Primer probe combination for identifying group A streptococcus M1UK strain and application thereof
Through the method based on real-time fluorescence PCR, a specific primer probe combination was designed to solve the problem that it is difficult to quickly identify the M1UK strain of Group A streptococci in the prior art, and efficient, fast and low-cost M1UK strain detection was achieved, improving the efficiency of disease treatment.
Patent Information
- Application Number
- CN202510450726.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-11
- Publication Date
- 2025-07-01
AI Technical Summary
The prior art is difficult to quickly and effectively identify the M1UK strain of Group A Streptococcus, and the genome sequencing method has problems such as high technical threshold, cumbersome process, long detection cycle and expensive reagents.
Using a method based on real-time fluorescence PCR, a primer probe combination that specifically amplifies the target gene of the M1UK strain was designed, and the rapid identification of the M1UK strain was achieved through real-time fluorescence quantitative PCR technology.
The specific distinction between M1UK strain and other GAS strains is achieved, with simple and fast operation, high detection efficiency and low cost, and high throughput detection, reducing labor and time costs, and improving disease treatment efficiency.
Smart Images

Figure CN120230872A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of detection of mutant strains of Streptococcus, and particularly relates to a method for identifying group A Streptococcus M1 UK Primer-probe combinations for strains and their applications. Background Art
[0002] Group A Streptococcus (GAS), also known as Streptococcus pyogenes, is the most important and common species in the genus Streptococcus. GAS colonizes the throat and is a major infectious pathogen in humans. GAS can cause superficial infections, deep infections, toxin-mediated diseases, and post-infectious immune diseases, the most common of which are pharyngeal tonsillitis, scarlet fever, and impetigo. GAS can be divided into invasive infections (iGAS) and non-invasive infections based on the site of infection. iGAS infections are caused by GAS invading a sterile area, such as streptococcal toxin shock syndrome (STSS), a highly lethal infectious disease caused by streptococcal infection, with GAS being the most common.
[0003] GAS can mutate under the interaction of the host, the environment and the pathogen itself to produce new clones (evolutionary branches) with enhanced drug resistance and virulence, such as M1 UK strains. M1 UK The strain was first detected in the UK in 2010. It currently accounts for more than 91% of the invasive M1 strains in the UK and the M1 strains detected in other countries around the world. UK The strains are also homologous to the British strain. UK Compared with other strains of the M1 lineage, the strains have 27 specific base mutations (SNPs), which increase the expression of scarlet fever toxin and streptococcal exotoxin SpeA, thus gaining stronger pathogenicity. UK The expression efficiency of strain SpeA increased by more than 10 times compared with other M1 lineage strains. UK The expression of other superantigen exotoxins of the strain did not show attenuation or decrease compared with other strains. UK Strains and wild strains of GAS are crucial for disease prevention and treatment. UK The commonly used method for strain identification is genome sequencing, which has high accuracy and good specificity, but has disadvantages such as high technical threshold, cumbersome process, long detection cycle and expensive reagents, which is not conducive to the rapid identification of variant strains. Therefore, a fast, effective and non-sequencing-dependent M1 UK Strain identification and detection methods are of great significance for the prevention and control of group A streptococcal diseases.
[0004] Real-time fluorescent quantitative PCR is a technique that adds fluorescent groups to the PCR reaction system and uses the accumulation of fluorescent signals to monitor the entire PCR process in real time. This technology not only achieves qualitative and quantitative analysis of the template, but also has the characteristics of high sensitivity, good specificity, real-time and accuracy. Real-time fluorescent quantitative PCR is used to identify M1 UK The strain has obvious advantages.
[0005] Based on this, the present invention establishes a real-time fluorescence PCR method for identifying group A Streptococcus M1 UK strain method, which can effectively distinguish wild strains of group A streptococci from M1 UK The method not only has the characteristics of strong specificity, high sensitivity, high detection efficiency and stability, but is also simple and rapid to operate, does not require special instruments and operations, is low-cost, and can achieve high throughput, effectively reducing manpower and time costs, and improving detection efficiency. It shows good application prospects in laboratory diagnosis, on-site detection, and health assessment of variant strains. Summary of the Invention
[0006] One object of the present invention is to provide a method for specifically amplifying M1 UK The second object of the present invention is to provide a primer-probe combination for preparing a primer-probe combination for identifying M1 UK The third object of the present invention is to provide a method for identifying M1 UK Another object of the present invention is to provide a kit for identifying M1 UK strain method.
