SNP (Single Nucleotide Polymorphism) marker related to Duroc pig breed identification and application thereof

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) marker related to duroc pig breed identification and application thereof. The molecular marker contains a sequence as shown in SEQ ID NO.1, the sequence contains an rs327637000 nucleotide site at the 44090690bp position of chromosome 8 of a reference sequence of an international pig genome version 11.1, the polymorphism on the site is G / T, the TT genotype is Duroc pig, the TG genotype is Duroc long ternary pig, and the GG genotype is long binary pig. The SNP marker provided by the invention can be used for simply and efficiently identifying Duroc and Duroc long-growing three-way pigs and long-growing two-way pigs, and is convenient for breeders to perform breeding background tracing. The invention provides a new technical means for pig breed identification, and has important application value and social benefit.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology and genetic breeding, and particularly relates to an SNP marker related to Duroc pig breed identification and its application. Background Art

[0002] The pig breeds widely raised in the current livestock industry are: Duroc, Duroc-Landrace-Yorkshire three-way cross pigs (i.e., the three-way cross offspring of Duroc, Landrace and Yorkshire), and Landrace-Yorkshire two-way cross pigs (i.e., the two-way cross offspring of Landrace and Yorkshire). Among them, Duroc pigs are famous for their fast growth rate, strong physique, strong stress resistance, etc., and are widely used as terminal sires in the commercial pig breeding system in China.

[0003] In the livestock industry, there are significant differences in growth rate, meat quality, reproductive ability, etc. among different breeds of pigs. Therefore, accurately distinguishing the breeds of pigs is of great significance for formulating scientific breeding strategies, optimizing the breeding structure, and improving economic benefits. Secondly, Duroc, Duroc-Landrace-Yorkshire three-way cross pigs and Landrace-Yorkshire two-way cross pigs, as important economic pig breeds, play a crucial role in the pig industry. However, with the expansion of the breeding scale and the popularization of cross-breeding among breeds, there are often cases of pedigree record errors or even losses in production. Pig breed identification is a key link to ensure breeding efficiency and genetic stability. Traditional pig breed identification methods mainly rely on morphological characteristics and physiological indicators, such as body shape, coat color, ear shape, growth rate, etc. However, these methods are easily affected by various factors such as environment, feeding conditions, growth and development stages, etc., resulting in inaccurate and unstable identification results. In addition, for young pigs or pig breeds with similar appearance characteristics, traditional methods are often difficult to effectively distinguish. Incorrect judgments will slow down the genetic progress of the population and cause greater breeding losses than pedigree loss. Therefore, it is particularly important to develop an accurate, stable and efficient pig breed identification method for widely raised pigs.

[0004] With the rapid development of molecular biology technology, molecular marker technology based on single nucleotide polymorphism (SNP) has gradually become a new means for pig breed identification. SNP refers to DNA sequence polymorphism caused by variation of a single nucleotide at the genomic level, which has advantages such as a large number, wide distribution, and good genetic stability. By detecting the genotypes of specific SNP loci, accurate identification of pig breeds can be achieved. In the pig genome, there are SNP loci related to breeds, and significant genotype differences exist among different breeds. Using SNP markers provides a new technical means for pig breed identification, with important application value and social benefits. Existing research has not found SNP loci with completely different genotypes in Duroc, Duroc-Landrace-Yorkshire three-way cross pigs, and Landrace-Yorkshire two-way cross pigs. Therefore, breed identification can only be carried out by combining a large number (more than 1000) of SNP loci with certain differences through a statistical model. Therefore, there is an urgent need to develop SNP markers and their identification methods related to the identification of Duroc, Duroc-Landrace-Yorkshire three-way cross pigs, and Landrace-Yorkshire two-way cross pigs. Summary of the Invention

[0005] To solve the above problems, the present invention provides an SNP marker related to Duroc pig breed identification and its application.

[0006] The present invention provides an SNP molecular marker related to Duroc pig breed identification, and the molecular marker contains the sequence shown in SEQ ID NO.1. The sequence contains the rs327637000 nucleotide locus at the 44090690bp position on chromosome 8 of the international pig genome version 11.1 reference sequence. The polymorphism at this locus is G / T, where the TT genotype is Duroc pig, the TG genotype is Duroc-Landrace-Yorkshire three-way cross pig, and the GG genotype is Landrace-Yorkshire two-way cross pig.

[0007] The present invention also provides a pair of PCR primers for detecting the above SNP molecular marker. The pair of PCR primers includes a forward primer with the nucleotide sequence shown in SEQ ID NO.2 and a reverse primer with the nucleotide sequence shown in SEQ ID NO.3.

[0008] The present invention also provides a pair of KASP primers for detecting the above SNP molecular marker. In the pair of KASP primers: the nucleotide sequence of the forward primer for detecting Allele T is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer for detecting Allele G is shown in SEQ ID NO.5, and the nucleotide sequence of the common reverse primer is shown in SEQ ID NO.6.

