SNP (Single Nucleotide Polymorphism) molecular marker for hypoxia tolerance character of grass carp, detection primer group, application and method

Abstract

The invention belongs to the technical field of molecular breeding of aquatic animals, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker for the hypoxia tolerance character of grass carp, a detection primer group, application and a method. The SNP molecular marker is located at the 33445030th basic group (P1) of the fifth chromosome of the grass carp genome and / or the 36269337th basic group (P2) of the tenth chromosome of the grass carp genome; and the SNP genotypes of the two sites are A / G. The molecular marker, the combination and the primer group disclosed by the invention can be used for detecting the hypoxia tolerance of the grass carp and genetic breeding of hypoxia tolerance molecules of the grass carp, and are of great significance for accelerating breeding of good varieties of the grass carp.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular breeding of aquatic animals, and particularly relates to an SNP molecular marker for the low-oxygen tolerance trait of grass carp, a detection primer set, and applications and methods thereof. Background Art

[0002] Grass carp ( Ctenopharyngodon idellus ) belongs to Cypriniformes and Cyprinidae, and is one of the "four major Chinese carps". Common aquaculture modes include pond aquaculture and cage aquaculture. In intensive aquaculture, due to the relatively high stocking density, especially during rainy days and early morning hours, the dissolved oxygen level in the water body is relatively low, and the phenomenon of "floating head" is very likely to occur. This will lead to a slow growth rate of fish, induce large-scale death events, and thus cause serious economic losses. At present, grass carp aquaculture mainly relies on aerators for oxygenation, but this significantly increases the aquaculture cost. Therefore, cultivating grass carp varieties with low-oxygen tolerance has become an urgent need for the industrial development.

[0003] Molecular marker-assisted breeding is a modern breeding method based on DNA molecular marker technology. By identifying molecular markers closely linked to target traits, it can assist in screening individuals with excellent traits, greatly improving the breeding efficiency and accuracy. Using genome-wide association analysis (GWAS), single nucleotide polymorphism sites (SNPs) related to the low-oxygen tolerance trait of grass carp are located. The development and application of these molecular markers are expected to break through the limitations of traditional breeding, strongly promote the directional cultivation of new grass carp varieties with low-oxygen tolerance, and at the same time lay a molecular foundation for elucidating the low-oxygen tolerance mechanism of grass carp.

[0004] The FLU-ARMS technology was launched by Guangzhou Good Biotechnology Co., Ltd. It is an SNP genotyping technology based on fluorescence quantitative PCR, mainly used for high-precision biallelic genotyping of known SNPs. It is suitable for detecting SNP sites in a large number of samples, and has the characteristics of economy, rapidity, and flexibility. It is expected to be used for cultivating new grass carp varieties with low-oxygen tolerance. Summary of the Invention

[0005] The purpose of the present invention is to provide an SNP molecular marker for the low-oxygen tolerance trait of grass carp, a detection primer set, and applications and methods thereof.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows: An SNP molecular marker for the low-oxygen tolerance trait of grass carp, the SNP molecular marker is located at the 33,445,030th base (P1) of chromosome 5 and / or the 36,269,337th base (P2) of chromosome 10 in the grass carp genome; the SNP genotypes of both loci are A / G.

[0007] The SNP molecular marker located at the 33,445,030th base (P1) on chromosome 5 of the grass carp genome is the base sequence shown in SEQ ID NO.1; The SNP molecular marker located at the 36,269,337th base (P2) on chromosome 10 of the grass carp genome is the base sequence shown in SEQ ID NO.2.

[0008] The genotype of the SNP molecular marker is GG at the P1 locus and / or GG at the P2 locus.

[0009] An application of the SNP molecular marker for the low-oxygen tolerance trait of grass carp, the application of the SNP molecular marker in molecular genetic breeding of grass carp for low-oxygen tolerance.

