Genetic engineering method for improving drought resistance of plants

Abstract

The invention relates to a genetic engineering method for improving drought resistance of plants, and belongs to the technical field of plant genetic engineering and crop genetic improvement. Aiming at the problems of single gene resource, low transformation efficiency and imperfect screening system in crop drought resistance improvement in the prior art, the invention provides an efficient drought-resistant breeding scheme based on the monophagi AmASMT gene. The method comprises the following steps: separating a full-length open reading frame ORF sequence of an AmAST gene from Saccharomyces cerevisiae, connecting the full-length open reading frame ORF sequence with a constitutive promoter and a selection marker gene to construct an overexpression vector pBWA (V) HS-AmAST-osgfp, and transferring the vector into rice callus by using an agrobacterium EHA105 mediated genetic transformation method, and screening by simulating drought stress through PEG-6000 to obtain a T1-generation transgenic plant with stable overexpression of the AmASMT gene and remarkably improved drought resistance. The method breaks through the dependence of traditional breeding on sibling species gene resources, and through the combination of precise gene regulation and control and an efficient screening system, a new rice variety adapting to the drought environment can be rapidly cultivated.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering and crop genetic improvement, and in particular relates to a genetic engineering method for improving plant drought resistance. Background Art

[0002] Drought stress is one of the main environmental factors limiting crop yields, particularly in the context of global climate change, with droughts occurring at significantly higher frequencies and intensities. Traditional approaches to improving plant drought resistance rely primarily on natural variation screening and hybrid breeding, but these methods suffer from long cycles, low efficiency, and susceptibility to genetic background limitations. With the development of molecular biology techniques, improving plant drought resistance through genetic engineering has become a research hotspot, but existing technologies still face the following challenges:

[0003] Currently, most known drought-resistant genes are derived from model plants (such as Arabidopsis thaliana), while the genetic resources of extremely drought-tolerant plants (such as xerophytes) have not been fully explored. As a typical xerophytic grass, the cloning and functional analysis of drought-resistant genes in Agropyron mongolicum are still in their infancy, limiting its application in crop improvement.

[0004] Existing drought-resistant gene transfer vectors often use constitutive promoters (such as CaMV 35S) to drive gene expression. While these promoters can improve plant drought resistance, they often result in side effects such as growth inhibition and yield reduction in transgenic plants. Furthermore, the selection of selectable marker genes (such as antibiotic resistance genes) in vector construction can raise ecological safety concerns and warrants further optimization.

[0005] Agrobacterium-mediated rice genetic transformation is highly genotype-dependent. Conventional transformation efficiencies for japonica rice are approximately 20%-30%, while those for indica rice are often less than 10%. Furthermore, the post-transformation screening process requires multiple stages, including callus induction, differentiation, and rooting, taking a total of four to six months, severely limiting the efficiency of functional verification of drought-resistance genes.

[0006] Existing drought resistance screening methods often rely on a single indicator (such as survival rate) and lack a comprehensive assessment of physiological and biochemical indicators (such as chlorophyll degradation rate and accumulation of osmotic regulatory substances). For example, while some transgenic plants can survive drought stress, their photosynthetic systems are severely damaged, resulting in a significant decrease in biomass, making it difficult to meet actual production needs.

[0007] The PEG-6000 solution commonly used in laboratories to simulate drought stress suffers from issues such as inaccurate concentration gradients and inconsistent treatment times. Studies have shown that the osmotic potential of PEG solutions differs from the dynamics of soil water potential during drought, resulting in a low correlation between screening results and field performance. A more realistic evaluation system is needed.

[0008] As a wild plant, the regulation of gene expression in crops from Salix serrata remains unclear. For example, promoters from Salix serrata genes may be incompatible with transcription factors from crops like rice, leading to unstable expression of target genes in transgenic plants and significant differences in drought resistance phenotypes.

[0009] The root cause of these problems lies in the inability of existing technologies to systematically address the synergy between drought-resistant gene discovery, vector optimization, transformation efficiency improvement, and multi-dimensional phenotypic evaluation. In particular, the lack of adaptive transformation strategies tailored to crop genetic backgrounds in the utilization of psammophyte genetic resources, coupled with insufficient standardization of drought stress assessment systems, has led to slow progress in drought-resistant genetic engineering research. In the future, a multidisciplinary approach combining genomics, metabolomics, and bioinformatics will be needed to construct a comprehensive technology system from gene cloning to variety breeding, providing new avenues for improving crop drought resistance. Summary of the Invention

[0010] One objective of the present invention is to address the current problem of crop drought resistance improvement relying on genetic resources from closely related species, resulting in limited genetic resources, low transformation efficiency, and an imperfect screening system. By introducing the AmASMT gene from Salix arundinacea, the present invention constructs a high-efficiency expression vector and optimizes the screening system, aiming to address the issues of insufficient genetic resources, low transformation efficiency, and the lack of comprehensive multi-index evaluation.

[0011] Traditional Agrobacterium transformation methods involve complex procedures, unstable efficiency, and long screening cycles. This invention optimizes the transformation process by using liquid nitrogen freeze-thaw, AS co-culture, and hygromycin screening, addressing the issues of low transformation efficiency, strong genotype dependence, and time-consuming screening.

[0012] Existing gene cloning methods are prone to introducing sequence errors and lack amplification specificity. This invention solves the accuracy and efficiency issues of cloning the full-length ORF sequence of the AmASMT gene by designing specific primers, optimizing the PCR program, and sequencing verification.

[0013] Traditional PEG-based drought stress simulations lack precise concentration control and have low correlation with actual field performance. This invention addresses the issues of inconsistent stress conditions and unreliable screening results by standardizing the PEG-6000 concentration range (15%-20% w / v) and treatment time (5-7 days).

[0014] Existing drought resistance screening relies on a single indicator (such as survival rate) and ignores physiological and biochemical responses. The present invention uses a comprehensive assessment of chlorophyll content, proline accumulation, and survival rate to address the problem of insufficient actual drought resistance of plants due to the one-sidedness of the screening system.

[0015] Chlorophyll determination methods have the problems of large errors and poor repeatability. The present invention solves the problem of inaccurate quantitative determination of chlorophyll degradation rate by combining spectrophotometry with the Lichtenthaler formula.

[0016] The proline detection process is complex and the color development stability is poor. The present invention optimizes the extraction and color development conditions by using the ninhydrin color development method to solve the problems of low efficiency and insufficient accuracy in proline content determination.

[0017] Survival rate statistics are greatly affected by environmental factors, resulting in poor comparability of results. The present invention solves the problem of high subjectivity in survival rate statistics by standardizing PEG treatment time, recovery conditions, and calculation formulas.

[0018] The preparation and application of PEG solution are not standardized, resulting in fluctuations in osmotic potential. The present invention solves the problem of unstable stress condition simulation by dissolving with magnetic stirring, maintaining a constant concentration, and controlling environmental parameters.

[0019] When measuring chlorophyll with a spectrophotometer, the baseline correction is insufficient, resulting in large data errors. The present invention solves the problem of inaccurate absorbance measurement through repeated measurements, blank control calibration and error control.

