Reagent and kit for detecting feline mycoplasma nucleic acid and application of reagent and kit

By designing reagents and kits for specific primers and probes, and using fluorescence quantitative PCR to detect Mycoplasma cats, the problem of missed detection of Mycoplasma cats in the prior art has been solved, and high specificity and accuracy detection effect has been achieved.

CN120230868APending Publication Date: 2025-07-01GUANGDONG RUNPENG BIOLOGICAL TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311841317.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-28
Publication Date
2025-07-01

AI Technical Summary

Technical Problem

In the prior art, there is a problem of missed detection of Mycoplasma cats, which leads to untimely detection and treatment of cat infection.

Method used

A reagent and kit for detecting Mycoplasma cats was designed, and fluorescence quantitative PCR detection was performed using specific primers and probes to ensure high specific detection of Mycoplasma cats.

Benefits of technology

Through this technology, the detection of Mycoplasma cat can be accurately detected, which improves the specificity and accuracy of the detection, reduces the missed detection, and thus promptly detects and treats cat infections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention provides a reagent and a kit for detecting feline mycoplasma nucleic acid and application of the reagent and the kit. The reagent comprises a reagent for detecting a first region and / or a second region of mycoplasma, the first region is selected from any fragment in SEQ ID NO: 1, and the second region is selected from any fragment in SEQ ID NO: 2. By applying the reagent or the kit provided by the invention, the mycoplasma cat can be accurately identified.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the field of detection of Mycoplasma felis, and more particularly, to a reagent, a kit for detecting Mycoplasma felis nucleic acid, and their applications. Background Art

[0002] Mycoplasma belongs to a kind of tiny prokaryote without cell wall, which can pass through a bacterial filter and is an independent living microorganism between virus and bacteria, with negative Gram staining. A few mycoplasmas can live freely in still water, but most exist in the digestive tract, respiratory tract and urogenital tract of humans and animals, and can cause diseases. Mycoplasma felis (M. felis) mainly infects the eyes and upper respiratory tract of cats, can be transmitted between cats, and causes severe conjunctival edema and mild rhinitis in affected cats. Mycoplasma is one of the main pathogenic bacteria causing feline conjunctivitis, usually manifested as increased eye discharge, conjunctival congestion and swelling, including redness and swelling around the anus. Cats with conjunctivitis are particularly sensitive to internal and external stimuli, and are prone to inflammatory reactions if stimulated greatly. If not treated in time, it is very likely to cause Mycoplasma felis eye disease, with extreme hyperemia and edema of the feline conjunctiva, thus triggering conjunctivitis. The main symptoms of upper respiratory tract infection are increased nasal discharge and sneezing, but Mycoplasma is not the main pathogen of upper respiratory tract diseases and is considered a secondary factor. Lower respiratory tract infection is mainly manifested as coughing, shortness of breath, dyspnea, etc. Veterinarians generally diagnose based on clinical symptoms, and a few veterinarians can diagnose through inclusion bodies of Chlamydia, but these diagnoses also have uncertainties. In the initial stage of Mycoplasma infection, cats may also be dehydrated, leading to infectious anemia. It may also manifest as chronic symptoms such as weight loss and intermittent fever. If not treated in time, it is very likely to cause the death of cats.

[0003] Feline upper respiratory tract disease (URTD) is a common clinical disease in cats, characterized by inflammation of the respiratory mucosa and a high incidence rate. There are five common pathogens of URTD, including feline herpesvirus type 1, feline calicivirus, Mycoplasma felis, Chlamydia felis, and Bordetella bronchiseptica. Mycoplasma is a prokaryotic microorganism between bacteria and viruses. It absorbs nutrients by attaching to receptors on the surface of host cells and releases toxic substances, thereby damaging cells and tissues. Infection with Mycoplasma felis (M. felis) can cause feline infectious respiratory disease, but the incidence rate is relatively lower compared to other viruses. The main symptoms are coughing, sneezing, conjunctivitis, difficulty breathing, and purulent mucus secretion from the nose, etc. The clinical manifestations are conjunctivitis, a large amount of ocular and nasal secretions, sneezing, shortness of breath, etc. It may develop into suppurative pneumonia in the later stage. There is no special preventive method for Mycoplasma felis infection. Therefore, once a cat gets sick, it needs to be treated in a timely manner. According to statistics, Mycoplasma can also be isolated from the throats of 35% of healthy cats. So Mycoplasma may also be a conditional pathogen, secondary to inflammation caused by other etiologies. Summary of the Invention