[0007] The purpose of the present invention is achieved through the following technical solutions:
[0008] In a first aspect, the present invention provides a primer-probe combination, characterized in that the primer-probe combination is a group consisting of an upstream primer, a downstream primer, a probe 1 and a probe 2. Specifically,
[0009] Upstream primer: AAAACAGCATATGCCATCGTGG;
[0010] Downstream primer: TCGCACAGAAAATCGTCTCAA;
[0011] Probe 1: TCTTGTTCTAACCAC;
[0012] Probe 2: TCTTGTTCTGACCAC.
[0013] Preferably, the 5' ends of the probes 1 and 2 are labeled with fluorescent reporter groups, and the fluorescent reporter group signals of the probes do not interfere with each other, and the 3' ends of the probes are labeled with fluorescent quenching groups.
[0014] In some embodiments of the present invention, the fluorescent reporter group is selected from one of FAM, VIC, HEX, ROX, and Cy5, and the fluorescent quencher group is selected from one of BHQ1, BHQ2, and MGB.
[0015] In a specific embodiment of the present invention, the fluorescent reporter groups labeled at the 5' ends of the probes 1 and 2 are FAM and VIC, respectively, and the fluorescent quencher group is MGB.
[0016] In a second aspect, the present invention provides a primer-probe combination according to the first aspect for preparing a method for identifying M1 UK Application of strains in products.
[0017] The products include but are not limited to test strips, membrane strips, test kits, and chip detection platforms.
[0018] In a third aspect, the present invention provides a kit, characterized in that the kit comprises the primer-probe combination described in the first aspect of the present invention.
[0019] Furthermore, the kit also includes PCR buffer, DNA polymerase, Mg 2+ , dNTPs, and deionized water.
[0020] Preferably, the kit further comprises a negative quality control product and a positive quality control product.
[0021] In a fourth aspect, the present invention provides a method for identifying M1 without the purpose of disease diagnosis. UK The method for producing a strain is characterized in that the method comprises the following steps:
[0022] (1) Extracting DNA or RNA from the strain to be tested;
[0023] (2) preparing a PCR amplification system containing the primer-probe combination described in the first aspect of the present invention, and performing a PCR amplification reaction;
[0024] (3) Determine whether M1 exists in the sample to be tested based on the amplification curve UK strains.
[0025] M1 UK The strain is a GAS variant strain, M1 UK Compared with other strains of the M1 lineage, the strains of the M1 lineage have increased the expression of scarlet fever toxin and streptococcal exotoxin SpeA, and have stronger pathogenicity. UKThe expression efficiency of strain SpeA increased by more than 10 times compared with other M1 lineage strains. UK The expression of other superantigen exotoxins of the strain did not show attenuation or decrease compared with other strains. UK strains are still dominant and the secondary infection frequency is high. Therefore, it is necessary to UK The strains are monitored, which is of great significance for the prevention and control of streptococcal diseases. UK The primer-probe combination of the strain can specifically amplify M1 UK strain target gene, which can effectively distinguish M1 UK strains compared with other GAS strains, including other M1 lineage strains.
[0026] The present invention provides a method for identifying M1 based on real-time fluorescence PCR. UK In addition to the advantages of strong specificity and accurate detection results, the strain method is simple and quick to operate, does not require large instruments such as gene sequencing, has high detection efficiency, reduces labor costs and time costs, and can achieve fast, effective and non-sequencing-dependent detection of variant strains, which is of great significance to disease prevention and control and improving disease treatment efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 Amplification curve of the primer-probe combination shown in Figure 1.
[0028] Figure 2 Amplification curve of the primer-probe combination 2.
[0029] Figure 3 Amplification curve of the primer-probe combination shown in 3.
[0030] Figure 4 Amplification curve of the primer-probe combination shown in 4.
[0031] Figure 5 Amplification curve of the primer-probe combination shown in 4'.
[0032] Figure 6 Amplification curve of the primer-probe combination shown in 4'.
[0033] Figure 7 Amplification curve of the primer-probe combination shown in Figure 5.