[0020] The present invention provides a genetic engineering method for improving plant drought resistance, comprising the following steps:

[0021] a) The full-length open reading frame (ORF) sequence of the AmASMT gene was isolated from Agropyron mongolicum, and the base sequence thereof is shown in SEQ ID NO: 3;

[0022] b) connecting the ORF sequence of the AmASMT gene to a plant expression regulatory element to construct an overexpression vector pBWA(V)HS-AmASMT-osgfp, wherein the regulatory element includes a constitutive promoter and a selection marker gene;

[0023] c) transferring the overexpression vector into rice callus tissue by Agrobacterium EHA105-mediated genetic transformation;

[0024] d) Under simulated drought stress conditions, PEG-6000 was treated to screen out transgenic rice T1 plants with overexpression of the AmASMT gene and significantly enhanced drought resistance.

[0025] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the Agrobacterium-mediated genetic transformation method specifically comprises the following steps:

[0026] i) transforming the overexpression vector pBWA(V)HS-AmASMT-osgfp into Agrobacterium EHA105 strain by liquid nitrogen freeze-thaw method;

[0027] ii) co-culturing the Agrobacterium carrying the vector with rice callus using a co-culture solution containing acetosyringone AS for 48 hours;

[0028] iii) obtaining transgenic rice calli stably integrated with the AmASMT gene through hygromycin screening and PCR verification.

[0029] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the full-length ORF sequence of the AmASMT gene is cloned by the following steps:

[0030] i) extracting total RNA from leaves of Salix serrata and synthesizing the first-strand cDNA using reverse transcriptase;

[0031] ii) Design a specific primer pair, the nucleotide sequence of which is:

[0032] Forward primer: SEQ ID NO: 1 5′-ATGGCGCTCACCAGGGAG-3′,

[0033] Reverse primer: SEQ ID NO: 2 5′-TGGGTAAACCTCGATGATCGATCTC-3′;

[0034] iii) PCR amplification using a high-fidelity DNA polymerase, the amplification procedure is as follows:

[0035] Initial denaturation: 94°C for 5 minutes;

[0036] Cycling parameters: denaturation at 94°C for 30 seconds, annealing at 50°C for 30 seconds, and extension at 72°C for 65 seconds, for a total of 30 cycles;

[0037] Final extension: 72°C for 10 min;

[0038] iv) separating the amplified products by agarose gel electrophoresis, excising the gel to recover the target fragment, ligating it into a cloning vector, and transforming it into Escherichia coli;

[0039] v) Positive clones containing the complete ORF sequence of the AmASMT gene were obtained through colony PCR and sequencing verification.

[0040] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the simulated drought stress conditions are: treating transgenic rice plants with a PEG-6000 solution at a concentration of 15%-20% w / v for 5-7 days, and screening transgenic plants with significantly enhanced drought resistance by measuring chlorophyll content, proline accumulation and plant survival rate.

[0041] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the screening comprises the following steps:

[0042] i) measuring the chlorophyll content of leaves of the transgenic plants by spectrophotometry, and selecting lines whose chlorophyll degradation rate is less than 40% of that of wild-type plants;

[0043] ii) using the ninhydrin colorimetric method to determine the proline accumulation in leaves, and screening for lines with proline content more than 2-fold higher than that of wild-type plants;

[0044] iii) Counting the survival rate of plants under drought stress, and selecting lines with a survival rate higher than 50% of the wild type;

[0045] iv) Combining the above indicators, transgenic plants with significantly enhanced drought resistance are obtained.

[0046] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the specific steps of determining the chlorophyll content by spectrophotometry are:

[0047] a) Taking leaf samples from the transgenic plants, extracting them in 80% acetone solution in the dark for 24 hours to obtain a chlorophyll extract;

[0048] b) measuring the absorbance of the extract at wavelengths of 663 nm and 645 nm using a spectrophotometer;

[0049] c) Calculate the total chlorophyll content according to the Lichtenthaler formula:

[0050] Total chlorophyll = (8.02 × A 663 +20.21×A 645 )×dilution factor (mg / g fresh weight)

[0051] d) Screening transgenic lines whose total chlorophyll degradation rate is less than 40% of that of wild-type plants.

[0052] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the specific steps of determining the proline accumulation amount by the ninhydrin colorimetric method are:

[0053] a) Leaf samples of transgenic plants were taken, ground with 3% w / v sulfosalicylic acid solution, extracted in a boiling water bath for 10 minutes, and centrifuged to obtain the supernatant;

[0054] b) Mix the supernatant with an equal volume of ninhydrin colorimetric solution (containing 1% ninhydrin, 60% glacial acetic acid, and 20% concentrated phosphoric acid) and develop the color in a 95°C water bath for 30 minutes;

[0055] c) after cooling, measuring the absorbance using a spectrophotometer at a wavelength of 520 nm, and calculating the proline content in μg / g fresh weight based on a standard curve;

[0056] d) Screening transgenic lines with proline content increased more than 2 times compared to wild-type plants.

[0057] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the specific steps of calculating the plant survival rate under drought stress are:

[0058] a) When the transgenic rice plants reached the three-leaf stage, a 15%-20% (w / v) PEG-6000 solution was applied for 7 days to simulate drought stress;

[0059] b) After the stress ends, normal hydroponic conditions are restored for 3 days, and the number of surviving plants is counted;

[0060] c) The survival rate is calculated as follows:

[0061] Survival rate = number of surviving plants / number of initial treated plants × 100%

[0062] d) Screening transgenic lines whose survival rate is at least 50% higher than that of wild-type plants.

[0063] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the PEG-6000 solution having a concentration of 15%-20% w / v is prepared and applied by the following steps:

[0064] a) dissolving PEG-6000 powder in a plant nutrient solution and stirring magnetically until completely dissolved to prepare a simulated drought stress solution of target concentration;

[0065] b) when the transgenic rice plants grow to the three-leaf stage, completely immersing the roots of the plants in the PEG-6000 solution, and replenishing the water lost by evaporation daily to maintain a constant concentration;

[0066] c) Continue treatment for 5-7 days, maintaining the light intensity at 200 μmol·m -2 ·s -1 , the day and night temperature is 25℃ / 22℃, and the relative humidity is 60%-70%.

[0067] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the spectrophotometric determination method further comprises:

[0068] i) using a quartz cuvette with a light path of 1 cm to load the chlorophyll extract;

[0069] ii) Measure the absorbance at wavelengths of 663 nm and 645 nm, repeat the measurement three times at each wavelength, and take the average value;

[0070] iii) Before measurement, 80% acetone solution was used as a blank control for baseline correction to ensure that the absorbance value error was less than ±0.005.

[0071] The present invention has achieved at least the following beneficial effects:

[0072] By introducing the AmASMT gene from Salix arundinacea, traditional breeding efforts have overcome their reliance on genetic resources from closely related species, broadening the source of drought-resistant genes. Combining a constitutive promoter with a selection marker gene improves vector expression efficiency and screening accuracy. Using PEG-6000 to simulate drought stress allows for rapid screening of drought-resistant plants, significantly shortening the breeding cycle. Ultimately, the resulting transgenic rice boasts steadily improved drought resistance, providing technical support for food security in arid regions.

[0073] Liquid nitrogen freeze-thaw improves the efficiency of vector introduction into Agrobacterium. Combined with AS co-culture medium, gene transfer between Agrobacterium and callus is facilitated. Hygromycin selection ensures the stability of transgenic callus. This process increases rice transformation efficiency to over 50% and shortens the screening cycle to two months, significantly accelerating the functional verification of drought-resistance genes.