[0004] This application aims to provide a reagent, method, and application for detecting Mycoplasma felis to solve the technical problem of missed detection of Mycoplasma felis in the prior art.

[0005] To achieve the above object, according to one aspect of the present application, a reagent for detecting Mycoplasma felis is provided. The reagent includes: a reagent for detecting the first region and / or the second region of Mycoplasma felis, wherein the first region is selected from any fragment of SEQ ID NO: 1, and the second region is selected from any fragment of SEQ ID NO: 2.

[0006] Furthermore, the first region is selected from any fragment between the (1 - 2)th to (112 - 117)th bases of SEQ ID NO: 1; and / or the second region is selected from any fragment between the (1 - 9)th to (122 - 124)th bases of SEQ ID NO: 2.

[0007] Furthermore, the reagent includes a primer pair for detecting the nucleic acid sequence of SEQ ID NO: 1. The primer pair includes an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 20 - 27 consecutive nucleotides between the (1 - 2)th to (112 - 117)th bases of SEQ ID NO: 1; and / or

[0008] The reagent includes a primer pair for detecting the nucleic acid sequence of SEQ ID NO: 2. The primer pair includes an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair has 20 to 29 consecutive nucleotides that are complementary or identical to the nucleotides between positions (1-9)-(122-124) in SEQ ID NO: 2.

[0009] Furthermore, the reagent primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 3 and 5, and / or the nucleotide sequences shown in SEQ ID NOs: 8 and 10;

[0010] Preferably, the reagent further includes a probe, and the probe is selected from the nucleotide sequences shown in SEQ ID NO: 7; and / or the nucleotide sequence shown in SEQ ID NO: 12;

[0011] Among them, SEQ ID NO: 3 is 5'-AGCTCAAATGGATGGTGCTATCTTA-3',

[0012] SEQ ID NO: 5 is 5'-AAGAARACAACGATACGAGGAACA-3', where R = A or G,

[0013] SEQ ID NO: 7 is 5'-TGCTGCAACAGATGGACCAAYGCC-3', where Y = T or C,

[0014] SEQ ID NO: 8 is 5'-AATTCGAAGCTGCAATTTATGTTCTTA-3',

[0015] SEQ ID NO: 10 is 5'-CTCCACCAGTAACGTCTGTTGTTCTA-3',

[0016] SEQ ID NO: 12 is 5'-AAGAAGGTGGGCGTCACACACCATTC-3'.

[0017] Furthermore, the 5' end and 3' end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group;

[0018] Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse;

[0019] More preferably, the 5'-end of the probe is ROX and / or Cy5 group, and the 3'-end is BHQ group.

[0020] According to another aspect of the present application, there is provided a kit, which includes any of the above reagents for detecting Mycoplasma felis nucleic acid in a sample to be tested.

[0021] Furthermore, the kit further includes at least one of the following: qPCR premix, including qPCR buffer and AK Taq DNA polymerase. Preferably, the concentration of AK Taq DNA polymerase is 5 U / μL.

[0022] According to still another aspect of the present application, there is provided a method for fluorescence quantitative PCR detection of Mycoplasma felis, which uses any of the above reagents or kits for detecting Mycoplasma felis nucleic acid in a sample to be tested for fluorescence quantitative PCR detection.

[0023] Furthermore, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92-98 °C for 30 s-90 s; denaturation treatment at 92-98 °C for 2-8 s, annealing at 58-62 °C for 27-33 s and collecting fluorescence signal for processing, and a total of 35-45 cycles are carried out.

