Construction method and application of lactococcus lactis for recombinant expression of LEK peptide
By constructing Lactococcus lactis for recombinant expression of LEK peptide, the problem of side effects of long-term use of lipid-lowering drugs was solved, and the effect of efficient and safe improvement of hyperlipidemia was achieved.
Patent Information
- Application Number
- CN202510387205.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-07-01
AI Technical Summary
The long-term use of blood lipid-lowering drugs in the prior art has side effects, and it is difficult to effectively and safely improve hyperlipidemia.
By constructing Lactococcus lactis for recombinant expression of LEK peptides, the recombinant plasmid was transferred into Lactococcus lactis to achieve the expression and production of LEK peptides.
The constructed recombinant Lactococcus lactis is highly safe, does not contain endotoxins and has probiotic properties, can be eaten directly without side effects, and the LEK peptide it expresses significantly improves blood lipid levels and has wide application prospects.
Smart Images

Figure CN120230775A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of recombinant microorganism, in particular to a construction method and application of Lactococcus lactis for recombinant expression of LEK peptide. Background Art
[0002] Hyperlipidemia is a metabolic disease characterized by abnormal elevation of plasma lipids and lipoproteins, manifested as significant changes in the levels of total cholesterol, triglyceride, low-density lipoprotein and high-density lipoprotein in plasma. This disease is not only an important risk factor for atherosclerosis, but also closely related to the occurrence and development of various inflammatory diseases. Although the commonly used drugs for treating hyperlipidemia can reduce blood lipid levels, long-term use has obvious side effects. Summary of the Invention
[0003] Aiming at the technical problem that long-term use of blood lipid-lowering drugs has side effects in the prior art, the present invention provides a construction method and application of Lactococcus lactis for recombinant expression of LEK peptide.
[0004] The technical solution adopted by the present invention is as follows: A construction method of Lactococcus lactis for recombinant expression of LEK peptide specifically includes the following steps:
[0005] S01: Codon optimization of LEK peptide gene: Optimize the LEK peptide gene sequence according to the codon preference of Lactococcus lactis;
[0006] S02: Construction of recombinant plasmid pNZ8148-LEK: Use the designed specific primers to amplify the LEK peptide gene fragment by polymerase chain reaction (PCR), then use restriction endonucleases NcoⅠ and HindⅢ to double-digest the pNZ8148 plasmid, and then mix and ligate the digested plasmid with the LEK peptide gene fragment, and finally synthesize the recombinant plasmid pNZ8148-LEK;
[0007] S03: Construction of recombinant Lactococcus lactis, including the following steps:
[0008] Electroporation of recombinant plasmid:
[0009] Take out the Lactococcus lactis competent cells stored at -80°C, thaw on ice and gently mix with the recombinant plasmid and let stand for 5 minutes. Transfer the mixture to a pre-cooled electroporation cuvette, apply an electric shock, and then quickly add the recovery medium. Transfer to a centrifuge tube for recovery culture, and spread the recovery solution on a GM17 resistant plate containing chloramphenicol for culture, and screen out positive transformants from it;
[0010] PCR verification of positive transformants:
[0011] Perform colony PCR on the screened positive transformants to confirm the success of transformation;
[0012] Sequencing verification of positive transformants:
[0013] The positive transformants qualified by PCR were inoculated into GM17 medium for overnight culture, and plasmids were extracted for sequencing to verify the correctness of the sequence. After confirming the results, qualified positive transformants were selected for glycerol preservation;
[0014] The present invention is further configured as an application of Lactococcus lactis for recombinant expression of LEK peptide in the preparation of lipid-lowering drugs.