[0074] Specific primer design combined with a high-fidelity PCR amplification procedure ensures accurate cloning of the full-length ORF sequence of the AmASMT gene. Double verification through colony PCR and sequencing avoids sequence errors during vector construction. This method increases the gene cloning success rate to over 90%, laying a solid foundation for subsequent functional studies.

[0075] Standardizing the PEG-6000 concentration range (15%-20%) and treatment time (5-7 days) ensures that the osmotic potential of simulated drought stress is highly consistent with actual field conditions. This improves the correlation between screening results and field drought resistance performance by more than 30%, reducing the cost of repetitive verification in subsequent field trials.

[0076] Through a multi-dimensional evaluation of chlorophyll content, proline accumulation, and survival rate, the drought resistance of the plants is comprehensively reflected, avoiding false positives caused by single-indicator screening. This comprehensive screening system has increased the field survival rate of drought-resistant plants by 40% and reduced biomass loss to less than 15%, meeting actual production needs.

[0077] Spectrophotometry combined with the Lichtenthaler formula enables accurate quantification of chlorophyll content with an error rate of less than 5%. The system screens strains with chlorophyll degradation rates less than 40% of the wild type, ensuring that transgenic plants maintain photosynthetic efficiency under drought stress and improving yield stability.

[0078] The optimized ninhydrin colorimetric assay has improved color stability, and the colorimetric solution formula (containing glacial acetic acid and concentrated phosphoric acid) suppresses background interference, improving the reproducibility of the assay results to over 95%. This method shortens the proline detection time to 2 hours, increasing efficiency by 50%, and provides technical support for high-throughput screening.

[0079] The standardized survival rate statistical process (treatment at the three-leaf stage, 7 days of stress, and 3 days of recovery) reduces environmental interference and improves data comparability; the survival rate calculation formula simplifies the statistical steps, increases screening efficiency by 30%, and ensures the field adaptability of drought-resistant plants.

[0080] Magnetic stirring dissolution combined with daily concentration calibration maintains a constant osmotic potential of the PEG solution, improving the stability of simulated stress conditions; precise control of environmental parameters (light, temperature and humidity) reduces the deviation between laboratory screening results and field performance to within 10%, thereby improving the reliability of the research results.

[0081] Repeated measurements and baseline correction controlled the absorbance error within ±0.005, ensuring the accuracy of chlorophyll content calculation; quartz cuvettes were used to reduce pathlength errors, and data repeatability reached over 98%, providing high-precision data support for drought resistance evaluation. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 The figure shows the phenotype of the T1 generation transgenic rice plants overexpressing the AmASMT gene in one embodiment of the present invention. Note: WT is wild-type rice, OE-2, OE-3, and OE-6 are three lines of T1 transgenic rice, CK represents normal nutrient solution hydroponic culture conditions, and D represents hydroponic culture under PEG-6000 simulated drought stress. DETAILED DESCRIPTION

[0083] The present invention will be described in further detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0084] According to one embodiment of the present invention, a) the full-length open reading frame ORF sequence of the AmASMT gene is isolated from Agropyron mongolicum, as shown in SEQ ID NO: 3; b) the ORF sequence of the AmASMT gene is connected to a plant expression regulatory element to construct an overexpression vector pBWA(V)HS-AmASMT-osgfp, wherein the regulatory element includes a constitutive promoter and a selection marker gene; c) the overexpression vector is transferred into rice callus by Agrobacterium EHA105-mediated genetic transformation; d) under simulated drought stress conditions, PEG-6000 is treated to screen out transgenic rice T1 plants with overexpression of the AmASMT gene and significantly enhanced drought resistance. Figure 1 As shown, transgenic rice plants overexpressing the AmASMT gene exhibited enhanced drought resistance, indicating that the AmASMT gene is a key gene for enhancing plant drought tolerance and has important application value in genetic engineering research in grasses.

[0085] First, extract total RNA from fresh leaves of Salix serrata using an RNA extraction kit (such as TIANGEN's DP441). Determine RNA concentration using a Nanodrop 2000 spectrophotometer, aiming for an A260 / A280 ratio between 1.8 and 2.0. For reverse transcription of first-strand cDNA, use PrimeScript Reverse Transcriptase (Takara, Cat. No. RR047A) at 37°C for 15 minutes and 85°C for 5 seconds.

[0086] For PCR amplification of the AmASMT gene ORF sequence, the forward primer was SEQ ID NO: 1 (5′-ATGGCGCTCACCAGGGAG-3′), and the reverse primer was SEQ ID NO: 2 (5′-TGGGTAAACCTCGATGATCGATCTC-3′). The amplification procedure was as follows: initial denaturation at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 65 seconds; and a final extension at 72°C for 10 minutes. A high-fidelity DNA polymerase (e.g., KOD FX Neo, TOYOBO, Cat. No. KFX-201) was used. Amplified products were verified by electrophoresis on a 1.2% agarose gel and then recovered.

[0087] The recovered fragment was ligated into the cloning vector pMD19-T (Takara, Catalog No. 3271), transformed into E. coli DH5α competent cells (Full Gold, Catalog No. CD201), plated on LB plates containing 100 μg / mL ampicillin, and incubated at 37°C for 16 hours. Single colonies were selected for colony PCR verification, and positive clones were sent for sequencing (e.g., BGI). The base sequence was determined as shown in SEQ ID NO:

[0088] ATGGCGCTCACCAGGGAGCAGCACATCCTCGACCAGGGGCTTGCTCGATGCCCAGCTCGAG

[0089] CTTTGGCACCACACCTTCAGCTTCGTCAAGTCCATGGCGCTCAAGTCTGCCCTGGACCTC

[0090] GGCATTGCCGATGCCATCCACCGCCAAGGCGGCGCCGCCACCCTCTCCCAGATTGCCGCC

[0091] ACGGCCACGCTCCACCCGACCAAGATCTGTTGCCTGCGCCGCCTCATGCGTGTGCTCATC

[0092] GTCTCCGGCATCTTCAGCGTCGACCACCCCAGGGACGACGGCGTTGAGGGCGAGGCCGTC

[0093] TACACGCTGACGCCCGCGTCCCGTCTCCTCGTCTGCTCGGCCTCGGCTAACATGGTCCAC

[0094] ATCACGAAGATGCTGCTCCACACCAACCTCGTCTCCCCGTTCTCCGACCTGGGGACTTGG

[0095] TTCCAGCACGAGCTGCCTGAGCCGGACCTCTTCAAGCTGAAGCACGGCAAGACCTTCTGG

[0096] GAGCTGGCCGACCACGACCCGGAGTACAATGCGCTCGTCAACGACGGCATGGTCTCCGAC

[0097] AGCAGCTTCCTCATGGACATCGCCATCAGGGAGTGCGGGGCTGTCTTCCAGGGGATAGGC

[0098] TCCCTGGTCGACGTCGCCGGGGGGCACGGTGGAGCGGCACAAGCCATCTCGAATGCGTTC

[0099] CCGGACGTGAAGTGTAGCGTGATGGACCTCGCCCACGTCGTCGCCAAGGCTCCGACCGGT

[0100] AGCGACGTGGAGTATATCGCTGGCGACATGTTTGAGAGCGTTCCACCGGCCGATGCCGTC

[0101] TTCCTCAAGTGGGTCATGCATGATTGGGGTGACGAGGACTGCATCAAGATACTAAAAAAT

[0102] TGCAAGAAAGCCATCGCGCCAAAAGATGCAGGAGGGAAGGTGATAATTATCGACATGGTG

[0103] GTTGGTGCAGGGCCACAGGACCTGAAGCACAAAGAGACACAGGTCATGTTCGACCTTTTC

[0104] ATCATGTTCATCAACGGCATCGAGCGAGATGAGCAGGAGTGGAAGAAGATAATCTTCGAG

[0105] GCTGGATTCAACGACTACAAAATCACGCCCATTCTGGGTGTGAGATCGATCATCGAGGTT

[0106] TACCCATGA

[0107] The AmASMT gene ORF sequence is linked to plant expression regulatory elements. The constitutive promoter can be the maize ubiquitin promoter (Ubi, NCBI Accession No. AF485783), and the selection marker gene can be the hygromycin phosphotransferase gene (HPT, NCBI Accession No. X58288). The vector backbone can be pBWA(V)HS. Alternatively, it can be constructed by a biotechnology company.

[0108] Double digestion was performed using the restriction endonucleases BamHI and KpnI (Thermo Scientific, Catalog Nos. ER0051 and ER0521) at 37°C for 3 hours. The AmASMT gene was ligated to the vector using T4 DNA ligase (NEB, Catalog No. M0202L) at 16°C for 12 hours. The ligation product was transformed into Escherichia coli DH5α and plated on LB plates containing 50 μg / mL kanamycin. Positive clones were verified by colony PCR and double digestion to obtain the recombinant vector pBWA(V)HS-AmASMT-osgfp.

[0109] The recombinant vector pBWA(V)HS-AmASMT-osgfp was transformed into the Agrobacterium tumefaciens strain EHA105 (Weidi Bio, Catalog No. AC1001) via the liquid nitrogen freeze-thaw method. Calluses were induced from mature seed embryos of the rice variety Nipponbare using N6 minimal medium (PhytoTech, Catalog No. N619). Co-cultivation with Agrobacterium was performed using a co-culture medium containing 100 μM acetosyringone (AS, Sigma, Catalog No. D134406) for 48 hours (25°C in the dark).

[0110] Hygromycin selection was performed using a medium containing 50 mg / L hygromycin (Roche, Catalog No. 10843555001) for a 4-week screening period. Transgenic calli were verified by PCR using primers specific for the HPT gene.

[0111] For simulated drought stress screening, transgenic rice seedlings (three-leaf stage) were treated with a 15% w / v PEG-6000 solution (Sigma, Catalog No. 81260) for 7 days under a light intensity of 200 μmol·m⁻²·s⁻¹ and a daytime temperature of 25°C / nighttime temperature of 22°C. Drought-resistant lines were screened by measuring chlorophyll content (spectrophotometer UV-1800, Shimadzu), proline accumulation (ninhydrin method), and survival rate (formula: survival rate = number of surviving plants / number of treated plants × 100%).

[0112] To this end, the gene isolation step was verified through high-fidelity PCR and sequencing to ensure the accuracy of AmASMT gene ORF sequence cloning, with an error rate of less than 0.1%. The maize ubiquitin promoter and hygromycin selection marker were used in vector construction, increasing gene expression efficiency by 30% and the screening positive rate to over 85%. Agrobacterium transformation combined with standardized PEG stress screening shortened the drought-resistant plant screening cycle to three months, and the field survival rate was 50% higher than that of the wild type.

[0113] According to another embodiment of the present invention, a commercially available EHA105 Agrobacterium strain (such as purchased from Invitrogen) can be used, and the overexpression vector pBWA (V) HS-AmASMT-osgfp (construction method see above) containing the AmASMT gene is mixed with 50 μL competent Agrobacterium. The liquid nitrogen quick freezing time is set to 3 minutes. After thawing in a 37°C water bath for 90 seconds, 500 μL of antibiotic-free YEB medium is added and cultured at 28°C and 200 rpm for 2 hours. When the bacteria are collected by centrifugation, centrifugation at 4000 rpm is used for 5 minutes. Finally, the bacteria are resuspended in 50 μL YEB medium and coated on a plate containing 50 mg / L kanamycin and 25 mg / L rifampicin. The centrifuge used in this process can be Eppendorf 5424, and the constant temperature shaker can be New Brunswick Innova44R.

[0114] The co-culture medium is formulated as follows: MS minimal medium supplemented with 30 g / L sucrose, 2 mg / L 2,4-D, and 100 μM acetosyringone (AS, purchased from Sigma-Aldrich). Three-day-old pre-cultured rice callus (e.g., Nipponbare) is mixed with activated Agrobacterium tumefaciens (OD600 ≈ 0.5) in a 1:10 ratio and co-cultivated at 28°C in the dark for 48 hours. The culture container is a 9 cm diameter glass Petri dish with two layers of sterile filter paper on the bottom to absorb excess bacterial solution. After co-cultivation, the callus is washed three times with sterile water containing 400 mg / L carbenicillin for 5 minutes each time.

[0115] The selection medium was MS solid medium supplemented with 50 mg / L hygromycin (purchased from Roche) and 400 mg / L carbenicillin. Washed calli were transferred to the selection medium and cultured at 28°C under illumination (light intensity 50 μmol·m⁻²·s⁻¹) for 2 weeks. Surviving resistant calli were transferred to differentiation medium (MS supplemented with 30 g / L sucrose, 2 mg / L 6-BA, and 0.5 mg / L NAA) and cultured for another 4 weeks. Genomic DNA was extracted from leaves of regenerated plants and PCR amplified using specific primers (forward: 5'-ATGGCGCTCACCAGGGAG-3', reverse: 5'-TGGGTAAACCTCGATGATCGATCTC-3'). The amplification program was as follows: initial denaturation at 94°C for 5 minutes, 30 cycles (94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 65 seconds), and a final extension at 72°C for 10 minutes. The PCR instrument used was a Bio-Rad C1000 Touch.

[0116] During the liquid nitrogen freeze-thaw process, optimal transformation efficiency was achieved by controlling the vector DNA concentration at 50-100 ng / μL. During co-culture, the AS concentration range was selected to be 50-200 μM. Experimental verification confirmed that 100 μM resulted in the highest Agrobacterium attachment efficiency. Hygromycin screening tests showed that 50 mg / L effectively inhibited the growth of non-transformed calli while not significantly affecting the differentiation of transgenic calli. All antibiotics used were plant tissue culture grade and purchased from Sigma-Aldrich.

[0117] By optimizing transformation parameters and screening conditions, the genetic transformation efficiency of japonica rice varieties has been consistently achieved at 35-40%, approximately 15 percentage points higher than conventional methods. Hygromycin resistance screening combined with PCR verification ensures a positive rate of over 95% for transgenic plants. Strictly controlling the co-cultivation time to 48 hours reduces callus browning caused by excessive Agrobacterium growth and reduces contamination to below 8%. This method is applicable to different genotypes of rice, including japonica and indica, and provides efficient technical support for functional verification of drought-resistant genes in Salix serrata.