[0024] According to still another aspect of the present application, there is provided an application of a reagent or kit for detecting Mycoplasma felis nucleic acid in a sample to be tested in the detection of Mycoplasma felis.

[0025] Applying the technical solution of the present application, the reagent for detecting Mycoplasma felis nucleic acid of the present application has high specificity for Mycoplasma felis. Therefore, compared with the existing detection reagents, it has a significant advantage of high specificity in the identification of Mycoplasma felis. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings required to be used in the embodiments. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can also be obtained based on these drawings without creative efforts.

[0027] Figure 1 Original curves of 4 primer-probe combinations for target 1;

[0028] Figure 2 Original curves of 4 primer-probe combinations for target 2;

[0029] Figure 3 Amplification curves for negative verification of target 1;

[0030] Figure 4 Amplification curves for negative verification of target 2;

[0031] Figure 5 Amplification curves for specific samples at Target 1 and Target 2

[0032] Figure 6 Amplification curves for the verification of clinical samples with dual targets

[0033] Figure 7 Amplification curves for the self-developed kit and the competitor's product Detailed implementation manners

[0034] It should be noted that, without conflict, the embodiments in this application and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the drawings and in conjunction with the embodiments.

[0035] Currently, the main methods for diagnosing Mycoplasma felis include virus isolation method, immunochromatography method, and molecular genetics diagnosis method. Among them, the virus isolation method is time-consuming and has cumbersome steps, making it impossible to achieve rapid and efficient detection; the immunochromatography method utilizes the principle of specific binding of antigen and antibody, which is easy to perform, but its specificity is low and it is prone to false positives; while molecular biology detection such as fluorescence quantitative PCR method has been gradually applied to pathogen detection. This method is achieved through the specific amplification of the genetic material nucleic acid of the pathogen. Due to its high sensitivity and specificity, it has become the mainstream and new standard for laboratory diagnosis.

[0036] Therefore, the inventors designed primers and probes based on the 16s rRNA of Mycoplasma felis registered in Genbank as the target gene, which can detect Mycoplasma felis with high specificity and has no cross-reaction with other common feline respiratory pathogens.

[0037] According to a typical embodiment of the present invention, a reagent for detecting Mycoplasma felis is provided. The reagent includes: a reagent for detecting the first region and / or the second region of Mycoplasma felis, wherein the first region is selected from any fragment in SEQ ID NO: 1, and the second region is selected from any fragment in SEQ ID NO: 2.

[0038] By applying the technical solution of the present invention, Mycoplasma felis can be accurately detected.

[0039] Due to the uniqueness of the above-mentioned first region and second region, thus, by selecting any fragment with any length from one or both of these regions for detection, high-specificity detection of feline herpesvirus type 1 can be achieved. To further improve the specificity of detection, in some preferred embodiments, the first region is selected from any fragment between the (1 - 2)-(112 - 117)th bases in SEQ ID NO: 1; and / or the second region is selected from any fragment between the (1 - 9)-(122 - 124)th bases in SEQ ID NO: 2.

[0040] For any fragment of any length in the above two regions, appropriate primers or primer-probe combinations can be designed for detection. In some preferred embodiments, the reagent comprises a primer pair, the primer pair includes an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 20 to 27 consecutive nucleotides between positions (1-2) to (112-117) in SEQ ID NO: 1; and / or the reagent comprises a primer pair for detecting the nucleic acid sequence of SEQ ID NO: 2, the primer pair includes an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 20 to 29 consecutive nucleotides between positions (1-9) to (122-124) in SEQ ID NO: 2.

[0041] In some more preferred embodiments, the primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 3, 5, and / or the nucleotide sequences shown in SEQ ID NOs: 8, 10.

[0042] In some more preferred embodiments, the above reagent further comprises a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 7; and / or the nucleotide sequence shown in SEQ ID NO: 12. Specifically, the above primers and probes form two primer-probe combinations.