[0010] A detection primer set as described above: The primer set consists of a primer set for detecting the genotype of the P1 locus and a primer set for detecting the genotype of the P2 locus: The primer set for detecting the genotype of the P1 locus is as follows: P1-F1: GAAGGTGACCAAGTTCATGCTAGCAGCCGCTGATCTAAGCAAGGTA; P1-F2: GAAGGTCGGAGTCAACGGATTAGCAGCCGCTGATCTAAGCAAGGTG; P1-R: GAAGAACATCAACCAAAAACAGGAAACTC; The primer set for detecting the genotype of the P2 locus is as follows: P2-F1: GAAGGTGACCAAGTTCATGCTTGACCAAGAAAATCTGAACTGCGAA; P2-F2: GAAGGTCGGAGTCAACGGATTTGACCAAGAAAATCTGAACTGCGAG; P2-R: AATAACGATAAATCAGTTCATCAGGGAGG.

[0011] An application of the detection primer as described above, the application of the primer set in preparing a product for detecting the low-oxygen tolerance trait of grass carp.

[0012] An application of the detection primer as described above, the application of the primer set in detecting the low-oxygen tolerance ability of grass carp.

[0013] An application of the detection primer as described above, the application of the primer set in molecular genetic breeding of grass carp for low-oxygen tolerance.

[0014] A method for detecting the low-oxygen tolerance ability of grass carp, (1) Extract the genomic DNA of the grass carp samples to be detected; (2) Using the genomic DNA as a template, perform PCR amplification with the primer set described; (3) Collect the fluorescence signals generated in each reaction well, determine the genotypes of the SNP loci, and determine the hypoxia tolerance of the grass carp samples.

[0015] In the determination of the genotypes of the SNP loci in step (3), for the P1 and P2 loci, if only FAM fluorescence is detected, the genotype is GG; if only HEX fluorescence is detected, the genotype is AA; if both FAM and HEX fluorescence are detected, the genotype is AG.

[0016] The PCR amplification reaction system: Primer - F1: 0.02 μL; Primer - F2: 0.02 μL; Primer - R: 0.06 μL; Flu - Arms 2×PCR mix: 1.0 μL; DNA template (5 ng - 50 ng): 0.9 μL.

[0017] PCR amplification program: 95°C, 1 min, 1 cycle; 95°C, 5 s, decreasing from 63.4°C to 57°C, decreasing 0.8°C per cycle, 15 s, 9 cycles; 95°C, 5 s, 57.5°C, 15 s, 35 cycles; 16°C, 20 s, 2 cycles.

[0018] Advantages of the present invention: The molecular markers, combinations and primer sets proposed by the present invention can be used for the detection of the hypoxia tolerance of grass carp, as well as the molecular genetic breeding of grass carp resistant to hypoxia, which is of great significance for accelerating the breeding of excellent grass carp varieties. Description of the Drawings

[0019] Figure 1 It is the genotype ratio of the P1 locus of 150 hypoxia - tolerant grass carp and 150 hypoxia - intolerant grass carp provided by the embodiment of the present invention. "*" represents that there is a significant difference in the genotypes of hypoxia - tolerant and hypoxia - intolerant individuals ( P <0.05, chi - square test).

[0020] Figure 2 It is the genotype ratio of the P2 locus of 150 hypoxia - tolerant grass carp and 150 hypoxia - intolerant grass carp provided by the embodiment of the present invention. "***" represents that there is an extremely significant difference in the genotypes of hypoxia - tolerant and hypoxia - intolerant individuals ( P <0.001, chi - square test).

[0021] Figure 3Proportion of 9 genotype combinations at P1 and P2 loci of 150 hypoxia-tolerant grass carps and 150 hypoxia-intolerant grass carps provided in the embodiments of the present invention. "***" represents that there is a highly significant difference in genotypes between hypoxia-tolerant and hypoxia-intolerant individuals ( P <0.001, chi-square test). Specific embodiments

[0022] The present invention will be further described below in conjunction with embodiments.

[0023] The present invention uses the FLU-ARMS technology, combined with the identified molecular markers for hypoxia tolerance in grass carp, to accurately screen breeding parents carrying hypoxia-tolerant markers at the early stage of breeding, thereby significantly shortening the breeding cycle and accelerating the cultivation process of new hypoxia-tolerant grass carp varieties.

[0024] It should be noted that all raw materials used in the embodiments are commercially available unless otherwise specified. Among them, the primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.; the lu-Arms 2×PCR mix was purchased from Guangzhou Good Biotechnology Co., Ltd.; the genome resequencing was completed by Shanghai Majorbio Bio-Pharm Technology Co., Ltd.