[0118] According to another embodiment of the present invention, the concentration of the PEG-6000 solution can be selected as 15%, 17.5% or 20% (w / v), and a plant nutrient solution (such as Hoagland solution) is used as a solvent, and a magnetic stirrer (such as IKA RCT basic) is used to continuously stir for 30 minutes until it is completely dissolved. The treatment objects are three-leaf stage transgenic rice plants (such as Nipponbare varieties), the roots are completely immersed in the solution, and the water lost by evaporation is replenished daily (about 5%-10% volume) to maintain a stable concentration. The environmental parameters during the treatment period are set as follows: light intensity 200μmol·m-2·s-1, day and night temperature 25℃ / 22℃, relative humidity 60%-70%, and monitoring is performed using a temperature and humidity recorder (such as Testo 175-H1).

[0119] Take 0.2g of the middle tissue of the functional leaf, add 5mL of 80% acetone solution (analytical grade, purchased from Sinopharm Group), and extract at 4℃ in the dark for 24 hours. Use a UV-Vis spectrophotometer (such as Shimadzu UV-1800) to measure the absorbance at wavelengths of 663nm and 645nm, and a quartz cuvette (purchased from Brand) with a light path of 1cm. The blank control uses 80% acetone solution, and each sample is measured in duplicate three times. The total chlorophyll content is calculated as follows: (8.02×A 663 +20.21×A 645 )×dilution factor (mg / g fresh weight). The chlorophyll degradation rate of wild-type plants under 15% PEG treatment was about 60%, and the screening standard for transgenic lines was set at a degradation rate ≤ 40%.

[0120] 0.5 g of leaf tissue was weighed and ground in 5 mL of 3% sulfosalicylic acid solution (purchased from Sigma-Aldrich). Extraction was performed in a boiling water bath for 10 minutes, followed by centrifugation at 12,000 rpm at 4°C for 10 minutes. 2 mL of the supernatant was added to an equal volume of ninhydrin colorimetric solution (1% ninhydrin, 60% glacial acetic acid, 20% concentrated phosphoric acid) and developed in a 95°C water bath for 30 minutes. After cooling, extraction was performed with 4 mL of toluene, and the absorbance of the supernatant was measured at 520 nm (UV-Vis spectrophotometer). Proline content was calculated using the formula: (C × V) / (W × 1000) μg / g fresh weight (C is the concentration obtained from the standard curve, V is the volume of the extract, and W is the sample fresh weight). Wild-type plants have a proline content of approximately 150 μg / g under stress conditions, and the screening criteria for transgenic lines was set at ≥300 μg / g.

[0121] The osmotic potential of the PEG-6000 solution was calibrated using a freezing point osmometer (e.g., Advanced Instruments 3320). The corresponding osmotic potentials for 15%, 17.5%, and 20% PEG-6000 solutions were -0.5 MPa, -0.7 MPa, and -0.9 MPa, respectively. For chlorophyll extraction, 80% acetone solution exhibited a 15% higher extraction efficiency than other concentrations. Ninhydrin colorimetric solution should be prepared fresh and stored in the dark for no more than 24 hours. Survival rate analysis was performed with a sample size of 30 plants per treatment, replicated three times to ensure data reliability.

[0122] Through comprehensive multi-indicator screening, the accuracy of drought resistance assessment for transgenic lines was improved by approximately 35% compared to single-indicator screening. Precise control of the PEG solution concentration gradient resulted in a correlation between stress intensity and field drought of 0.82 (P < 0.01). The coefficients of variation for chlorophyll and proline determinations were 3.2% and 5.1%, respectively, ensuring the stability of screening results. The experimental period was controlled within 15 days, approximately 40% shorter than traditional methods, making it suitable for large-scale drought resistance assessment of transgenic plants.

[0123] According to another embodiment of the present invention, 0.2 g of tissue from the middle of the functional leaf of the transgenic plant was taken, 5 mL of 80% acetone solution (analytical grade, Sinopharm Group) was added, and the extract was kept in the dark at 4°C for 24 hours. The absorbance was measured at wavelengths of 663 nm and 645 nm using a Shimadzu UV-1800 spectrophotometer with a 1 cm optical path quartz cuvette (Brand). The blank control was an 80% acetone solution, and each sample was repeated 3 times. The total chlorophyll content was calculated as follows: (8.02 × A663 + 20.21 × A645) × dilution factor (mg / g fresh weight). The chlorophyll degradation rate of the wild-type plant under 15% PEG treatment was approximately 60%, and the screening criterion was set to a degradation rate of ≤40%.

[0124] 0.5 g of leaf tissue was weighed and ground in 5 mL of 3% sulfosalicylic acid solution (Sigma-Aldrich). After boiling in a water bath for 10 minutes, the mixture was centrifuged at 12,000 rpm at 4°C for 10 minutes. 2 mL of the supernatant was added to an equal volume of ninhydrin colorimetric solution (1% ninhydrin, 60% glacial acetic acid, 20% concentrated phosphoric acid) and incubated in a water bath at 95°C for 30 minutes. After cooling, the mixture was extracted with 4 mL of toluene, and the absorbance of the supernatant was measured at 520 nm. Proline content was calculated using the formula: (C × V) / (W × 1000) μg / g fresh weight (where C is the standard curve concentration, V is the volume of the extract, and W is the sample fresh weight). Proline content in the wild type under stress is approximately 150 μg / g, and the screening criteria was set at ≥300 μg / g.

[0125] At the three-leaf stage, the roots of plants were immersed in a 15%-20% PEG-6000 solution (prepared with Hoagland nutrient solution) for 7 days. Water lost due to evaporation was replenished daily to maintain a stable concentration. After the stress ended, normal hydroponics was resumed for 3 days, and the number of surviving plants was counted. The survival rate was calculated as: number of surviving plants / number of initial treated plants × 100%. The wild-type survival rate is approximately 30%, and the screening criteria was set at ≥45%. Each treatment group consisted of 30 plants, with three replicates.

[0126] The PEG solution concentration was calibrated using a freezing point osmometer; 15% corresponds to -0.5 MPa and 20% corresponds to -0.9 MPa. For chlorophyll extraction, 80% acetone solution exhibited 15% higher extraction efficiency than other concentrations. Ninhydrin colorimetric solution should be prepared fresh and stored in the dark for no more than 24 hours. For survival rate analysis, the sample size was 30 plants per group, with three replicates. Data were analyzed using SPSS software with a t-test; P < 0.05 was considered significant.

[0127] Through comprehensive multi-criteria screening, the accuracy of drought resistance assessment in transgenic lines was improved by 35% compared to single-criteria screening. The coefficients of variation for chlorophyll and proline determination were 3.2% and 5.1%, respectively, ensuring robust results. The survival rate analysis cycle was kept within 10 days, 40% shorter than traditional methods. The experimental data was replicated three times, achieving a reproducibility of 92%. This screening system is applicable to different genotypes of rice, including japonica and indica rice, and provides a standardized process for functional validation of drought-resistance genes.

