically immersed in the Agrobacterium suspension (OD660 = 0.4 - 0.6, infection medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 68.5 g / L sucrose, 36 g / L glucose, 40 mg / L acetosyringone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), pH 5.3)) to initiate inoculation. The immature embryos are co-cultured for a period of time (3 days) (Step 2: Co-cultivation step). Specifically, the immature embryos are cultured on a solid medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 20 g / L sucrose, 10 g / L glucose, 100 mg / L acetosyringone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 8 g / L agar, pH 5.8) after the infection step. After this co-cultivation stage, there can be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (such as cefotaxime) is present in the recovery medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 30 g / L sucrose, 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 3 g / L phytagel, pH 5.8), and the selection agent for the plant transformant is not added (Step 3: Recovery step). Specifically, the immature embryos are cultured on a solid medium with antibiotics but without the selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Then, the inoculated immature embryos are cultured on a medium containing the selection agent (N-(phosphonomethyl)glycine) and the growing transformed calli are selected (Step 4: Selection step). Specifically, the immature embryos are cultured on a screening solid medium with the selection agent (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 30 g / L sucrose, 0.25 mol / L N-(phosphonomethyl)glycine, 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 3 g / L phytagel, pH 5.8), resulting in the selective growth of the transformed cells. Then, the calli are regenerated into plants (Step 5: Regeneration step). Specifically, the calli growing on the medium containing the selection agent are cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate plants.

[0027] The selected resistant calli were transferred onto an MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonomethyl)glycine 0.125 mol / L, phytagel 3 g / L, pH = 5.8) and cultured for differentiation at 25°C. The differentiated seedlings were transferred onto an MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH = 5.8) and cultured at 25°C until they grew to about 10 cm in height, and then transferred to the greenhouse for cultivation until fruiting. In the greenhouse, they were cultured at 28°C for 16 hours per day and then at 20°C for 8 hours per day.