[0009] The present invention also provides a kit for detecting the above SNP molecular marker, and the kit contains the primer pair described in claim 2 or 3.

[0010] The SNP molecular markers provided by the present invention are applied in pig breeding.

[0011] The beneficial effects of the present invention are as follows:

[0012] The SNP markers provided by the present invention can simply and efficiently identify Duroc pigs, Duroc×Landrace×Yorkshire three-way cross pigs, and Landrace×Yorkshire two-way cross pigs. Among them, Duroc pigs have a TT genotype at this locus, Duroc×Landrace×Yorkshire three-way cross pigs have a TG genotype at this locus, and Landrace×Yorkshire two-way cross pigs have a GG genotype at this locus. The Duroc pigs, Duroc×Landrace×Yorkshire three-way cross pigs, and Landrace×Yorkshire two-way cross pigs can be efficiently identified through this SNP marker, the pedigree data with missing or incorrect records can be corrected, and the Duroc pigs, Duroc×Landrace×Yorkshire three-way cross pigs, and Landrace×Yorkshire two-way cross pigs with indistinguishable phenotypic differences can be accurately distinguished, which is convenient for breeders to trace the breeding background. The present invention provides a new idea for developing an accurate, stable, and efficient pig breed identification method. The present invention has a wide range of applications and is not affected by whether the pigs are sold, dead, or have correct pedigree records. The molecular markers and primers developed based on the SNPs of the present invention can be used for rapid high-throughput detection of SNPs. As long as the genotype is measured, the sample variety can be known. At present, machine learning algorithms need to be based on more than 1000 loci to distinguish genetically similar breeds, while the present invention only needs to detect 1 locus, greatly reducing the measurement cost. The present invention provides a new technical means for pig breed identification and has important application value and social benefits.

[0013] In addition, the present invention provides a method for detecting the above molecular markers by KASP primers. This detection method does not require synthesizing specific fluorescent probes for each SNP locus, but is based on its unique ARM PCR principle, enabling all locus detections to ultimately use universal fluorescent primers for amplification, greatly reducing the cost of reagents and having high accuracy, providing a simple, accurate, and low-cost operation method for the detection of the molecular markers of the present invention. Description of the Drawings

[0014] Figure 1 It is a statistical chart of the accuracy of pedigree ratio prediction in Example 2;

[0015] Figure 2 It is a gel electrophoresis diagram of the amplified fragment at the rs327637000 locus at 44090690 bp on chromosome 8 of pigs in Example 3;

[0016] Figure 3 It is the sequencing result of the rs327637000 locus at 44090690 bp on chromosome 6 and chromosome 8 of pigs in Example 3;

[0017] Figure 4 It is the result of using the SNP locus to identify the breed of the pigs to be tested in Example 4. Detailed Embodiments

[0018] The present invention will be further described below in conjunction with embodiments.

[0019] Unless otherwise specified, the technical means used in the embodiments are conventional means well-known to those skilled in the art. Unless otherwise specified, all reagents used in this method are of analytical purity or above specifications.

[0020] Embodiment 1:

[0021] There are certain differences in traits such as litter size and age at 100 kg body weight among pig breeds. Quantitative traits are affected by multiple genes, and it is possible that the differences between breeds are only caused by individual genotypes among a large number of trait-related genes. Therefore, it is only possible to screen out the relevant loci for breed identification among a large number of loci. The porcine liquid-phase 100K chip developed by Shijiazhuang Borui Biotechnology Co., Ltd. contains 18,800 loci related to economic traits and is evenly distributed on each chromosome. Since trait-related loci are randomly distributed on the chromosome, it contains or links the trait-related loci to the greatest extent. Therefore, the porcine liquid-phase 100K chip developed by Shijiazhuang Borui Biotechnology Co., Ltd. was used to detect the genotypes of 1,649 Duroc pigs, 1,437 Landrace × Large White F1 pigs, and 1,211 Duroc × (Landrace × Large White) F1 pigs from 17 pig farms in 6 provinces of Xinjiang, Hebei, Sichuan, Anhui, Hunan, and Guangdong in China. The Borui porcine liquid-phase 100K chip contains 84,889 loci and can be used for analyses such as GS, GWAS, selection signal analysis, and breed identification. The design principle is as follows:

[0022] 1) Select 18,800 SNPs located in QTL regions related to porcine economic traits from the QTLdb database. The traits include: litter size, age at 100 kg body weight, backfat thickness at 100 kg, feed conversion rate, etc.;

[0023] 2) The SNP loci are evenly distributed on the chromosome so that they can capture the QTLs related to economic traits to the greatest extent;

[0024] 3) In the population composed of Duroc, Landrace, and Large White pigs, the minor allele frequency of the SNP loci is greater than 0.35.