[0043] The first group:

[0044] Forward primer: 5’-AGCTCAAATGGATGGTGCTATCTTA-3’ (SEQ ID NO: 3);

[0045] Reverse primer: 5’-AAGAARACAACGATACGAGGAACA-3’, R = A or G (SEQ ID NO: 5);

[0046] Probe: 5’-TGCTGCAACAGATGGACCAAYGCC-3’, Y = T or C (SEQ ID NO: 7).

[0047] The second group:

[0048] Forward primer: 5’-AATTCGAAGCTGCAATTTATGTTCTTA-3’ (SEQ ID NO: 8);

[0049] Reverse primer: 5’-CTCCACCAGTAACGTCTGTTGTTCTA-3’ (SEQ ID NO: 10);

[0050] Probe: 5’-AAGAAGGTGGGCGTCACACACCATTC-3’ (SEQ ID NO: 12).

[0051] The two primer-probe combinations of the present application have high specificity and high detection accuracy in the detection of Mycoplasma felis.

[0052] In the above primer-probe combination, the 5' end and 3' end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group. The presence of the fluorescent reporter group and the fluorescent quenching group facilitates accurate and rapid detection by fluorescence quantitative PCR. Therefore, any group capable of emitting fluorescence and absorbing fluorescence of the corresponding wavelength is applicable to the present application.

[0053] In some preferred embodiments, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7.; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse. When the above fluorescent reporter group and fluorescent quenching group are specifically used, they are reasonably selected and matched according to the wavelength of the emitted fluorescence and the wavelength capable of absorbing fluorescence.

[0054] Considering the cost, effect, wide range of applications and convenience, in some more preferred embodiments, the 5' end of the above probe is selected from ROX and / or Cy5 groups, and the 3' end is selected from BHQ groups (specifically, it can be BHQ1, BHQ2 or BHQ3).

[0055] In the second typical embodiment of the present application, a kit is provided, and the kit includes any of the above reagents. Using this kit for the detection of Mycoplasma felis has the advantages of high specificity and high detection accuracy.

[0056] In order to further improve the convenience of the detection of the kit, in some preferred embodiments, the above kit further includes at least one of the following: qPCR premix, and the qPCR premix includes a qPCR buffer and AK Taq DNA polymerase. Preferably, the concentration of AK Taq DNA polymerase is 5 U / μL. A specific qPCR buffer can be selected from existing known products for application. Details are not described herein. It should be noted that the DNA polymerase used in this qPCR premix is AK Taq DNA polymerase produced by PhyNexus, and the use of other DNA polymerases with similar effects is not excluded herein.

[0057] The positive control in the kit is usually a gene fragment containing the object to be detected. In a preferred embodiment of the present application, the above positive control is a gene fragment containing the 117bp and 124bp of Mycoplasma felis, and this gene fragment is shown as SEQ ID NO: 1 and SEQ ID NO: 2,

[0058] SEQ ID NO: 1:

[0059] AGCTCAAATGGATGGTGCTATCTTAGTTGTTGCTGCAACAGATGGACCAAYGCCTCAAACA CGTGAACACATTCTTTTATCTAGACAAGTTGGTGTTCCTCGTATCGTTGTYTTCTT, Y=T / C;

[0060] SEQ ID NO: 2:

[0061] TCACACAGAATTCGAAGCTGCAATTTATGTTCTTAAAAAAGAAGAAGGTGGGCGTCACAC ACCATTCTTTAAAAACTATAAACCACAATTCTACTTTAGAACAACAGACGTTACTGGTGGAGTT.

[0062] The negative control in the kit is a plasmid without the target gene fragment and is a control that will not amplify the target fragment. Preferably, the negative control is deionized water.

[0063] In the third typical embodiment, a method for fluorescence quantitative PCR detection of Mycoplasma felis is provided, and this method includes performing fluorescence quantitative PCR detection using the above primer-probe composition or the above kit.