[0015] The present invention is further configured as an application of Lactococcus lactis for recombinant expression of LEK peptide in health foods.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: The recombinant Lactococcus lactis constructed in the present invention, as a food-grade microorganism, has very high safety. Because it does not contain endotoxin and has good probiotic characteristics, this Lactococcus lactis can be directly consumed without other side effects, and the LEK peptide expressed by it can complement the function of Lactococcus lactis itself, significantly improving the blood lipid level. Therefore, the recombinant Lactococcus lactis provided by the present invention has broad application prospects in the fields of food, health food and medicine, especially showing good potential in improving hyperlipidemia and regulating body weight. Description of the Drawings
[0017] Figure 1 It is a diagram showing the obtained target recombinant plasmid in the present invention;
[0018] Figure 2 It is an electrophoretogram of the molecular weight of the protein in the present invention;
[0019] Figure 3 It is a histogram of total cholesterol after the mouse serum experiment in Test Example 2 of the present invention;
[0020] Figure 4 It is a histogram of triglyceride after the mouse serum experiment in Test Example 2 of the present invention;
[0021] Figure 5 It is a histogram of low-density lipoprotein cholesterol after the mouse serum experiment in Test Example 2 of the present invention;
[0022] Figure 6 It is a histogram of high-density lipoprotein cholesterol after the mouse serum experiment in Test Example 2 of the present invention. Detailed Embodiments
[0023] Next, in combination with the embodiments of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.
[0024] Reference Figure 1-6 , to solve the problems existing in the background technology, the following technical solutions are proposed in this application: A construction method of Lactococcus lactis for recombinant expression of LEK peptide. This method constructs the LEK peptide gene in series on the pNZ8148 vector and transfers it into Lactococcus lactis NZ9000 by electrotransduction technology, thereby obtaining recombinant Lactococcus lactis capable of expressing LEK peptide. The specific steps are as follows:
[0025] S01: Codon optimization of the LEK peptide gene: Optimize the LEK peptide gene sequence according to the codon preference of Lactococcus lactis;
[0026] S02: Construction of the recombinant plasmid pNZ8148-LEK: Use the designed specific primers to amplify the LEK peptide gene fragment by polymerase chain reaction (PCR). Subsequently, double-digest the pNZ8148 plasmid with the restriction endonucleases NcoⅠ and HindⅢ, then mix and ligate the digested plasmid with the LEK peptide gene fragment, and finally synthesize the recombinant plasmid pNZ8148-LEK;
[0027] S03: Construction of recombinant Lactococcus lactis, including the following steps:
[0028] Electrotransformation of the recombinant plasmid:
[0029] Take out the Lactococcus lactis competent cells stored at -80°C, thaw them on ice, gently mix them with the recombinant plasmid and let it stand for 5 minutes. Transfer the mixture to a pre-cooled electroporation cuvette, apply an electric shock, and then quickly add the recovery medium. Transfer it to a centrifuge tube for recovery culture, and spread the recovery solution on a GM17 resistant plate containing chloramphenicol for culture, and screen out positive transformants from it;
[0030] PCR verification of positive transformants:
[0031] Perform colony PCR on the screened positive transformants to confirm the success of the transformation;
[0032] Sequencing verification of positive transformants:
[0033] Inoculate the positive transformants qualified by PCR test into GM17 medium for overnight culture, and extract the plasmid for sequencing to verify the correctness of the sequence. After confirming the results, select qualified positive transformants for glycerol preservation;
[0034] Among them, research shows that the protein sequence LEK extracted from Torreya grandis Fort. cv. Merrillii can effectively regulate the above-mentioned blood lipid indexes, thereby improving hyperlipidemia. On this basis, the present invention constructs a Lactococcus lactis capable of expressing the LEK peptide, in order to improve the symptoms of hyperlipidemia by regulating lipid metabolism. However, for traditional methods of recombinant expression of small peptides, Escherichia coli is usually used as the host cell. The endotoxin production of Escherichia coli makes it unsuitable for in-situ application, and the purification process is often complex and time-consuming. Therefore, the present invention proposes to produce the LEK peptide by modifying probiotics. This method can not only reduce the chemical synthesis cost of the LEK peptide, but more advantageously, probiotics are non-toxic to the human body when orally administered, and the synergistic effect of its metabolites and the LEK peptide can effectively improve the curative effect of hyperlipidemia.
[0035] Example 1: Optimization of the codons of the tandem LEK peptide;
[0036] Since the LEK peptide is derived from Torreya grandis Fort. cv. Merrillii protein, there are differences in its codon usage preference and Lactococcus lactis. Therefore, in order to improve the expression efficiency of the LEK peptide in Lactococcus lactis, its nucleotide sequence needs to be optimized. The optimized nucleotide sequence is shown in Sequence No. 1: aaggaggcactcaccatgggtttggaaaaattggagaaattggaaaagttggaaaaact tgagaagttggagaagttggaaaaattagaaaagctggagaaactagaaaaattggaaaagttagaaaaactggagaaac tcgaaaaacttgaaaagctggaaaagttagaaaaattagagaagctcgaaaaactggaaaaataa.