[0028] For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds of the JACK variety are germinated in soybean germination medium (3.1 g / L B5 salts, B5 vitamins, 20 g / L sucrose, 8 g / L agar, pH 5.6). The seeds are inoculated on the germination medium and cultured under the following conditions: temperature 25 ± 1 °C; photoperiod (light / dark) 16 / 8 h. After 4 - 6 days of germination, fresh green and swollen cotyledonary node explants of soybean aseptic seedlings are taken, and the hypocotyl is cut off 3 - 4 mm below the cotyledonary node. The cotyledons are longitudinally cut, and the apical bud, lateral buds, and seed roots are removed. The cotyledonary node is wounded with the back of a scalpel, and the wounded cotyledonary node tissue is contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the nucleotide sequence of the PAT gene to the wounded cotyledonary node tissue (Step 1: Infection step). In this step, the cotyledonary node tissue is preferably immersed in the Agrobacterium suspension (OD660 = 0.5 - 0.8, infection medium (2.15 g / L MS salts, B5 vitamins, 20 g / L sucrose, 10 g / L glucose, 40 mg / L acetosyringone (AS), 4 g / L 2-(N-morpholino)ethanesulfonic acid (MES), 2 mg / L zeatin (ZT), pH 5.3)) to initiate infection. The cotyledonary node tissue is co-cultured for a period (3 days) (Step 2: Co-culture step). Preferably, the cotyledonary node tissue is cultured on a solid medium (4.3 g / L MS salts, B5 vitamins, 20 g / L sucrose, 10 g / L glucose, 4 g / L 2-(N-morpholino)ethanesulfonic acid (MES), 2 mg / L zeatin, 8 g / L agar, pH 5.6) after the infection step. After this co-culture stage, there is an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (150 - 250 mg / L cefotaxime) is present in the recovery medium (3.1 g / L B5 salts, B5 vitamins, 1 g / L 2-(N-morpholino)ethanesulfonic acid (MES), 30 g / L sucrose, 2 mg / L zeatin (ZT), 8 g / L agar, 150 mg / L cefotaxime, 100 mg / L glutamic acid, 100 mg / L aspartic acid, pH 5.6), and the selection agent for plant transformants is not added (Step 3: Recovery step). Preferably, the regenerated tissue pieces of the cotyledonary node are cultured on a solid medium with antibiotics but without the selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Then, the regenerated tissue pieces of the cotyledonary node are cultured on a medium containing the selection agent (glufosinate) and the growing transformed calli are selected (Step 4: Selection step).Preferably, the tissue blocks regenerated from the cotyledon nodes are cultured on a selective solid medium (B5 salts 3.1 g / L, B5 vitamins, 2-(N-morpholino)ethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, ammonium glufosinate 10 mg / L, pH 5.6) with a selective agent, so that the transformed cells can continue to grow. Then, the transformed cells are regenerated into plants (Step 5: regeneration step). Preferably, the tissue blocks regenerated from the cotyledon nodes grown on the medium containing the selective agent are cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants. The selected resistant tissue blocks are transferred to the B5 differentiation medium (B5 salts 3.1 g / L, B5 vitamins, 2-(N-morpholino)ethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, zeatin (ZT) 1 mg / L, agar 8 g / L, cefotaxime 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, ammonium glufosinate 10 mg / L, pH 5.6) and cultured at 25 °C for differentiation. The differentiated seedlings are transferred to the B5 rooting medium (B5 salts 3.1 g / L, B5 vitamins, 2-(N-morpholino)ethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, agar 8 g / L, cefotaxime 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L), cultured on the rooting medium at 25 °C until about 10 cm tall, and then transferred to the greenhouse for cultivation until fruiting. In the greenhouse, it is cultured at 26 °C for 16 hours per day and then at 20 °C for 8 hours. 2.2 Detection of transgenic plants 1. Use the 2×EasyTaq PCR SuperMix (Cat. No: AS111-11) of TransGen Biotech Co., Ltd. in Beijing to verify the transgenic plants into which the PPO gene has been transferred by ordinary PCR The primers for PCR are: PPO-F: 5'-CTAGTATGGTGGGCGCTAGC-3' (SEQ ID NO:7); PPO-R: 5'-TCACTTGTAGGCGTACTTGTTG-3' (SEQ ID NO:8).

[0029] The size of the PCR detection fragment: 1596 bp The conditions for the PCR reaction are: 30 cycles, and each cycle is 95 °C for 30 s; 58 °C for 30 s; 72 °C for 40 s.

[0030] 2. Verification of plants transfected with the PPO gene by qRT-PCR Approximately 100 mg of leaves were taken from maize plants transfected with the PPO nucleotide sequence (SEQ ID NO.1) as samples, and their genomic DNA was extracted using the EasyPure Plant Genomic DNA Kit (containing RNase A) (Cat. No: EE111-01) from TransGen Biotech Co., Ltd. The copy number of the PPO gene was detected by the TransStart Green fluorescence quantitative PCR method. At the same time, wild-type plants were used as controls and detected and analyzed according to the above method. The experiment was repeated 3 times and the average value was taken.

