Application of NPFFR2 gene SNP (Single Nucleotide Polymorphism) site in judging hysteritis resistance of dairy cow

Through genome-wide association analysis and PCR sequencing technology, the NPFFR2 gene SNP site rs110326785 was screened to identify uterine inflammation resistance in dairy cows, solve the problems of high incidence of uterine inflammation and antibiotic residues in dairy cows, and achieve optimized breeding and economic benefits of dairy herds.

CN120230866AActive Publication Date: 2025-07-01INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI +1

Patent Information

Application Number
CN202510678621.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-26
Publication Date
2025-07-01
Estimated Expiration
2045-05-26

AI Technical Summary

Technical Problem

In the prior art, the incidence of uterine inflammation in dairy cows is high, resulting in a decline in reproductive performance and economic losses in dairy cows. Antibiotic treatment has problems with bacterial resistance and dairy antibiotic residues, and there is a lack of effective genetic improvement means to improve uterine inflammation resistance.

Method used

The SNP site rs110326785 in the NPFFR2 gene was screened as candidate genes by using genome-wide association analysis technology. The uterine inflammation resistance of cows was identified through PCR and sequencing technology, and the individuals of cows with GG genotypes were screened as individuals with high uterine inflammation resistance for assisted breeding.

Benefits of technology

Effectively identify and screen individuals with high uterine inflammation resistance, reduce the incidence of uterine inflammation, reduce the use of antibiotics, reduce economic losses, and improve the reproductive performance of dairy herds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230866A_ABST
    Figure CN120230866A_ABST
Patent Text Reader

Abstract

The invention discloses application of an NPFFR2 gene SNP site in judgment of dairy cow hysteritis resistance, and belongs to the technical field of livestock and poultry molecular biology, the SNP site is rs110326785, and the site generates Ggt; the metritis resistance of a dairy cow individual with the genotype of GG at the site is obviously higher than that of dairy cow individuals with the genotypes of GA and AA. The mutation of the SNP site rs110326785 is missense mutation, so that glutamic acid at the 406th site of an amino acid sequence coded by NPFFR2 mutates into lysine, when the genotype of the site is GG, the dairy cow metritis resistance is the highest, and the SNP site can be used for screening and identifying dairy cows with high metritis resistance, so that dairy cow individuals with high metritis resistance are selected for cattle herd optimization and auxiliary breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of livestock and poultry molecular biology, and specifically relates to the application of SNP loci of the NPFFR2 gene in judging the high or low resistance of dairy cows to metritis. Background Art

[0002] Bovine metritis is a uterine inflammation caused by bacterial infection, usually occurring within 21 days after parturition (most commonly within 7 days). Cows suffering from metritis secrete reddish-brown watery and foul-smelling uterine secretions and show symptoms of systemic infection, including fever, lethargy, loss of appetite, increased heart rate, decreased milk production, etc. Postpartum metritis is highly harmful and seriously damages the reproductive performance of dairy cows, resulting in low conception rates and increased non-pregnant days in diseased dairy cows, thus increasing the reproductive cost of dairy cows and even leading to infertility in dairy cows, increasing the risk of culling diseased dairy cows. The incidence of postpartum metritis is high, and 5-20% of cows in the postpartum dairy cow population suffer from metritis. In short, metritis has caused huge economic losses to dairy cow breeding enterprises.

[0003] Using antibiotics is a common method for effectively treating bovine metritis, but there are problems of bacterial drug resistance and antibiotic residues in dairy products. Currently, bacterial drug resistance has become an important issue of concern in the field of global public health. The incidence of bovine metritis is affected by both genetic and environmental factors. Genetically improving dairy cows to enhance their metritis resistance (METR) and breeding new germplasms of metritis-resistant dairy cows can reduce the incidence of metritis, reduce the use of antibiotics, thereby reducing the problems of bacterial drug resistance and antibiotic residues in dairy products, and reducing the economic losses of dairy cow breeding enterprises. It is also one of the important ways to achieve cost reduction, quality improvement and efficiency increase in Chinese dairy cow breeding enterprises.