[0037] Example 2: Amplification of the tandem LEK peptide gene sequence;
[0038] To achieve the amplification of the tandem LEK peptide gene sequence, specific primers are first designed. The sequences of the upstream primer and the downstream primer are shown in Sequence No. 2 and No. 3 respectively:
[0039] No. 2 (upstream primer): CACTCACCATGGGTTTGGA
[0040] No. 3 (downstream primer): GAAAAATAAAAGCTTTCTTTGA
[0041] Next, the optimized LEK peptide nucleotide sequence was amplified by polymerase chain reaction (PCR). The PCR reaction conditions were set as follows: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 30 seconds, and finally a final extension at 72°C for 5 minutes. The whole cycle was repeated 35 times;
[0042] Among them, after the PCR reaction was completed, the amplification product was analyzed by electrophoresis using 1% agarose gel, and then the target band was purified and recovered. During the construction of the recombinant plasmid, the target plasmid was digested with restriction endonucleases Nco I and Hind III by double digestion. The reaction temperature was set at 37°C to optimize the digestion efficiency;
[0043] Subsequently, a ligation reaction was carried out according to the digested product and transformation was performed. The results were as Figure 1 shown to obtain the target recombinant plasmid.
[0044] Example 3: Construction of recombinant Lactococcus lactis strains;
[0045] The recombinant plasmid pNZ8148-LEK was transformed into Lactococcus lactis by electrotransformation technology: Take the competent cells of Lactococcus lactis NZ9000 and gradually melt them on ice;
[0046] Mix 100 μl of the prepared competent cells with 600 ng of the recombinant plasmid dissolved in sterile water, let it stand on ice for 5 min, and then transfer it to a cold electroporation cuvette for electroporation. Deliver a single pulse at 1800 kV and 200 Ω through Gene Pulser (Bio-Rad, USA);
[0047] Subsequently, immediately mix the cell suspension with 1000 μl of GM17 medium and incubate it at 30°C for 2 hours. After centrifugation (4000×g, 4°C), discard 900 μl of the medium, resuspend it, and spread 100 μl of the suspended culture on a GM 17 plate containing chloramphenicol and incubate it for 24 - 36 hours;
[0048] The positive transformants were identified by colony PCR. Select a single colony from the transformants and gently mix it with 10 μl of sterile ultrapure water. Take 1 μl of the mixed solution as the template for the subsequent PCR reaction;
[0049] Colony PCR was performed using specific primers to identify positive recombinants;
[0050] The upstream primer was No. 4 and the downstream primer was No. 5. Their sequences were respectively:
[0051] No. 4 (upstream primer): AAGGAGGCACTCACCAT
[0052] No.5 (downstream primer): GCCTCCTCCAACCGAAATAG
[0053] The PCR reaction procedure is as follows: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 30 seconds, and finally final extension at 72°C for 5 minutes. The whole cycle is repeated 35 times.
[0054] Inoculate the identified positive recombinant into GM17 liquid medium, incubate statically at 30°C overnight, extract the plasmid for sequencing identification, and prepare the positive recombinant with correct sequencing into glycerol bacteria for storage at -80°C for later use.
[0055] Test Example 1, induced expression and detection of recombinant Lactococcus lactis;
[0056] Activate the recombinant Lactococcus lactis constructed in Example 1 by static incubation at 30°C overnight, inoculate it into 50 ml of GM17 liquid medium at a ratio of 1:100, and incubate statically at 30°C until OD = 0.3 - 0.4, then add nisin at a concentration of 2 ng / ml and induce for 6 h;
[0057] Centrifuge at 8000 g / min for 10 min to collect the cell precipitate: After washing the precipitate three times with sterile PBS, resuspend it in 1 ml of PBS and perform ultrasonic disruption;
[0058] Use SDS-PAGE protein electrophoresis and Western-blot to detect the expression of the tandem protein. The results are as Figure 2 shown. The size of the tandem protein is approximately 7.5 - 8.5 kDa, indicating that the tandem protein is successfully expressed in Lactococcus lactis.