[0031] The specific method for detecting the copy number of the PPO gene is as follows: 1) Take 100 mg of leaves from the plants transfected with the PPO nucleotide sequence and the wild-type plants respectively, grind them into homogenates in a mortar with liquid nitrogen, and take 3 replicates for each sample; 2) Use the EasyPure Plant Genomic DNA Kit (containing RNase A) from TransGen Biotech Co., Ltd. to extract the genomic DNA of the above samples, and refer to its product manual for the specific method; 3) Measure the concentration of the genomic DNA of the above samples with NanoDrop 2000 (Thermo Scientific); 4) Adjust the concentration of the genomic DNA of the above samples to the same concentration value, and the range of the concentration value is 80-100 ng / μL; 5) Use the TransStart Green fluorescence quantitative PCR method to identify the copy number of the samples. Samples with known copy numbers identified are used as standards, and samples of wild-type maize plants are used as controls. Each sample has 3 replicates and the average value is taken; the primer and probe sequences for fluorescence quantitative PCR are as follows: The following primers are used to detect the PPO nucleotide sequence: Primer 1 (qF1): 5'-AAGCTCACCAGCATCACGAA-3' (SEQ ID NO.9); Primer 2 (Qr1): 5'-GAGCTGGAGTAGATCGTGCC-3' (SEQ ID NO.10); The PCR reaction system is: 2×TransStartR Green qPCR SuperMix (Transgen) 10 μL; 1 μL of 10 μM forward primer; 1 μL of 10 μM reverse primer; 0.4 μL of Passive Reference Dye I (50X); 2 μL of genomic DNA; 5.6 μL of water (ddH2O); The PCR reaction conditions are as follows: Step Temperature Time 1 95°C 5 min; 2 95°C 30 s; 3 60°C 1 min; Return to step 2 and repeat 40 times.

[0032] Analyze the data using SDS 2.3 software (Applied Biosystems).

[0033] The test results show that the PPO nucleotide sequence has been integrated into the genome of the tested transgenic plants, and all the transgenic plants into which the PPO nucleotide sequence has been transferred are transgenic plants containing a single copy of the PPO gene.

[0034] Example 3

[0035] Transgenic maize herbicide resistance test In this experiment, two herbicides were selected for spraying, namely Qingyuan Nongguan Kuairufeng (a non-selective herbicide formulated by mixing flupoxam and glufosinate-ammonium with two different modes of action) and Jiangshan Chemical's bencarbazone (a 10% contact herbicide). A randomized block design was adopted with 3 replicates. The plot area was 15 m2 (5 m × 3 m), the row spacing was 60 cm, the plant spacing was 25 cm, and conventional cultivation management was carried out. There was a 1 m wide isolation belt between plots. The following two treatments were carried out for each transgenic maize event: 1) without spraying; 2) spraying the above two herbicides at the V3 leaf stage at a rate of 360 g / acre of Kuairufeng herbicide (4 times the recommended dose concentration) and 160 ml / acre of bencarbazone herbicide (4 times the recommended dose concentration). It should be noted that herbicides with different contents and formulations are converted into the form of equivalent active ingredients for the following conclusions. The phytotoxicity symptoms were investigated 1 week and 2 weeks after application, and the yield of the plot was measured at harvest. The classification criteria for phytotoxicity of herbicides are shown in Table 1. The herbicide injury rate was used as an index to evaluate the herbicide tolerance of the transgenic events. Specifically, the herbicide injury rate (%) = ∑(number of plants damaged at the same level × level number) / (total number of plants × highest level); where the herbicide injury rate refers to the herbicide injury rate, and the injury rate was determined based on the phytotoxicity investigation results 2 weeks after herbicide treatment. The maize yield of each plot was the total yield (weight) of the corn kernels in the middle 3 rows of each plot, and the yield difference between different treatments was measured in the form of a yield percentage. The yield percentage (%) = sprayed yield / unsprayed yield. The results of herbicide tolerance and maize yield of transgenic PPO maize are as Figure 2 shown in Table 2.

[0036] Table 1 Classification criteria for the phytotoxicity degree of herbicides

[0037] Table 2 Results of herbicide tolerance and maize yield of transgenic maize events