[0004] Metritis resistance belongs to a trait with low heritability. When the genetic selection index in the United States was updated in 2018, the metritis resistance trait was included in the lifetime net worth index. Although more reliable genetic estimated breeding values (EBVs) generated based on genotype prediction can now be used to evaluate the metritis resistance index of dairy cows, there are currently few research reports on the genetic mechanism analysis of the factors affecting Holstein cow metritis resistance, and the development of related genetic markers needs to be strengthened urgently. Using the genome-wide association study (GWAS) method can effectively locate key candidate molecular marker loci related to traits and analyze the genetic mechanism of complex traits.

[0005] The neuropeptide FF receptor 2 gene (NPFFR2) encodes a member of the G-protein-coupled neuropeptide receptor subfamily and functions by being activated by neuropeptide A-18-amide (NPAF) and F-8-amide (NPFF). Moreover, NPFFR2 is involved in anti-inflammatory effects in vivo and in vitro by being activated by NPFF and can regulate the proliferation of human T lymphocytes. It is reported in the open literature that in the study of Holstein cattle, the NPFFR2 gene was found to be one of the candidate genes for mastitis susceptibility, and a missense mutation site rs110326785 in the NPFFR2 gene might be a potential causal mutation related to mastitis resistance in Holstein cattle (Wu et al., Association analysis for udder health based on SNP-panel and sequence data in Danish Holsteins. Genet Sel Evol. 2015 Jun 19;47(1):50.; Cai et al., Meta-analysis of six dairy cattle breeds reveals biologically relevant candidate genes for mastitis resistance. Genet Sel Evol. 2024 Jul 15;56(1):54.). In addition, using the GWAS method, 3 SNPs related to body conformation traits in Holstein cattle were identified in the NPFFR2 gene, including the rs110326789 locus (Li S et al., Genome-wide association analysis of body conformation traits in Chinese Holstein Cattle. BMC Genomics. 2024 Dec 3;25(1):1174).

[0006] Regarding the association between NPFFR2 and metritis resistance, there is no research report at present. In view of this, the present invention is specifically proposed. Summary of the Invention

[0007] The object of the present invention is to provide a new use of the SNP locus rs110326785 of the NPFFR2 gene for judging the level of metritis resistance in dairy cows.

[0008] The technical solution of the present invention is described in detail as follows: In a first aspect, the present invention provides the use of the SNP locus of the NPFFR2 gene in determining the resistance of dairy cows to metritis. The SNP locus is rs110326785, and a base mutation of G>A occurs at this locus. The resistance of dairy cows with the genotype GG at this locus to metritis is significantly higher than that of dairy cows with the genotypes GA and AA.

[0009] In a second aspect, the present invention provides the use of the nucleotide sequence containing the SNP locus of the NPFFR2 gene in determining the resistance of dairy cows to metritis. The nucleotide sequence is as shown in SEQ ID NO:1, where the 300th position is the SNP locus, and a base mutation of G>A occurs at this locus. The resistance of dairy cows with the genotype GG at this locus to metritis is significantly higher than that of dairy cows with the genotypes GA and AA.

[0010] In a third aspect, the present invention provides the use of a primer pair for detecting the SNP locus of the NPFFR2 gene in determining the resistance of dairy cows to metritis. The SNP locus is rs110326785, and the nucleotide sequences of the primer pair are as follows: Forward primer: 5’-TGTGGACCCTGATGATGC-3’ (SEQ ID NO:2); Reverse primer: 5’-GAACGAAGCCATAGACAT-3’ (SEQ ID NO:3).

[0011] In a fourth aspect, the present invention provides the use of a kit containing a primer pair for detecting the SNP locus of the NPFFR2 gene in determining the resistance of dairy cows to metritis. The SNP locus is rs110326785, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO:2~3. The kit may further include DNA extraction reagents, PCR amplification reagents, etc.

[0012] In a fifth aspect, the present invention provides a method for screening dairy cows with high resistance to metritis, including the following steps: (1) Extract the genomic DNA of the dairy cow to be tested; (2) Using the genomic DNA in step (1) as a template, perform a PCR reaction with the primer pair shown in SEQ ID NO:2~3 to obtain an amplification product; (3) Sequence the amplification product. When the genotype of the SNP locus at the 300th position of the amplification product is GG, the dairy cow to be tested belongs to the dairy cow with high resistance to metritis.