[0034] Figure 8 Amplification curve of the primer-probe combination shown in 6.
[0035] Figure 9 Amplification curve of the primer-probe combination shown in 7.
[0036] Figure 10Amplification curve of the primer-probe combination shown in Figure 8. DETAILED DESCRIPTION
[0037] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts are within the scope of protection of the present invention.
[0038] Example 1 is designed to identify M1 UK Primer probes for strains
[0039] The present invention screens M1 UK Four specific genes of the strain were used as target genes, and 3-5 pairs of primer-probe combinations were designed as candidates for each target gene. All candidate primers were subjected to blast analysis in Genbank, and primers with low specificity were eliminated. The two primer pairs with the best specificity for each target gene were selected as experimental verification primers. The specific primer and probe nucleotide information is shown in Table 1.
[0040] Table 1 for M1 UK Experimental verification primers of strain target genes
[0041]
[0042]
[0043] In the above table, "F" represents the upstream primer; "R" represents the downstream primer; and "P" represents the probe.
[0044] The present invention screens M1UK strain-specific genes as target genes to design primers and probes, and determines the optimal primer-probe combination based on the BLAST sequence specificity test results, single reactivity specificity verification and multiple cross-specificity verification results of the primer and probe sequences.
[0045] Example 2 for identifying M1 UK strain method
[0046] 1 Primer synthesis
[0047] The primer and probe combinations used for experimental verification were synthesized according to the oligonucleotide sequence information shown in Table 1.
[0048] 2 DNA extraction of strains to be tested
[0049] 2.1 Strain culture
[0050] Follow the routine procedures for bacterial isolation and culture.
[0051] 2.2 Extraction of bacterial genomic DNA
[0052] Take 1 ml of bacterial culture medium and extract genomic DNA according to the instructions of the bacterial genomic DNA extraction kit.
[0053] 3 Establishment of real-time fluorescence quantitative PCR system
[0054] 3.1 Prepare the PCR reaction solution as shown in the table below and dispense into a 96-well plate;
[0055] Table 2 PCR reaction system
[0056]
[0057] 3.2 Take the DNA sample and add it to the above 96-well plate, adding 2 μL to each well;
[0058] 3.3 Seal the PCR plate, place it in the thermal amplification instrument, and perform PCR amplification according to the conditions shown in the table below;
[0059] Table 3 PCR amplification conditions
[0060]
[0061]
[0062] 4. Result determination
[0063] If there is no S-shaped amplification curve, the sample is judged to be specific for M1 UK The strain tested negative;
[0064] If the amplification curve is clearly S-shaped, the sample is judged to be specific for M1 UK The test result of the strain was positive sample.
[0065] Example 3 Specificity test
[0066] Take M1 respectively UK Strains, other types of group A Streptococcus (Emm1, Emm1.3, Emm1.149, Emm12, Emm12.1, Emm12.2, Emm12.4, Emm12.7, Emm12.37, Emm12.66, Emm12.87, Emm12.95, Emm76, Emm89, Emm156) were used as strains to be tested and cultured according to the method provided in Example 2. The strain DNA was extracted and the reaction solution for PCR amplification shown in Table 2 was prepared. The primer and probe combination was as shown in combination 1 in Table 1. A DNA template was added and the amplification reaction was performed according to the PCR amplification program provided in Table 3. The amplification curve was shown in FIG. Figure 1 As shown in the figure, it can be seen that in the UKIn the strain to be tested system, the amplification curve showed an obvious S-type, and for other types of group A streptococci, some obvious S-type amplification curves also appeared. UK The detection specificity of the strain is poor. Using the same method, the amplification curve of combination 2 in Table 1 is as follows Figure 2 As shown in the figure, multiple amplification curves can be seen, indicating that the primer-probe combination is effective for M1 UK The detection specificity of the strain is also poor.