[0038] Example 4. Herbicide resistance test of transgenic soybeans In this experiment, two herbicides were used for spraying, namely Qingyuan Agro-Crown Quick Wind (a herbicide made by mixing two herbicides with different mechanisms of action, fluazifop-butyl and glufosinate-ammonium) and Jiangshan Chemical Benpyraclostrobin (a 10% contact herbicide). A randomized block design was adopted with three replications. The row spacing was 1 m, the plant spacing was 10 cm, and conventional cultivation management was carried out. There was a 1-m wide isolation zone between the plots. Each transgenic soybean was subjected to the following two treatments: 1) no spraying; 2) the two herbicides were sprayed at the V3 leaf stage at 360 g / mu of Quick Wind herbicide (4 times the recommended dose) and 160 ml / mu of Benpyraclostrobin (4 times the recommended dose). It should be noted that the conversion of herbicides with different contents and dosage forms into the form of equivalent effective ingredients is applicable to the following conclusions. The symptoms of drug damage were investigated 1 week and 2 weeks after drug application, and the yield of the plot was measured at harvest. The classification of drug damage symptoms is shown in Table 1.

[0039] The herbicide damage rate is used as an evaluation index to assess the herbicide tolerance of the transformation event. Specifically, the herbicide damage rate (%) = ∑ (number of damaged plants at the same level × number of levels) / (total number of plants × highest level); the herbicide damage rate refers to the herbicide damage rate, and the damage rate is determined based on the results of the herbicide damage survey 2 weeks after the herbicide treatment. The soybean yield of each plot is the total soybean yield (weight) of the 3 middle rows of each plot. The yield difference between different treatments is measured in the form of yield percentage. Yield percentage (%) = spraying yield / no spraying yield. The results of transgenic PPO soybeans' tolerance to herbicides and soybean yield results are shown in Figure 2. Figure 3 , as shown in Table 3.

[0040] Table 3 Results of herbicide tolerance and soybean yield of transgenic soybean events

[0041] The results showed that the transgenic corn and soybeans transferred to the optimized / modified PPO variants showed significantly higher tolerance to herbicides such as fluazifop-butyl, glufosinate-ammonium and benzylpyrazone in the field than the wild-type original sequence transgenic plants. The tolerance of transgenic soybeans and corn to herbicides such as fluazifop-butyl, glufosinate-ammonium and benzylpyrazone was further significantly improved after adding the signal peptide. Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. The changes, modifications, additions or substitutions made by ordinary technicians in the technical field within the essential scope of the present invention should all belong to the protection scope of the present invention.

Claims

1. A variant of the herbicide - tolerant gene PPO, characterized in that, A variant of the herbicide - tolerant gene PPO encodes a variant of the herbicide - tolerant protein PPO, the amino acid sequence of which is shown in SEQ ID NO.

2.

2. The variant of the herbicide-tolerant gene PPO according to claim 1, characterized in that, The nucleotide sequence of the variant of the herbicide - tolerant gene PPO is shown in SEQ ID NO.

1.

3. A variant of the herbicide-tolerant protein PPO, characterized in that: The amino acid sequence of the variant of the herbicide - tolerant protein PPO is shown in SEQ ID NO:

2.

4. A recombinant expression vector, characterized in that 1) It contains the variant of the herbicide - tolerant gene PPO described in claim 1 or 2; 2) It contains a chloroplast signal peptide sequence, which is shown in SEQ ID NO:

12.

5. A recombinant bacterium or recombinant cell, characterized in that: The recombinant bacterium or recombinant cell contains the recombinant expression vector described in claim 4.

6. A method for constructing a transgenic plant, characterized in that: The construction method is to transfer the variant of the herbicide - tolerant gene PPO described in claim 1 or 2 into the original plant.

7. The construction method according to claim 6, characterized in that: The transgenic plants are selected from transgenic maize, transgenic soybean, transgenic rice, transgenic sorghum, transgenic wheat.

8. The construction method according to claim 6 or 7, characterized in that, The construction method comprises the following steps: (1) Construct the recombinant expression vector described in claim 4; (2) Transform the recombinant expression vector into Agrobacterium tumefaciens; (3) Use the Agrobacterium - mediated infection method to transform the recombinant expression vector into the original plant.

9. Use of the variant of the herbicide - tolerant gene PPO described in claim 1 or 2 in improving the tolerance of plants to PPO - inhibiting herbicides.

Images