[0025] Example 1

[0026] Identification of molecular markers for hypoxia tolerance traits in grass carp, including the following steps: (1) Hypoxia stress experiment on grass carp 2000 grass carps were purchased from Nansi Lake Fisheries Co., Ltd. in Weishan County, with an average weight of 23.50 g and an average total length of 12.58 cm. During the hypoxia stress experiment, the water temperature was controlled at 21 ± 1°C, and the dissolved oxygen in the water was reduced by adding sodium sulfite powder. Observe the behavior of the fish losing balance, record the time when each fish loses balance, and take fin tissue samples. The first 150 fish that lost balance were regarded as hypoxia-intolerant fish, and the last 150 fish that lost balance or survived were regarded as hypoxia-tolerant fish.

[0027] (2) Genome-wide association study (GWAS) Extract the fin DNA of hypoxia-intolerant fish and hypoxia-tolerant fish, with a total of 300 samples, including 150 hypoxia-intolerant grass carp samples and 150 hypoxia-tolerant grass carp samples. For genome resequencing using the Illumina platform. The sequencing volume for each sample is 8 Gb. Use Fastp (v 0.23.4) to filter the original sequencing sequences and align the filtered sequences with the grass carp reference genome. Use GATK (v 3.8) to identify each sample, and filter high-quality SNPs with a minor allele frequency (MAF) > 5% and missing data < 20% as the filtering threshold. Use the generalized linear model (GLM) for genome-wide association analysis and process the phenotypic data into binary variables. Use the Bonferroni correction method to correct the multiple tests for the selected candidate marker loci to control the false positive rate.

[0028] (3) Mining of molecular marker loci for hypoxia tolerance in grass carp Arrange the SNP loci obtained from the genome-wide association analysis according to the p value size, and screen the SNP loci significantly associated with the hypoxia tolerance trait in grass carp. The results show that the 33,445,030th base (P1) on chromosome 5 and the 36,269,337th base (P2) on chromosome 10 in the grass carp genome are significantly associated with the hypoxia tolerance trait. The p values of the P1 locus and the P2 locus are 1.12E-07 and 1.27E-07, respectively. The P1 locus, the P2 locus and the upstream and downstream sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, and [A / G] is the SNP locus of the molecular marker. SEQ ID NO.1 is the 33,444,832-33,445,230th base on chromosome 5. SEQ ID NO.1 is the 36,269,137-36,269,537th base on chromosome 10.

[0029] The sequence shown in SEQ ID NO.1 is as follows: TATATAAAAAAAAGATAGTGGCGAGATACAGCAACTCCCCCCAACTGTTGACTGGCTCTAATAGCGCCATTGTTTCTCTCACCCAAAAAGCCCCAGCAAGGCAGAGTTCATAAAAGCAAAATATCAAATGCTGGCTTACGTCCATCGTTTACCATGTCGAGATGACGACAGTACAGCAGCCGCTGATCTAAGCAAGGT[A / G]AGGAAAGAGTTTCCTGTTTTTGGTTGATGTTCTTCTCGATATTCAAATATGTGATGCATCCATCATGATACATTTTTTCAGGTTTGACTTGCTTTATTGTTGAATAATAAATTTAAACAGTTCCTCTAGCACATCTAAGGCTTTTTGTCTGCTATCAGGCTTGTTGAAATGTCTCTATTGATGCACTTTGTCTTTGATTC。

[0030] The sequence shown in SEQ ID NO.2 is as follows: AGAATATAATTTAAAACATATTTTTGAAAATAATTCAGATGTGTACACTCACATGTATTCAGTGTGTAAGAGCCATTAATTTGAAACAGGTTTCGAAACCAACATGAACACAAAGAGTACATTTCTAAGAAATTCTAAGAATTTTTTGTTTTATCAAGGAAACTCTTAAATGTCATTGACCAAGAAAATCTGAACTGCGA[A / G]TGAAAGCCTCCCTGATGAACTGATTTATCGTTATTTGTTGTTGTAGAGCACACATCCAACTATGCCGATAATGGGGTTGTAATTTATGTGTGTAAGTGCATGTACGAACTGTACGAAAGTGTAAACAGCCAACCAAAACAAAACTCCCAGATCAACTTCTCTCATAAACAGTTGCCTTTAACTGCATCATTGCTCTTCTT。

[0031] The results of GWAS analysis show that when the genotypes of grass carp at locus P1 and locus P2 are GG, its hypoxia tolerance ability is stronger; when the genotypes at locus P1 and locus P2 are other types, its hypoxia tolerance ability is weaker.