[0025] In this embodiment, 1,649 Duroc pigs, 1,437 Landrace×Large White crossbred pigs, and 1,211 Duroc×(Landrace×Large White) crossbred pigs of determined breeds from 17 pig farms in 6 provinces of Xinjiang, Hebei, Sichuan, Anhui, Hunan, and Guangdong in China were genotyped using a porcine liquid-phase 100K chip. Based on plink, loci with SNP detection rates lower than 0.9, multi-allelic loci, and samples with individual detection rates lower than 0.9 were removed. After that, the genotype frequencies of each locus for the three breeds were calculated by Python. It was found that at the rs327637000 locus at 44,090,690 bp on chromosome 8, the genotype of Duroc pigs was all TT, the genotype of 99.58% of Landrace×Large White crossbred pigs was GG, and the genotype of 99.42% of Duroc×(Landrace×Large White) crossbred pigs was GT.

[0026] Example 2: Verification of the SNP loci obtained in Example 1:

[0027] In this example, the random forest (RF) method was used to verify whether the SNP loci obtained in Example 1 could be used to distinguish Duroc pigs, Landrace×Large White crossbred pigs, and Duroc×(Landrace×Large White) crossbred pigs.

[0028] In this example, a training set consisting of 2,530 Large White pigs, 1,672 Landrace pigs, 1,649 Duroc pigs, 1,437 Landrace×Large White crossbred pigs, and 1,211 Duroc×(Landrace×Large White) crossbred pigs, a total of 8,499 pigs, was constructed for RF model training to evaluate the importance of each locus. We performed one-hot re-encoding on the genotype information (referred to as one-hot features), and after re-encoding the breed information by bloodline proportion, it was input into the RF model for training to obtain the importance values of each one-hot feature for breed identification.

[0029] As Figure 1 shown, a certain proportion of one-hot features were sequentially selected and input into a multi-layer perceptron model for breed prediction, and the absolute coefficient (R 2 ) of the predicted bloodline proportion and the true bloodline proportion was calculated. It was found that when the top 0.07% of one-hot features were selected, the bloodline proportion prediction accuracy was the highest, that is, the breed identification accuracy was the highest. Therefore, it was considered that the loci to which this part of the one-hot features belonged were the most important loci for breed identification information sources, a total of 191.

[0030] The genotype frequencies of the 191 screened loci were statistically analyzed, and it was found that the SNP locus located at 8_44090690 (ranked first in importance) could be used to distinguish Duroc pigs, Landrace×Large White crossbred pigs, and Duroc×(Landrace×Large White) crossbred pigs.

[0031] Example 3: Construction of the SNP locus genotype detection method:

[0032] Using the reference sequence of Sus scrofa genome version 11.1 and the DNA sequence of chromosome 8 as a template, primers were designed: forward primer A1 and reverse primer A2. The primer sequences are as follows:

[0033] Forward primer A1 (SEQ ID NO.2): 5’-GCTGTAACTCCCGGTACATCA-3’

[0034] Reverse primer A2 (SEQ ID NO.3): 5’-TCTTTAGCCTGCAAGGCCTATT-3’

[0035] DNA extraction, PCR amplification and sequencing:

[0036] Genomic DNA was extracted from the tissues of the pigs to be tested and used as a DNA template for PCR amplification. The total reaction volume of the amplification was 20 μL, including 1 μL of DNA template, 0.4 μL each of the primers shown by forward primer A1 and reverse primer A2 (concentration: 10 μmol / L), 10 μL of PCR Mix reagent, and 7.2 μL of double-distilled water. The PCR amplification reaction conditions were:

[0037]

[0038] The PCR products were detected by electrophoresis in 1% agarose gel. The size of the amplified target fragment containing the rs327637000 locus at 44090690 bp on chromosome 8 was approximately 986 bp. The electrophoresis pattern is shown in Figure 2 , and the remaining amplified products were sequenced. The specific nucleotide sequence of this amplified fragment is shown in SEQ ID NO.1. There is a polymorphic site in this fragment. Specifically, at the 800th bp of SEQ ID NO.1, K is either T or G. That is, the genotype sequencing map of the rs327637000 locus at 44090690 bp on chromosome 8 is shown in Figure 3 , where Figure 3-1 and Figure 3-2 are TG Sanyuan pigs, Figure 3-3 and Figure 3-4 are TT Duroc pigs, Figure 3 -5 and Figure 3 -6 are GG Landrace×Large White pigs.