[0013] Sixth aspect, the present invention provides the application of the SNP locus of the NPFFR2 gene, the nucleotide sequence containing the SNP locus of the NPFFR2 gene, the primer pair for detecting the SNP locus of the NPFFR2 gene, or the kit containing the primer pair for detecting the SNP locus of the NPFFR2 gene in the assisted breeding of dairy cows, characterized in that the SNP locus is rs110326785, and the uterine inflammation resistance of dairy cow individuals with the SNP locus genotype of GG is significantly higher than that of dairy cow individuals with the genotypes of GA and AA.

[0014] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses the genome-wide association analysis technology to screen that the NPFFR2 gene can be used as a candidate gene for uterine inflammation resistance in dairy cows, and further identifies a G>A mutation SNP locus rs110326785 located on the fifth exon of NPFFR2, which is significantly associated with the uterine inflammation resistance of Holstein cows (P value is 0.0479). This mutation is a missense mutation, resulting in the mutation of glutamic acid at the 406th position of the amino acid sequence encoded by NPFFR2 to lysine. For the trait of uterine inflammation resistance, the GG genotype of the above SNP locus is the dominant allele genotype, that is, individuals with the GG genotype have higher uterine inflammation resistance, which can be used to screen and identify dairy cows with high uterine inflammation resistance, and then select dairy cow individuals with high uterine inflammation resistance for herd optimization and assisted breeding. Description of the Drawings

[0015] Figure 1 It is the electrophoresis result of PCR products. M is the DL2000 molecular weight marker, and 1-5 are the PCR products of DNA samples of different individual Holstein cows.

[0016] Figure 2 It is the sequencing analysis peak map of PCR products of Holstein cows with different genotypes, and the position highlighted with a black background is the rs110326785 locus. Detailed Embodiments

[0017] In order to enable those skilled in the art to better understand the solution of the present application, the following will describe the present application clearly and completely in conjunction with the embodiments and the drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work shall fall within the protection scope of the present application. The instruments and reagents used in the embodiments are all from commercial channels unless otherwise specified.

[0018] Example 1 Screening and Identification of SNP Locus 1. Use the genome-wide association analysis technology to screen the NPFFR2 gene as a candidate gene for uterine inflammation resistance in Holstein cows (1)Follicle or blood samples of 2,708 Holstein cows were collected from large-scale dairy farms in Dezhou, Shandong; Linyi, Shandong; Dongying, Shandong; Tongliao, Inner Mongolia; Suqian, Jiangsu; Jinchang, Gansu; Tacheng, Xinjiang, etc. in China, and sent to Illumina for genotyping of the genomic DNA of the above cows using the Bovine 50K SNP chip to obtain the SNP locus genotype information in the 50K chip of each cow.

[0019] (2)Based on the genotype information, the genomic estimated breeding value of endometritis resistance for each cow was estimated.

[0020] (3)Using the GEMMA software and the mixed linear model, a genome-wide association analysis was performed on the genomic breeding values of endometritis resistance of the above 2,708 cows and the SNP locus genotypes obtained by genotyping, and the FDR method was used to correct the P values for multiple testing.

[0021] (4)Through genome-wide association analysis, a G>A mutation SNP locus (rs110326785) located in the fifth exon of NPFFR2 and significantly associated with endometritis resistance in Holstein cows (P value = 0.0479) was identified for the first time. This mutation is a missense mutation, resulting in the mutation of glutamate at position 406 in the amino acid sequence encoded by NPFFR2 to lysine.

[0022] 2. Determine the dominant genotype of the SNP locus in the NPFFR2 gene Using the T-test statistical method, the genomic estimated breeding values of endometritis resistance corresponding to different genotypes at the rs110326785 locus in the above Holstein cow population were analyzed. As shown in Table 1, it was found that the genomic estimated breeding value of endometritis resistance of the wild homozygous genotype GG was the highest and extremely significantly (P = 0.000043 < 0.01) higher than that of the heterozygous type GA, and significantly (P = 0.01072 < 0.05) higher than that of the homozygous mutant genotype AA. However, the difference in the endometritis resistance breeding values between the GA and AA genotypes was not significant (P = 0.66151 > 0.05).