[0128] According to another embodiment of the present invention, 0.2 g of tissue from the middle part of the functional leaf of the transgenic plant was taken, 5 mL of 80% acetone solution (analytical grade, purchased from Sinopharm Group) was added, and the mixture was ground into a homogenate using a glass mortar. The homogenate was transferred to a 15 mL centrifuge tube and allowed to stand at 4 ° C in the dark for 24 hours. After the extraction was completed, the mixture was centrifuged at 10,000 rpm for 10 minutes at 4 ° C (Eppendorf 5424 type centrifuge can be selected), and the supernatant was taken as the chlorophyll extract. In this process, the extraction efficiency of 80% acetone solution was experimentally verified to be about 12% higher than that of other concentrations (such as 95%), and it can effectively maintain the stability of chlorophyll.

[0129] A 1-cm quartz cuvette (purchased from Brand) was loaded with the chlorophyll extract and placed in the sample chamber of a UV-Vis spectrophotometer (e.g., Shimadzu UV-1800). The absorbance was measured at 663 nm and 645 nm, with three replicates at each wavelength, and the average value was taken. Before measurement, a baseline correction was performed using an 80% acetone solution as a blank control to ensure an absorbance error of less than ±0.005. Instrument parameters were set as follows: scan range 400-700 nm, slit width 2 nm, and response time 0.5 s.

[0130] The total chlorophyll content was calculated according to the Lichtenthaler formula: total chlorophyll = (8.02 × A 663 +20.21×A 645 ) × dilution factor (mg / g fresh weight). The dilution factor is determined based on the actual extract volume and sample size. For example, if 5 mL of extract corresponds to 0.2 g of sample, the dilution factor is 25. The chlorophyll degradation rate of wild-type plants under 15% PEG-6000 stress is approximately 60%. The screening criterion for transgenic lines was set at a degradation rate of ≤40%. Data were processed using Excel software, and comparisons between groups were performed using the independent sample t-test (P < 0.05 was considered significant).

[0131] The extraction time was set at 24 hours, which increased the extraction efficiency by approximately 8% compared to the 12-hour extraction time reported in the literature. The optical pathlength of the quartz cuvette was calibrated to ±0.01 mm, ensuring accurate absorbance measurements. A baseline blank control was performed once per batch to prevent instrument drift from affecting the results. The dilution factor was calculated based on the principle of conservation of mass, ensuring accurate unit conversion.

[0132] The coefficient of variation (CV) for chlorophyll determination using this method is 3.2%, significantly lower than the traditional grinding method (CV 5.8%). Baseline correction limits absorbance errors to within ±0.005, ensuring comparability of data across different batches. The screening criteria enable an accuracy rate of 92% for assessing the photosynthetic protection of transgenic lines, approximately 25% higher than a single survival rate metric. The experimental cycle is controlled within 26 hours, making it suitable for high-throughput screening.

[0133] According to another embodiment of the present invention, 0.5 g of transgenic plant leaf samples were taken, 5 mL of 3% sulfosalicylic acid solution (purchased from Sigma-Aldrich, catalog number S5136) was added, and the sample was ground into a homogenous slurry using a glass mortar. The homogenate was transferred to a 15 mL centrifuge tube and heated in a boiling water bath for 10 minutes (the water bath can be selected from Shanghai Yiheng HH-6 model), and shaken every 2 minutes during the process. After cooling to room temperature, the sample was centrifuged at 12,000 rpm for 10 minutes at 4°C (the centrifuge can be selected from Eppendorf 5424 model), and the supernatant was used as the test solution. During this process, the osmotic potential of the 3% sulfosalicylic acid solution was measured to be -0.3 MPa, which can effectively precipitate protein and stabilize proline.

[0134] Mix 2 mL of the supernatant with 2 mL of ninhydrin colorimetric solution (1% ninhydrin, 60% glacial acetic acid, 20% concentrated phosphoric acid) and heat in a 95°C water bath for 30 minutes (use the same water bath as above). The colorimetric solution must be prepared freshly for use. Ninhydrin is purchased from Sigma-Aldrich (Cat. No. 102806), and glacial acetic acid (Sinopharm Group, analytical grade) and concentrated phosphoric acid (Sinopharm Group, 85%) are mixed in a volume ratio. After the reaction, immediately cool the centrifuge tube in an ice bath for 10 minutes. Add 4 mL of toluene (Sinopharm Group, analytical grade) for extraction and shake vigorously for 1 minute. After stratification, remove the upper toluene phase.

[0135] The absorbance of the toluene phase was measured using a UV-Vis spectrophotometer (e.g., Shimadzu UV-1800) at a wavelength of 520 nm using a 1 cm pathlength quartz cuvette (Brand, Cat. No. 759200). An equal volume of toluene was used as a blank control, and each sample was measured in triplicate. Proline content was calculated using the formula: (C × V) / (W × 1000) μg / g fresh weight, where C is the concentration obtained from the standard curve (μg / mL), V is the volume of the extract (mL), and W is the sample fresh weight (g). The standard curve was prepared using L-proline (Sigma-Aldrich, Cat. No. P0380) with a concentration range of 0-100 μg / mL. Wild-type plants exhibited approximately 150 μg / g proline under 15% PEG stress, and the screening criterion for transgenic lines was set to ≥300 μg / g.

[0136] The boiling water bath time was set to 10 minutes, which increased the extraction efficiency by approximately 18% compared to the reported 5-minute extraction time. A centrifugal speed of 12,000 rpm effectively removed the precipitate, resulting in a supernatant clarity of 98%. Toluene extraction effectively separated the aqueous and organic phases, achieving an extraction efficiency exceeding 95%. The linear correlation coefficient R of the standard curve was 1. 2 =0.998, ensuring quantitative accuracy.

[0137] The coefficient of variation (CV) for proline determination using this method is 5.1%, significantly lower than the conventional ninhydrin method (CV 8.3%). The colorimetric reaction temperature is strictly controlled at 95°C ± 2°C to ensure reaction consistency. The established screening criteria enable an accuracy rate of 91% for assessing the osmotic regulation capacity of transgenic lines, approximately 23% higher than a single survival rate metric. The experimental cycle is controlled within 6 hours, making it suitable for large-scale sample analysis.

[0138] According to another embodiment of the present invention, PEG-6000 powder (such as purchased from Sigma-Aldrich, product number 81240) is dissolved in a plant nutrient solution (such as Hoagland solution), magnetically stirred (IKARCT basic) for 30 minutes until completely dissolved, and a simulated drought stress solution with a concentration of 15%, 17.5% or 20% (w / v) is prepared. The treatment object is a three-leaf stage transgenic rice plant (such as the Nipponbare variety), the root system is completely immersed in the solution, and the water lost by evaporation is replenished daily (about 5%-10% volume) to maintain a stable concentration. The environmental parameters during the treatment period are set as follows: light intensity 200μmol·m-2·s1 (Conviron E15 can be selected as the light incubator), day and night temperature 25℃ / 22℃, relative humidity 60%-70% (Testo 175-H1 can be selected as the temperature and humidity recorder).

[0139] After 7 days of stress treatment, the plants were transferred to normal hydroponic conditions (Hoagland nutrient solution) and recovered for 3 days. Use transparent plastic containers (such as round petri dishes with a diameter of 10 cm) for hydroponics to ensure that the roots are completely immersed. During the recovery period, the same light, temperature and humidity conditions as the treatment phase were maintained. When counting surviving plants, the survival standard was that the leaves remained green and the base of the stem was not rotten. The sample size for each treatment was set at 30 plants, and repeated 3 times to ensure data reliability.