[0039] Example 4: Using the SNP locus to identify the breeds of pigs to be tested:

[0040] 4.1 First, primer sequences were designed:

[0041] KASP primer pairs were designed for the G / T polymorphic locus of the amplified fragment in Example 3 for specific detection of this polymorphic locus. The nucleotide sequences of the designed KASP primer pairs are:

[0042] The forward HEX-labeled primer B1 (SEQ ID NO.4) for detecting Allele T is as follows:

[0043] SEQ ID NO.4: GAAGGTCGGAGTCAACGGATTTGTCCACAGCTCTTCAGTCT

[0044] The forward FAM-labeled primer B2 (SEQ ID NO.5) for detecting Allele G is as follows:

[0045] SEQ ID NO.5: GAAGGTGACCAAGTTCATGCTTGTCCACAGCTCTTCAGTCG;

[0046] The universal reverse primer C (SEQ ID NO.6) is as follows:

[0047] SEQ ID NO.6 (universal reverse primer C): TCTCCTGTGTTTGACCTTGC.

[0048] The above primers were synthesized by Sangon Biotech Co., Ltd. Dilute each group of primers in the KASP primer pair to 10 μmol / L and mix them evenly for standby according to the volume ratio of primers of 12:12:30.

[0049] 4.2 Secondly, quality control was carried out on the extracted genomic DNA:

[0050] Genomic DNA was extracted from the pigs to be tested (20 Duroc pigs, 20 Landrace × Large White pigs, and 20 Duroc × Landrace × Large White pigs were randomly selected as the pigs to be tested in order to verify the accuracy of the method), and a DNA extraction kit could be used. Quality detection was carried out on the extracted genomic DNA. 1% agarose electrophoresis and Nanodrop2100 were used for detection respectively. The qualified DNA requirements were: (1) Agarose electrophoresis showed a single DNA band without obvious smearing. (2) The A260 / 280 detected by Nanodrop2100 was between 1.8 - 2.0; the A260 / 230 was between 1.8 - 2.0; there was no obvious light absorption at 270 nm. According to the KASP detection technology of LGC Company in the UK and the genome size, the DNA usage was calculated to be 10 - 20 ng / sample, and the extracted genomic DNA was diluted to a concentration of 10 - 20 ng / μL as the DNA template for standby.

[0051] 4.3 Genotyping was carried out:

[0052] First, add 1.5 μL of the diluted DNA template to be tested (10 - 20 ng / μL) and a blank control (No template control, NTC, using sterilized water) into a 96-well reaction plate respectively, and dry at 60 °C for 30 min until the DNA becomes dry powder for standby.

[0053] Dilute each primer in the above KASP primer pair to 10 μmol / L, and mix them as a primer mixture for standby according to the volume ratio of 12:12:30. Add 1×Master mix (KBS-1016-011) and the primer mixture to each reaction well respectively. After the Mix is dispensed, seal the film, and use Bio-Rad CFX 96 for PCR amplification. The specific procedure is as follows:

[0054]

[0055] View the fluorescence signal and interpret the genotyping. The specific results are as Figure 4 shown. Among them, each point in the figure represents a material to be tested. The blue square near the upper left corner indicates that the locus is a homozygous genotype "TT"; the green triangle near the middle indicates that the locus is a heterozygous genotype "TG"; the orange dot near the lower right side indicates that the locus is a homozygous genotype "GG"; the black square represents NTC, which is the blank control without adding DNA. Infer the breed from the genotype of this locus. The TT genotype is Duroc pigs, the TG genotype is Duroc-Landrace-Yorkshire three-way cross pigs, and the GG genotype is Landrace-Yorkshire two-way cross pigs. The results show that among the 60 pigs to be tested in this example, 20 were identified as Duroc pigs, 20 as Landrace-Yorkshire two-way cross pigs, and 20 as Duroc-Landrace-Yorkshire three-way cross pigs by the method of the present invention, and the accuracy rate is 100%.

[0056] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention. Therefore, in any aspect, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be included in the present invention.

[0057] In addition, it should be understood that although this specification is described according to the embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A SNP molecular marker related to Duroc pig breed identification, characterized in that: The molecular marker contains a sequence as shown in SEQ ID NO.1, which contains the rs327637000 nucleotide site located at the 44090690bp of chromosome 8 of the international pig genome version 11.1 reference sequence. The polymorphism at this site is G / T, wherein the TT genotype is Duroc pig, the TG genotype is Duroc-Changda three-way pig, and the GG genotype is Changda two-way pig.

2. A PCR primer pair for detecting the SNP molecular marker according to claim 1, characterized in that: The PCR primer pair includes a forward primer whose nucleotide sequence is shown as SEQ ID NO.2 and a reverse primer whose nucleotide sequence is shown as SEQ ID NO.

3.

3. A KASP primer pair for detecting the SNP molecular marker according to claim 1, characterized in that: In the KASP primer pair: the nucleotide sequence of the forward primer for detecting Allele T is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer for detecting Allele G is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.

6.

4. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The kit comprises the primer pair according to claim 2 or 3.

5. Use of the SNP molecular marker according to claim 1 in pig breeding.

Images