[0023] In summary, in the Holstein cow population, for the endometritis resistance trait, the GG genotype is the dominant allele genotype, that is, individuals with the GG genotype have higher endometritis resistance.

[0024] Table 1. Genomic breeding values of endometritis resistance of individuals with different genotypes at the rs110326785 locus Example 2 Verification of the correlation between SNP locus and endometritis resistance in cows To verify the relationship between the rs110326785 locus and the resistance trait to metritis in Holstein cattle, genotyping was performed on a total of 920 Holstein cows in another Holstein cattle population, and genetic evaluation was carried out to obtain the genomic estimated breeding value for metritis resistance. Using the T-test statistical method, the genomic estimated breeding values for metritis resistance of individuals with different genotypes were compared and analyzed, and the results are shown in Table 2.

[0025] Table 2 Relationship between the genotypes at the rs110326785 locus in cattle and the genomic estimated breeding values for metritis resistance in the validation population The detection results showed that there were three genotypes in the Holstein cow population of the validation group; in all the validated populations, the genomic estimated breeding value for metritis resistance of the GG genotype was the highest, extremely significantly (P = 0.00183 < 0.01) higher than that of the GA genotype, and significantly (P = 0.01167 < 0.05) higher than that of the AA genotype for the genomic estimated breeding value of metritis resistance. However, there was no significant difference in the genomic estimated breeding values for metritis resistance between the GA and AA genotypes (P = 0.6665), which was consistent with the results in Example 1; and there were significant differences in the comparison between GG individuals and AA individuals and GA individuals in terms of the mean values of the estimated breeding values of the two populations.

[0026] Example 3 Method for detecting the genotype of SNP locus rs110326785 (1) Select the concerned Holstein cattle population, collect venous blood, and extract genomic DNA using a kit.

[0027] (2) Design PCR primers upstream and downstream of the rs110326785 SNP locus according to the sequence of the bovine NPFFR2 gene (GenBank gene accession number: NC_037333): The forward primer is NPFFR2-exon5-SNP-F: 5’-TGTGGACCCTGATGATGC-3’, The reverse primer is NPFFR2-exon5-SNP-R: 5’-GAACGAAGCCATAGACAT-3’.

[0028] (3) Perform genotype analysis by PCR amplification and sequencing The PCR amplification system was 20 μL, including 1.0 μL each of the corresponding upstream and downstream primers (10 μmol / L), 10.0 μL of 2×Taq PCR Master Mix, 1.0 μL of DNA template (50 ng), and 7.0 μL of ddH2O. The PCR reaction program was: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 57.5 °C for 30 s, extension at 72 °C for 30 s, and this step was repeated for 35 cycles; extension at 72 °C for 10 min. The length of the PCR product was 470 bp, and the agarose gel results were as Figure 1 shown.

[0029] The specific sequence was as follows: 5’-TGTGGACCCTGATGATGCTCTCAGATTATGTTGACCTGTCTGCAAATGAACTGCAGGTCATCAATATCTACATCTACCCTTTTGCACACTGGCTGGCCTTCTGCAACAGCAGCGTCAACCCCATCATTTATGGTTTCTTCAATGAAAATTTTCGTCGTGGTTTCCAAGATGCTTTTCACCTCCAGCTCTGCCAAAAAAGAGCAAAGTCCAAGGAAGTCTACACTCTGAGAGCTAAAAACACTGTGGTCATCAACACATCTCATCTGTCAGCACAGGAATCAACAGTTAAAAACCCACAC G AGGAAACTGTGCTTTGTAGGATAAGTGCTGAAAAGCCCTTACAGGAATTAATGATGGAAGAATTAGGAGAAATTACCAGTAGCAATGAGATGTAAAAAGAGCTGGTGTGATGATTTTAACTCTGCTGTGTGATATATATTGAAATATTGTTGATGTCTATGGCTTCGTTC-3’ (SEQ ID NO:1).