[0059] Test Example 2, improvement effect of recombinant Lactococcus lactis on hyperlipidemic mice;
[0060] Animal experiment: Use 30 six-week-old male C57BL / 6 mice with an average body weight of 18 - 20 g, purchased from Hangzhou Medical College;
[0061] After 7 days of adaptive feeding, randomly divide them into 5 groups with 6 mice in each group, including a normal group, a model group, and drug administration groups;
[0062] The normal group is given 0.2 mL of PBS by gavage daily, and the high-fat model group is fed a high-fat diet (containing 1.25% cholesterol);
[0063] The positive drug group is given the same high-fat diet and additionally supplemented with the cholesterol-lowering drug simvastatin (5 mg / kg / d);
[0064] In addition, there are two drug groups that are gavaged with NZ9000 + pNZ8148 (5×10 9CFU) and NZ9000 + pNZ8148-LEK (5×10 9 CFU), administered for up to 5 weeks;
[0065] After the last dose, the mice were fasted overnight;
[0066] On the next day, blood was collected under anesthesia. After the blood was allowed to stand at room temperature for 2 hours, it was centrifuged at 3000×g for 10 minutes, and the supernatant was obtained and stored at -80°C;
[0067] On the third day, the determination of triglyceride, total cholesterol, high-density lipoprotein and low-density lipoprotein in the mouse serum was carried out according to the kit instructions provided by Jiancheng (Nanjing, China);
[0068] On the fourth day, the results were as Figure 3 shown: Compared with the control group, the recombinant strain significantly reduced the levels of cholesterol, triglyceride and low-density cholesterol in the mouse serum, increased the high-density cholesterol level, and improved the hyperlipidemia of the mice.
[0069] In summary, the recombinant Lactococcus lactis constructed in the present invention, as a food-grade microorganism, has very high safety. Because it does not contain endotoxin and has good probiotic characteristics, this Lactococcus lactis can be directly consumed without other side effects, and the LEK peptide expressed by it can complement the function of Lactococcus lactis itself, significantly improving the blood lipid level. Therefore, the recombinant Lactococcus lactis provided by the present invention has broad application prospects in the fields of food, health food and medicine, especially showing good potential in improving hyperlipidemia and regulating body weight.
[0070] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, the scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. A method for constructing Lactococcus lactis for recombinantly expressing LEK peptide, characterized in that: The specific steps include: S01: Codon optimization of LEK peptide gene: Optimize the LEK peptide gene sequence according to the codon preference of Lactococcus lactis; S02: Construction of recombinant plasmid pNZ8148-LEK: LEK peptide gene fragment was amplified by polymerase chain reaction (PCR) using the designed specific primers, and then the pNZ8148 plasmid was double-digested with restriction endonucleases NcoⅠ and HindⅢ, and then the digested plasmid was mixed with the LEK peptide gene fragment and ligated to finally synthesize the recombinant plasmid pNZ8148-LEK; S03: Construction of recombinant Lactococcus lactis, comprising the following steps: Electroporation of recombinant plasmid: Take out competent Lactococcus lactis cells stored at -80°C, thaw on ice, gently mix with the recombinant plasmid and let stand for 5 minutes, transfer the mixture to a pre-cooled electroporation cup, add recovery medium quickly after electric shock, transfer to a centrifuge tube for recovery culture, and spread the recovery solution on a GM17 resistance plate containing chloramphenicol for culture, and screen out positive transformants; PCR verification of positive transformants: Perform colony PCR on the screened positive transformants to confirm the success of the transformation; Sequencing verification of positive transformants: The positive transformants that passed the PCR test were inoculated into GM17 medium for overnight culture, and the plasmids were extracted for sequencing to verify the correctness of the sequence. After confirming the results, the qualified positive transformants were selected for glycerol storage.
2. Use of the Lactococcus lactis for recombinantly expressing LEK peptide as claimed in claim 1 in the preparation of lipid-lowering drugs.
3. Use of the Lactococcus lactis for recombinantly expressing LEK peptide as claimed in claim 1 in health food.