[0140] Survival rate was calculated as: number of surviving plants / number of initially treated plants × 100%. Wild-type plants had an approximately 30% survival rate under 15% PEG stress, and the screening criterion was set at a survival rate of ≥45% for transgenic lines. Data were processed using Excel software, and intergroup comparisons were performed using the chi-square test (P < 0.05 was considered significant). The experimental period was limited to 10 days, approximately 40% shorter than traditional soil culture methods.

[0141] The PEG solution concentration was calibrated using an osmometer (Advanced Instruments 3320). PEG concentrations of 15%, 17.5%, and 20% corresponded to osmotic potentials of -0.5 MPa, -0.7 MPa, and -0.9 MPa, respectively. During recovery, the pH of the nutrient solution was adjusted to 5.8 ± 0.1 (a Mettler Toledo FE20 pH meter was recommended). A sample size of 30 strains per group was used, and statistical power analysis (α = 0.05, β = 0.8) was performed.

[0142] This method maintains a statistical error rate of ±5% for survival rates, approximately 20% higher than traditional visual assessment methods. Precise control of environmental parameters results in a stress treatment reproducibility of 92% and plant mortality of less than 3% during the recovery phase. The established screening criteria enable an 89% accuracy rate for drought tolerance assessment of transgenic lines, approximately 20% higher than using a single chlorophyll indicator. The experimental cycle is shortened to 10 days, making it suitable for rapid identification of multiple batches of transgenic plants.

[0143] According to another embodiment of the present invention, PEG-6000 powder (such as purchased from Sigma-Aldrich, product number 81240) is dissolved in a plant nutrient solution (such as Hoagland solution) at a ratio of 15%, 17.5% or 20% (w / v), and stirred continuously at 300 rpm for 30 minutes using a magnetic stirrer (such as IKA RCT basic) until completely dissolved. The solution concentration is calibrated by an ice point osmometer (Advanced Instruments 3320), and the osmotic potentials corresponding to concentrations of 15%, 17.5%, and 20% are -0.5 MPa, -0.7 MPa, and -0.9 MPa, respectively. The nutrient solution formula contains: Ca(NO3)2·4H2O 945 mg / L, KNO3607 mg / L, NH4H2PO4 115 mg / L, MgSO4·7H2O 493 mg / L, and trace element solution 1 mL / L.

[0144] When the transgenic rice plants grow to the three-leaf stage, their roots are completely immersed in a 5L plastic container (such as a 25cm diameter round pot) filled with a PEG-6000 solution of the corresponding concentration. Water loss due to evaporation (approximately 5%-10% volume) is replenished daily by measuring and adding deionized water using a graduated cylinder (accuracy ±5mL) to maintain a stable solution concentration. The root immersion depth is controlled at 5-8cm to ensure that the root tip is completely immersed. During the treatment, the solution pH is monitored using a pH meter (Mettler Toledo FE20) and adjusted to 5.8±0.1 with 1M NaOH or HCl when necessary.

[0145] During the treatment, the light intensity was maintained at 200 μmol·m2·s-1 (Conviron E15 can be selected as the light incubator), and the light cycle was 16 hours of light / 8 hours of darkness. The day and night temperatures were set at 25°C (daytime) and 22°C (nighttime), respectively, and a temperature controller (such as RWD 6402) was used to maintain a stable temperature. The relative humidity was controlled at 60%-70% and adjusted by a humidifier (such as Yadu SZK-J350) and a dehumidifier (such as Deye DYD-E12A3). The temperature and humidity data were automatically recorded every hour by a temperature and humidity recorder (Testo175-H1) to ensure that the environmental parameters did not fluctuate by more than ±2%.

[0146] The osmotic potential calibration error of the PEG solution was controlled within ±0.05 MPa to ensure consistent stress intensity. The trace element solution in the plant nutrient solution contained: 2.86 mg / L H₃BO₃, 1.81 mg / L MnCl₂·4H₂O, 0.22 mg / L ZnSO₄·7H₂O, 0.08 mg / L CuSO₄·5H₂O, and 0.02 mg / L Na₂MoO₄·2H₂O. The container was made of black plastic to reduce algae growth. The solution volume to plant number ratio was 1 L per 10 plants to ensure ample space for root growth.

[0147] This method achieved a 99.2% stability in PEG solution concentration, approximately 15% higher than the traditional manual supplementation method. Environmental parameter fluctuations were controlled within ±2%, ensuring repeatability of the stress treatment. Plant mortality during treatment was less than 5%, approximately 20% lower than that achieved using soil culture. The correlation between osmotic potential and field drought reached 0.82 (P < 0.01), improving the consistency between screening results and actual drought tolerance by approximately 30%. The experimental period was controlled within 7 days, approximately 50% shorter than the soil drought method, making it suitable for large-scale drought resistance testing of transgenic plants.

[0148] According to another embodiment of the present invention, a quartz cuvette with an optical path of 1 cm (such as the 759200 model produced by Brand) is used to load the chlorophyll extract. The cuvette needs to be rinsed three times with 80% acetone solution (analytical grade, Sinopharm Group) before use to avoid cross contamination. The extract is slowly injected along the inner wall of the cuvette, and the liquid level is controlled at 2 / 3 of the height of the cuvette, about 3 mL. Use lens paper to wipe the outer wall of the cuvette to ensure that there are no fingerprints or liquid residues to avoid affecting the transparency of the light path.

[0149] Place the loaded quartz cuvette into the sample chamber of a UV-Vis spectrophotometer (e.g., Shimadzu UV-1800), ensuring that the illuminated surface of the cuvette is aligned with the optical path. Select "Single Wavelength Measurement" mode on the instrument interface, setting the wavelengths to 663 nm and 645 nm, respectively. Repeat the measurement three times at each wavelength, with a 30-second interval between each measurement, and take the average value as the final absorbance value. Instrument parameters are set as follows: scan range 400-700 nm, slit width 2 nm, response time 0.5 s, and data acquisition interval 1 nm.

[0150] Before measurement, perform baseline correction using an 80% acetone solution as a blank control. Place the blank control cuvette in the sample compartment and click the "Auto Zero" button to automatically subtract the blank signal. After baseline correction, measure the blank control absorbance three times in a row, ensuring that the value remains stable within ±0.005. If it exceeds this range, rerinse the cuvette and perform baseline correction again. Perform blank control correction again after every 10 samples during the experiment to ensure instrument stability.

[0151] The optical pathlength accuracy of the quartz cuvettes was calibrated to ±0.01 mm, in compliance with ISO 3568. An 80% acetone solution was prepared by mixing 80 mL of acetone (Sinopharm Group, analytical grade) with 20 mL of deionized water. The instrument's wavelength accuracy was verified using standard filters (e.g., NIST-traceable praseodymium-neodymium filters) with an error of ±0.5 nm. Data were recorded using Excel software and expressed as mean ± standard deviation. Intergroup comparisons were performed using an independent sample t-test (P < 0.05 was considered significant).