[0032] Example 2

[0033] Design of primers for detecting molecular marker loci of hypoxia tolerance trait in grass carp, comprising the following steps: Design a specific Flu-Arms primer set according to the upstream and downstream sequences of the 33,445,030th base (P1) on chromosome 5 and the 36,269,337th base (P2) on chromosome 10 of the grass carp genome.

[0034] The sequences of the primer combinations for detecting the genotype of the P1 locus are shown as follows: P1-F1: GAAGGTGACCAAGTTCATGCTAGCAGCCGCTGATCTAAGCAAGGTA (SEQ ID NO.3); P1-F2: GAAGGTCGGAGTCAACGGATTAGCAGCCGCTGATCTAAGCAAGGTG (SEQ ID NO.4); P1-R: GAAGAACATCAACCAAAAACAGGAAACTC (SEQ ID NO.5).

[0035] The sequences of the primer combinations for detecting the genotype of the P2 locus are shown as follows: P2-F1: GAAGGTGACCAAGTTCATGCTTGACCAAGAAAATCTGAACTGCGAA (SEQ ID NO.6); P2-F2: GAAGGTCGGAGTCAACGGATTTGACCAAGAAAATCTGAACTGCGAG (SEQ ID NO.7); P2-R: AATAACGATAAATCAGTTCATCAGGGAGG (SEQ ID NO.8).

[0036] Example 3

[0037] Use the primer set of the molecular marker designed in Example 2 above to detect the genotype of the molecular marker, comprising the following steps: (1) Extraction of grass carp genomic DNA Cut grass carp fin tissue and extract genomic DNA by the phenol-chloroform method.

[0038] (2) Establishment of genotyping PCR amplification system The PCR amplification system (2 μL) is shown in Table 1.

[0039] Table 1. PCR Amplification System for Genotype Detection of Low Dissolved Oxygen Tolerance Molecular Markers in Grass Carp

[0040] (3)Genotyping Fluorescent Quantitative PCR Amplification Program Genotyping was performed using a QS1 real-time fluorescent quantitative PCR instrument (Thermo Fisher, USA). The amplification conditions are shown in the following table.

[0041] Table 2. Genotyping Fluorescent Quantitative Amplification Program

[0042] (4)Plate Reading Detection After the amplification program is completed, the real-time fluorescent quantitative PCR instrument can directly scan the amplification products on the PCR plate to analyze the genotype. For the P1 and P2 loci, if only FAM fluorescence is detected, the genotype is GG; if only HEX fluorescence is detected, the genotype is AA; if both FAM and HEX fluorescence are detected, the genotype is AG.

[0043] Example 4

[0044] Verification of the identified low dissolved oxygen tolerance trait molecular markers in grass carp includes the following steps: 1000 grass carps were subjected to low dissolved oxygen stress, and the resistance of each grass carp to low dissolved oxygen was tested using the method in Example 1. 150 low dissolved oxygen sensitive individuals and 150 low dissolved oxygen tolerant individuals were obtained. Using the primer set in Example 2 and the molecular marker genotype detection method in Example 3, genotype detection of the P1 locus and P2 locus was performed on 150 low dissolved oxygen sensitive individuals (numbered 1 - 150) and 150 low dissolved oxygen tolerant individuals (numbered 151 - 300) (Table 3). Among the low dissolved oxygen sensitive individuals and low dissolved oxygen tolerant individuals, the genotype ratios of the P1 locus are as Figure 1 shown, the genotype ratios of the P2 locus are as Figure 2 shown, and the genotype combination distribution ratios of the P1 and P2 loci are as Figure 3 shown.