[0067] The present invention screened two sets of primer-probe combinations for target gene 2, which were combination 3 and combination 4 in Table 1, and configured detection systems containing combination 3 and combination 4, respectively. The amplification results were as follows: Figure 3 and 4 As shown, Figure 3 Multiple non-specific amplifications occurred, so the combination of 3 primer probes was eliminated. Figure 4 The amplification curves shown show that the primer-probe combination provided by combination 4 can achieve the M1 UK The specific amplification of the strain was found, but a careful comparison revealed that other types of group A streptococci also showed a small amount of amplification, and the primer probe needed to be improved. Therefore, based on combination 4, the present invention technicians improved the primer probe to obtain the primer probe shown in combination 4', in which probe 1 was used to label M1 UK The target gene of the strain is amplified, and probe 2 is used to mark the amplification of other types of genes of group A streptococci. Specifically, the combination 4' is targeted at M1 UK The amplification curve of the strain sample is as follows Figure 6 As shown, for M1 UK The amplification curve of the mixed sample of the strain and other types of group A streptococci is as follows Figure 5 As shown in the FAM (red) amplification curve, it can be seen that the combined 4' primer probe can achieve M1 UK Strain-specific amplification, for non-M1 UK For other types of group A streptococci of the strain, an amplification curve appears on another channel VIC (pink).
[0068] Continue to prepare PCR reaction solutions containing the primer and probe combinations shown in combination 5 to combination 8 in Table 1. The strain to be detected is M1 UK The amplification curve of the strain and other types of group A streptococci after amplification reaction is as follows Figure 7-10 As shown in the amplification curve, it can be seen that the primer and probe combinations shown in combinations 5-8 cannot specifically amplify M1 UK strains.
[0069] Based on the above results, the present invention preferably combines the primer probe shown in 4' as a method for detecting M1 UKOptimal primer-probe combination for the strain.
[0070] Example 4 Repeatability test
[0071] Take M1 UK strains, extract the strain DNA, prepare a PCR amplification reaction solution containing the primer-probe combination shown in combination 1, perform the amplification reaction according to the PCR amplification program provided in Table 3, repeat the experiment three times, and observe the amplification curves obtained in the three experiments. The amplification curves obtained by the three parallel repeats are basically consistent, and the coefficient of variation CV of the Ct value is less than 5%, indicating that the real-time fluorescence quantitative PCR established by the present invention can identify M1 UK The method of strain identification has good repeatability and stability.
[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A primer-probe combination, characterized in that: The primer-probe combination is a group consisting of an upstream primer, a downstream primer, a probe 1 and a probe 2; Upstream primer: AAAACAGCATATGCCATCGTGG; Downstream primer: TCGCACAGAAAATCGTCTCAA; Probe 1: TCTTGTTCTAACCAC; Probe 2: TCTTGTTCTGACCAC.
2. The primer-probe combination according to claim 1, characterized in that: The 5' ends of the probe 1 and the probe 2 are labeled with a fluorescent reporter group, and the fluorescent reporter group signals of the probes do not interfere with each other. The 3' ends of the probes are labeled with a fluorescent quencher group.
3. The primer-probe combination according to claim 2, characterized in that: The fluorescent reporter group is selected from one of FAM, VIC, HEX, ROX, and Cy5, and the fluorescent quencher group is selected from one of BHQ1, BHQ2, and MGB.
4. The primer-probe combination according to claim 3, characterized in that: The fluorescent reporter groups labeled at the 5' ends of the probe 1 and the probe 2 are FAM and VIC respectively, and the fluorescent quenching group is MGB.
5. The primer-probe combination according to any one of claims 1 to 4 is used in the preparation of a method for identifying M1 UK Application of strains in products.
6. The use according to claim 5, characterized in that: The products include test strips, membrane strips, test kits, chips or detection platforms.
7. A kit, characterized in that The kit comprises the primer-probe combination according to any one of claims 1 to 4.
8. The kit according to claim 7, characterized in that The kit also includes PCR buffer, DNA polymerase, Mg 2+ , dNTPs, and deionized water.
9. The kit according to claim 7, characterized in that The kit also includes negative quality control products and positive quality control products.
10. Identification not for the purpose of disease diagnosis M1 UK The method of the strain is characterized in that The method comprises the following steps: (1) Extracting DNA or RNA of the strain to be tested; (2) preparing a PCR amplification system containing the primer-probe combination according to any one of claims 1 to 4, and performing a PCR amplification reaction; (3) Determine whether M1 exists in the sample to be tested based on the amplification curve UK strains.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker, primer probe, kit and method for identifying brucella vaccine strain A19 and application
CN115786541A
Cited By
Simple and efficient screening method of group A streptococcus qPCR primer
CN120823886A