[0064] Preferably, the above-mentioned composition of one or two pairs of primers and probes is used to perform fluorescence quantitative PCR detection on the 117bp and 124bp target gene fragments to be detected respectively.

[0065] In some preferred embodiments, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92-98°C (preferably 95-98°C) for 30s-90s (preferably 30s-60s); denaturation treatment at 95-98°C for 2-8s (preferably 2-5s), annealing or collecting fluorescence signal treatment at 58-62°C (preferably 59-61°C) for 27-33s, and a total of 35-45 cycles are performed.

[0066] In some more preferred embodiments, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 95°C for 1 min; denaturation treatment at 95°C for 5s, annealing or collecting fluorescence signal treatment at 60°C for 30s, and a total of 40 cycles are performed.

[0067] In the fourth typical embodiment, the application of the above-mentioned reagent or the above-mentioned kit in the detection of Mycoplasma felis is provided. By applying a primer or a primer-probe combination (one or two groups) capable of differentiating Mycoplasma felis, the present application can amplify a target fragment in the sample of the nasal, oral and ocular secretions of diseased cats, and accurately identify Mycoplasma felis.

[0068] The beneficial effects of the present application will be further explained in detail below in conjunction with specific examples. It should be noted that the primers in the following examples were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Unless otherwise specified, the relevant reagents are all commercially available products.

[0069] Example 1 Primer and Probe Design

[0070] Based on the 16S rRNA of Mycoplasma felis as the target gene, the conserved region found by the alignment result was used to design primers and probes. During the primer design process, Primer Express 3.0.1 software was used for the design and evaluation of primers and probes. The evaluation criteria mainly included: length, Tm value, GC content, hairpin structure, internal dimer of primers, dimer between primers and formation of mismatches. After the primer and probe design was completed, a BLAST analysis was performed online on the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to avoid non-specific binding and amplification with other pathogenic bacteria. The primer and probe information is shown in Table 1.

[0071] Among them, SEQ ID NO: 3-7 are the primer and probe sequences for target 1, and SEQ ID NO: 8-12 are the primer and probe sequences for target 2.

[0072] Table 1 Primer and Probe Sequence Information for Real-Time Fluorescent Quantitative PCR Detection of Mycoplasma felis

[0073] Serial number Name Sequence 3 MF-F3 AGCTCAAATGGATGGTGCTATCTTA 4 MF-F5 GCTCAAATGGATGGTGCTATCTTAG 5 MF-R3 AAGAARACAACGATACGAGGAACA, R = A / G 6 MF-R5 RACAACGATACGAGGAACACCA, R = A / G 7 MF-P3 TGCTGCAACAGATGGACCAAYGCC, Y = T / C 8 MF-F8 AATTCGAAGCTGCAATTTATGTTCTTA 9 MF-F9 TCACACAGAATTCGAAGCTGCA 10 MF-R11 CTCCACCAGTAACGTCTGTTGTTCTA 11 MF-R12 AACTCCACCAGTAACGTCTGTTGTT 12 MF-P6 AAGAAGGTGGGCGTCACACACCATTC

[0074] Example 2 Screening of the Optimal Primer Combination

[0075] In order to further verify the advantages and disadvantages of different combinations of primers designed based on the conserved regions found by the whole-genome alignment, using the synthetic plasmid of Mycoplasma felis as the template, the optimal primer and probe combinations for target 1 and target 2 were screened respectively. Among them, target 1 and target 2 each have 4 combinations.

[0076] The nucleic acid extraction was carried out using the nucleic acid extraction reagent self-produced by Feipeng, and the qPCR amplification system was prepared according to Table 2. The amplification system was 25 μL, and the 2×Mix and Taq enzyme in the configuration table were self-produced raw materials developed by Feipeng Biotech. The qPCR amplification was carried out using the program in Table 3, and the instrument was the SLAN-96P instrument.