[0045] Genotype analysis showed that in the hypoxia-tolerant population, the proportion of the GG genotype at the P1 locus was significantly higher than that in the hypoxia-intolerant population. The proportion of individuals with the AG genotype was significantly higher in the hypoxia-intolerant population than in the hypoxia-tolerant population. At the P2 locus, the proportion of the GG genotype in the hypoxia-tolerant population was significantly higher than that in the hypoxia-intolerant population. In terms of the genotype combinations at the P1 and P2 loci, the proportion of the combination of the GG genotype at the P1 locus and the GG genotype at the P2 locus (GG-GG) in the hypoxia-tolerant population was extremely significantly higher than that in the hypoxia-intolerant population; the proportion of the AG-AA genotype combination was extremely significantly higher in the hypoxia-intolerant population than in the hypoxia-tolerant population. It is proved that the P1 and P2 loci and their combinations can be used as molecular markers for detecting the hypoxia tolerance ability of grass carp, and have significant application potential in genetic marker-assisted breeding.

[0046] Table 3. Genotype detection results of the P1 locus and P2 locus of 300 grass carps

[0047] Note: "-" represents weak hypoxia tolerance ability, and "+" represents strong hypoxia tolerance ability.

Claims

1. A SNP molecular marker for the low oxygen tolerance trait of grass carp, characterized in that: The SNP molecular marker is located at the 33,445,030th base (P1) on chromosome 5 and / or the 36,269,337th base (P2) on chromosome 10 of the grass carp genome; the SNP genotypes at both loci are A / G.

2. The SNP molecular marker for the hypoxia tolerance trait of grass carp according to claim 1, characterized in that: The SNP molecular marker located at the 33,445,030th base (P1) on chromosome 5 of the grass carp genome is the base sequence shown in SEQ ID NO.1; The SNP molecular marker located at the 36,269,337th base (P2) on chromosome 10 of the grass carp genome is the base sequence shown in SEQ ID NO.

2.

3. The SNP molecular marker for the hypoxia tolerance trait of grass carp according to claim 1 or 2, characterized in that: The genotype of the SNP molecular marker is GG at the P1 locus and / or GG at the P2 locus.

4. Use of the SNP molecular marker for the low oxygen tolerance trait of grass carp according to claim 1, characterized in that: The application of the SNP molecular marker in the molecular genetic breeding of grass carp for hypoxia tolerance.

5. A primer set for detecting the SNP molecular marker of the hypoxia tolerance trait of grass carp as claimed in claim 1, characterized in that: The primer set consists of a primer set for detecting the genotype of the P1 locus and a primer set for detecting the genotype of the P2 locus and is composed of: The primer set for detecting the genotype of the P1 locus is as follows: P1-F1: GAAGGTGACCAAGTTCATGCTAGCAGCCGCTGATCTAAGCAAGGTA; P1-F2: GAAGGTCGGAGTCAACGGATTAGCAGCCGCTGATCTAAGCAAGGTG; P1-R: GAAGAACATCAACCAAAAACAGGAAACTC; The primer set for detecting the genotype of the P2 locus is as follows: P2-F1: GAAGGTGACCAAGTTCATGCTTGACCAAGAAAATCTGAACTGCGAA; P2-F2: GAAGGTCGGAGTCAACGGATTTGACCAAGAAAATCTGAACTGCGAG; P2-R: AATAACGATAAATCAGTTCATCAGGGAGG.

6. Use of the primer set according to claim 5, characterized in that: The application of the primer set in the preparation of a product for detecting the hypoxia tolerance trait of grass carp.

7. Use of the primer set according to claim 5, characterized in that: The application of the primer set in the detection of the hypoxia tolerance ability of grass carp.

8. Use of the primer set according to claim 5, characterized in that: The application of the primer set in the molecular genetic breeding of grass carp for hypoxia tolerance.

9. A method for detecting the hypoxia tolerance ability of grass carp, characterized in that (1) Extract the genomic DNA of the grass carp sample to be detected; (2) Using the genomic DNA as a template, perform PCR amplification with the primer set as claimed in claim 5; (3) Collect the fluorescence signals generated in each reaction well, judge the genotype of the SNP locus, and determine the hypoxia tolerance ability of the grass carp sample.

10. The method for detecting the hypoxia tolerance ability of grass carp according to claim 9, wherein, In step (3), when judging the genotypes of the P1 and P2 loci of the SNP locus, if only FAM fluorescence is detected, the genotype is GG; if only HEX fluorescence is detected, the genotype is AA; if both FAM and HEX fluorescence are detected, the genotype is AG.

Images