[0030] In the sequence, the underlined positions were the SNP (rs110326785) sites related to the resistance to bovine metritis.

[0031] The PCR product was subjected to Sanger sequencing, and the sequencing analysis results were viewed and analyzed using SeqMan software or Chromas software. As Figure 2 , it showed different genotypes of the SNP site rs110326785.

[0032] In this article, specific examples are used to elaborate on the inventive concept in detail. The descriptions of the above embodiments are only for helping to understand the core idea of the present invention. It should be noted that for those of ordinary skill in the art, any obvious modifications, equivalent substitutions or other improvements made without departing from the inventive concept shall be included within the protection scope of the present invention.

Claims

1. Use of SNP sites of the NPFFR2 gene in judging the resistance of dairy cows to metritis, characterized in that, The SNP locus is rs110326785, and a base mutation of G>A occurs at this locus; the uterine inflammation resistance of dairy cow individuals with the genotype GG at this locus is significantly higher than that of dairy cow individuals with the genotypes GA and AA.

2. Use of nucleotide sequences containing SNP sites of the NPFFR2 gene in judging the high or low resistance of dairy cows to metritis, characterized in that, The nucleotide sequence is as shown in SEQ ID NO:1, where the 300th position is the SNP locus, and a base mutation of G>A occurs at this locus; The uterine inflammation resistance of dairy cow individuals with the genotype GG is significantly higher than that of dairy cow individuals with the genotypes GA and AA.

3. Use of primer pairs for detecting SNP sites of the NPFFR2 gene in judging the resistance of dairy cows to metritis, characterized in that, The SNP locus is rs110326785, and the nucleotide sequences of the primer pair are as follows: Forward primer: 5’-TGTGGACCCTGATGATGC-3’ (SEQ ID NO:2); Reverse primer: 5’-GAACGAAGCCATAGACAT-3’ (SEQ ID NO:3).

4. Use of a kit containing primer pairs for detecting SNP sites of the NPFFR2 gene in judging the resistance of dairy cows to metritis, characterized in that, The SNP locus is rs110326785, and the nucleotide sequences of the primer pair are as follows: Forward primer: 5’-TGTGGACCCTGATGATGC-3’ (SEQ ID NO:2); Reverse primer: 5’-GAACGAAGCCATAGACAT-3’ (SEQ ID NO:3).

5. A method for screening dairy cows with high resistance to metritis, characterized in that, It includes the following steps: (1) Extract the genomic DNA of the dairy cow to be tested; (2) Using the genomic DNA in step (1) as a template, and using the primer pair shown in SEQ ID NO:2~3 to obtain an amplification product through PCR reaction; (3) Sequence the amplification product. When the SNP locus genotype at the 300th position of the amplification product is GG, the dairy cow to be tested belongs to the dairy cow with high uterine inflammation resistance.

6. Application of SNP locus of NPFFR2 gene, nucleotide sequence containing SNP locus of NPFFR2 gene, primer pair for detecting SNP locus of NPFFR2 gene, or kit containing primer pair for detecting SNP locus of NPFFR2 gene in dairy cattle assisted breeding, characterized in that, The SNP locus is rs110326785, and the uterine inflammation resistance of dairy cow individuals with the SNP locus genotype GG is significantly higher than that of dairy cow individuals with the genotypes GA and AA.

Citation Information

Patent Citations

  • Genetic markers for mastitis resistance

    CA2882192A1

  • Genetic markers for mastitis resistance

    CN104812912A

  • SNP (Single Nucleotide Polymorphism) marker related to milk production character of Holstein dairy cow in southern China and application of SNP marker

    CN115141889A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to cow mastitis resistance and application of SNP molecular marker

    CN117025797A

  • Milk cow recessive mastitis resistance molecular marker combination and detection primer, detection kit and application thereof

    CN117070621A

Cited By

  • SNP (Single Nucleotide Polymorphism) molecular marker related to concentration of butyric acid in rumen of dairy cow, detection primer pair and application of SNP molecular marker

    CN120924682A