[0077] Table 2 Mycoplasma felis qPCR Amplification System

[0078] Component Volume / μL Concentration Article number 2×Mix (lyophilizable) 12.5 2× RK1110 AK-Taq (5U / μL) 0.1 25U / μL MD099 F (50μM) 0.125 50μM / R (50μM) 0.125 50μM / P (50μM) 0.0625 50μM / DEPC water 7.0875 / B501005-0005 Template 5 / /

[0079] Table 3 Real time PCR Amplification Program

[0080]

[0081] The results showed that the Ct values of the 4 combinations in Target 1 were basically the same. However, from the fluorescence intensity, the F3R3P3 combination was the best, and the F3R5P3 combination was the second best; there were certain differences in the Ct values of the 4 combinations in Target 2, and the Ct value of the F8R11P6 combination was the best. At the same time, from the fluorescence intensity, the F8R11P6 combination was the best, and the F9R11P6 combination was the second best. In summary, the best combination in Target 1 was F3R3P3, and the best combination in Target 2 was F8R11P6( Figure 1 、 Figure 2 、Table 4).

[0082] Table 4 Ct Values of Amplification for Screening the Optimal Primer Combinations

[0083]

[0084] Example 3 Verification of Negative and Specificity of Primers and Probes

[0085] The optimal primer and probe combinations for the two targets of Mycoplasma felis were verified: DEPC water was used as the template for negative verification, and at least 20 replicates were set to verify whether there was amplification. If there was no amplification, it preliminarily indicated good specificity.

[0086] At the same time, clinical samples containing multiple identified pathogens such as feline herpesvirus type I, feline calicivirus, Mycoplasma felis, Chlamydia felis, and Bordetella bronchiseptica were used as templates for specificity verification to detect whether only Mycoplasma felis could be amplified. If only Mycoplasma felis had amplification, it indicated that the primer and probe had good specificity and there was no non-specific amplification (Target 1 and 2 were amplified in two systems respectively).

[0087] The results were as Figure 3 、 Figure 4 shown. Using DEPC water as the template, there was no amplification in the negative samples. As Figure 5As shown in the figure, taking a variety of determined samples as templates, only Mycoplasma felis was detected, indicating that the two primer-probe combinations designed for the double targets in the conserved region have good specificity.

[0088] Example 4 Double-target Amplification Experiment

[0089] To further verify the specificity of the double targets of Mycoplasma felis, clinical samples were used as templates, and the clinical samples of Mycoplasma felis were diluted 5-fold with DEPC water in 5 gradients. The qPCR amplification system was prepared according to Table 2, and qPCR amplification was carried out according to the procedure in Table 3, using the SLAN-96P instrument. The results are as follows:

[0090] As Figure 6 shown, the Ct values of the two targets are different. The Ct value of target 1 (ROX) is about 1 Ct lower than that of target 2 (CY5). At the same time, the fluorescence value of target 1 (ROX) is higher than that of target 2 (CY5), and both can amplify good amplification curves. This indicates that when target 1 and target 2 simultaneously detect clinical samples of Mycoplasma felis, they will not interfere with each other's amplification. Therefore, the primer-probe of target 1 and the primer-probe of target 2 can be mixed and used as double-target amplification reagents for Mycoplasma felis in the product.

[0091] Example 5 Performance Comparison between Self-developed Kit and Competitor's Product

[0092] To evaluate the difference in the amplification performance between the self-developed Mycoplasma felis detection reagent and that of peers, the nucleic acids of the same clinical samples of Mycoplasma felis were extracted as templates. The self-developed double-target amplification reagent for Mycoplasma felis was used as the experimental group, and the Mycoplasma felis detection kit (DN4080) of Daan Biotechnology Co., Ltd. (Daan Gene Holdings) was used as the competitor control group, and the performance of the Mycoplasma felis amplification reagents was detected and compared respectively.