[0152] This method maintains an absorbance measurement error rate within ±0.005, improving accuracy by approximately 40% compared to traditional manual zeroing methods. Baseline correction ensures 98% comparability between experimental batches, minimizing the impact of instrument drift. Averaging three replicates reduces the coefficient of variation (CV) to 2.8%, a reduction of approximately 60% compared to a single measurement. SPSS software analysis of the experimental data demonstrated a reproducibility of 95%, making it suitable for the precise determination of chlorophyll content in high-throughput screening.

[0153] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the description and implementation methods. They can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A genetic engineering method for improving plant drought resistance, characterized in that: The following steps are involved: a) isolating the full-length open reading frame (ORF) sequence of the AmASMT gene from Agropyron mongolicum, wherein the base sequence thereof is as shown in SEQ ID NO: 3; b) connecting the ORF sequence of the AmASMT gene to a plant expression regulatory element to construct an overexpression vector pBWA(V)HS-AmASMT-osgfp, wherein the regulatory element includes a constitutive promoter and a selection marker gene; c) transferring the overexpression vector into rice callus by Agrobacterium EHA105-mediated genetic transformation; d) Under simulated drought stress conditions, PEG-6000 was used to screen out transgenic rice T1 plants with overexpression of the AmASMT gene and significantly enhanced drought resistance.

2. The genetic engineering method for improving plant drought resistance according to claim 1, characterized in that: The Agrobacterium-mediated genetic transformation method in step c) specifically comprises the following steps: i) transferring the overexpression vector pBWA(V)HS-AmASMT-osgfp into Agrobacterium EHA105 strain by liquid nitrogen freeze-thaw method; ii) using a co-culture solution containing acetosyringone (AS), co-culturing the Agrobacterium carrying the vector with rice callus for 48 hours; iii) obtaining transgenic rice callus stably integrated with the AmASMT gene through hygromycin screening and PCR verification.

3. The genetic engineering method for improving plant drought resistance according to claim 1, characterized in that: The full-length ORF sequence of the AmASMT gene described in step a) is cloned by the following steps: i) extracting total RNA from leaves of Salix serrata, and synthesizing the first-chain cDNA using reverse transcriptase; ii) Design a specific primer pair, the nucleotide sequence of which is: Forward primer: SEQ ID NO: 1 5′-ATGGCGCTCACCAGGGAG-3′, Reverse primer: SEQ ID NO: 2 5′-TGGGTAAACCTCGATGATCGATCTC-3′; iii) PCR amplification using a high-fidelity DNA polymerase, the amplification procedure is: Pre-denaturation: 94°C for 5 minutes; Cycling parameters: denaturation at 94°C for 30 seconds, annealing at 50°C for 30 seconds, and extension at 72°C for 65 seconds, for a total of 30 cycles; Final extension: 72°C for 10 min; iv) separating the amplified products by agarose gel electrophoresis, excising the gel to recover the target fragment, ligating it to a cloning vector and transforming it into Escherichia coli; v) Through colony PCR and sequencing verification, a positive clone containing the complete ORF sequence of the AmASMT gene was obtained.

4. The genetic engineering method for improving plant drought resistance according to claim 1, characterized in that: The simulated drought stress condition in step d) is: treating the transgenic rice plants with a PEG-6000 solution at a concentration of 15%-20% w / v for 5-7 days, and screening out transgenic plants with significantly enhanced drought resistance by measuring chlorophyll content, proline accumulation and plant survival rate.

5. The genetic engineering method for improving plant drought resistance according to claim 1, characterized in that: The screening in step d) comprises the following steps: i) measuring the chlorophyll content of the leaves of the transgenic plants by spectrophotometry, and selecting strains with a chlorophyll degradation rate lower than 40% of that of the wild-type plants; ii) using the ninhydrin colorimetric method to determine the proline accumulation in leaves, and screening for strains with proline content more than 2 times higher than that of wild-type plants; iii) Counting the survival rate of plants under drought stress, and selecting strains with a survival rate 50% higher than that of the wild type; iv) Combining the above indicators, transgenic plants with significantly enhanced drought resistance are obtained.

6. The genetic engineering method for improving plant drought resistance according to claim 5, characterized in that: The specific steps of measuring the chlorophyll content by spectrophotometry in step i) are: a) taking leaf samples of the transgenic plants, and extracting them with 80% acetone solution in the dark for 24 hours to obtain chlorophyll extract; b) using a spectrophotometer to measure the absorbance of the extract at wavelengths of 663 nm and 645 nm, respectively; c) Calculate the total chlorophyll content according to the Lichtenthaler formula: Total chlorophyll = (8.02 × A 663 +20.21×A 645 )×dilution factor (mg / g fresh weight) d) Screening transgenic lines whose total chlorophyll degradation rate is less than 40% of that of wild-type plants.

7. The genetic engineering method for improving plant drought resistance according to claim 5, characterized in that: The specific steps of determining the proline accumulation amount by the ninhydrin colorimetric method in step ii) are: a) taking leaf samples of transgenic plants, adding 3% w / v sulfosalicylic acid solution, grinding, extracting in a boiling water bath for 10 minutes, and collecting the supernatant after centrifugation; b) Mix the supernatant with an equal volume of ninhydrin colorimetric solution containing 1% ninhydrin, 60% glacial acetic acid, and 20% concentrated phosphoric acid, and develop the color in a 95°C water bath for 30 minutes; c) after cooling, using a spectrophotometer to measure the absorbance at a wavelength of 520 nm, and calculating the proline content μg / g fresh weight based on a standard curve; d) Screening transgenic lines with proline content increased by more than 2 times compared with wild-type plants.

8. The genetic engineering method for improving plant drought resistance according to claim 5, characterized in that: The specific steps of calculating the survival rate of plants under drought stress in step iii) are: a) When the transgenic rice plants grew to the three-leaf stage, a PEG-6000 solution with a concentration of 15%-20% (w / v) was applied to simulate drought stress for 7 days; b) After the stress ends, normal hydroponic conditions are restored for 3 days and the number of surviving plants is counted; c) The survival rate calculation formula is: Survival rate = number of surviving plants × number of initial treatment plants × 100% d) Screening transgenic lines whose survival rate is at least 50% higher than that of wild-type plants.

9. The genetic engineering method for improving plant drought resistance according to claim 4, characterized in that: The PEG-6000 solution with a concentration of 15%-20% w / v was prepared and applied by the following steps: a) dissolving PEG-6000 powder in a plant nutrient solution, stirring magnetically until completely dissolved, and preparing a simulated drought stress solution of a target concentration; b) when the transgenic rice plants grow to the three-leaf stage, completely immersing the roots of the plants in the PEG-6000 solution, and replenishing the water lost by evaporation every day to maintain a constant concentration; c) The treatment is continued for 5-7 days, during which the light intensity is maintained at 200 μmol·m-2·s-1, the day and night temperature is maintained at 25°C / 22°C, and the relative humidity is maintained at 60%-70%.

10. The genetic engineering method for improving plant drought resistance according to claim 6, characterized in that: The spectrophotometer determination method in step b) further comprises: i) using a quartz cuvette with an optical path of 1 cm to load the chlorophyll extract; ii) Measure the absorbance at wavelengths of 663 nm and 645 nm respectively, repeat the measurement 3 times at each wavelength and take the average value; iii) Before the measurement, 80% acetone solution was used as a blank control for baseline correction to ensure that the absorbance value error was less than ±0.005.

Images