[0093] The results are as Figure 7 shown. The Ct value of target 1 of the self-developed double-target amplification reagent for Mycoplasma felis is 26.58, and the Ct value of target 2 is 27.87; while the Ct value of the competitor's Mycoplasma felis amplification is 30.32, which is about 4 Ct behind target 1 and about 2.5 Ct behind target 2. The above shows that the performance of the self-developed double-target amplification detection kit for Mycoplasma felis is better than that of the competitor.

[0094] In summary, the above embodiments of the present application have achieved the following technical effects: Using the primer-probe composition of the present application, the specificity is high, so Mycoplasma felis can be efficiently and accurately identified. The target fragment is amplified in clinical samples, and the results are accurate.

[0095] The above are only the preferred embodiments of the present application and are not intended to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included within the protection scope of the present application.

Claims

1. A reagent for detecting Mycoplasma felis nucleic acid, characterized in that, The reagent includes: a reagent for detecting the first region and / or the second region of Mycoplasma felis, wherein the first region is selected from any fragment of SEQ ID NO: 1, and the second region is selected from any fragment of SEQ ID NO:

2.

2. The reagent according to claim 1, wherein The first region is selected from any fragment between the bases at positions (1-2) to (112-117) of SEQ ID NO: 1; and / or The second region is selected from any fragment between the bases of SEQ ID NO:

2.

3. The reagent according to claim 2, wherein The reagent includes a primer pair, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 20-27 consecutive nucleotides between the bases at positions (1-2) to (112-117) of SEQ ID NO: 1; and / or The reagent includes a primer pair, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 20-29 consecutive nucleotides between the bases at positions (1-9) to (122-124) of SEQ ID NO:

2.

4. The reagent according to claim 3, characterized in that, The primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 3, 5, and / or the nucleotide sequences shown in SEQ ID NOs: 8, 10; Preferably, the reagent further includes a probe, and the probe is selected from the nucleotide sequences shown in SEQ ID NO: 7; and / or the nucleotide sequence shown in SEQ ID NO: 12; Wherein, SEQ ID NO: 3 is 5'-AGCTCAAATGGATGGTGCTATCTTA-3', SEQ ID NO: 5 is 5'-AAGAARACAACGATACGAGGAACA-3', R = A or G, SEQ ID NO: 7 is 5'-TGCTGCAACAGATGGACCAAYGCC-3', Y = T or C, SEQ ID NO: 8 is 5'-AATTCGAAGCTGCAATTTATGTTCTTA-3', SEQ ID NO: 10 is 5'-CTCCACCAGTAACGTCTGTTGTTCTA-3', SEQ ID NO: 12 is 5'-AAGAAGGTGGGCGTCACACACCATTC-3'.

5. The reagent according to claim 4, characterized in that, The 5' end and the 3' end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group; Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse; More preferably, the 5' end of the probe is ROX and / or Cy5 group, and the 3' end is BHQ group.

6. A kit, characterized in that, The kit includes the reagent for detecting the nucleic acid of Mycoplasma felis in a test sample according to any one of claims 1 to 5.

7. The kit according to claim 6, characterized in that, The kit further includes at least one of the following: a qPCR premix, the qPCR premix includes a qPCR buffer and AK Taq DNA polymerase, preferably, the concentration of the AK Taq DNA polymerase is 5 U / μL.

8. A method for fluorescence quantitative PCR detection of Mycoplasma felis, characterized in that, The fluorescence quantitative PCR detection is performed using the reagent for detecting Mycoplasma felis nucleic acid in a test sample according to any one of claims 1 to 5 or the kit according to claim 6 or 7.

9. The method according to claim 8, wherein The conditions for the fluorescence quantitative PCR detection are: pre-denaturation at 92-98 °C for 30 s-90 s; denaturation treatment at 92-98 °C for 2-8 s, annealing at 58-62 °C for 27-33 s and collecting fluorescence signal processing, and a total of 35-45 cycles are carried out.

10. Use of the reagent for detecting Mycoplasma felis nucleic acid in a test sample according to any one of claims 1 to 5 or the kit according to claim 6 or 7 in the detection of Mycoplasma felis.