Molecular marker closely linked with PVY resistance of sun-cured tobacco variety Pan county willow leaves and application of molecular marker
By developing co-dominant Bi-PASA markers, using the dual base deletion characteristics of the cDNA coding region of the eIF4E1 gene, the problem that existing markers cannot distinguish the resistance and sensory genotypes of tobacco varieties is solved, and the accurate selection of tobacco PVY resistance genotypes is achieved, and breeding efficiency is improved.
Patent Information
- Application Number
- CN202510648090.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-07-01
AI Technical Summary
The existing molecular markers cannot effectively distinguish the genotypes of the tobacco variety Panxian Big Willow Leaf Middle Resistant, Sensitive Parents and the hybrid offspring of the parent, resulting in a slow breeding process.
A co-dominant Bi-PASA marker was developed, using the double base deletion characteristics of sites 267-268 of the cDNA coding region of the eIF4E1 gene, and designed primers for PCR amplification to accurately identify wild-type and mutant alleles.
Through this marker, germplasm materials or transgenic offspring containing the mutation type of Panxian large willow leaf can be accurately selected to improve selection efficiency and accelerate the breeding process.
Smart Images

Figure CN120230880A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the development of a natural mutant of a gene and its related mutation-site specific molecular markers, and particularly to the development and application of a novel allele of eukaryotic translation initiation factor eIF4E1 in tobacco and its mutation-site specific molecular markers. The gene mutant can provide a source of variation for breeding tobacco varieties resistant to PVY virus containing the mutation site, and the site-specific molecular marker can be directly applied to marker-assisted breeding to select tobacco materials containing the mutation site, improving the selection efficiency of the mutant eIF4E1 allele, belonging to the field of agricultural biotechnology. Background Art
[0002] Tobacco potato virus Y disease is a systemic infectious disease caused by Potato virus Y (PVY) infecting tobacco. Breeding and planting disease-resistant varieties is the most economical and effective method for controlling this disease (Tang Junkun et al., 2011). Research shows that the PVY resistance source materials of tobacco are divided into two categories: one is the resistance source materials such as VAM (TI 1406) and its derived germplasm TN86 generated by X-ray mutagenesis, and their PVY resistance is controlled by the recessive gene locus va (Koelle G., 1961; Miller R.D., 1987); the other is the resistance source materials derived from the resistance of Nicotiana africana, and their PVY resistance is controlled by a dominant gene (Lewis R.S., 2005). At present, the resistance source materials controlled by the va locus are widely used in tobacco disease-resistant breeding. To improve the breeding utilization efficiency of the va locus, domestic and foreign scholars have successively developed molecular markers such as RAPD and SCAR linked to the va locus (Noguchi S., 1999; Julio E., 2006; Wang Gui et al., 2012). However, the genetic distance between these molecular markers and the va locus is relatively far and the linkage strength is small, so their application value in breeding is limited.
[0003] In order to better utilize the PVY resistance controlled by the va locus, scholars at home and abroad have conducted in-depth research on the specific situation of the effector gene and chromosomal fragment deletion of the va locus. Noguchis et al. (Noguchi S., 1999) found that the resistance of va-genotype tobacco plants is caused by the deletion of the gene fragment susceptible to PVY in the tobacco plants. Julio et al. (Julio E., 2015) compared the transcriptomes of tobacco near-isogenic lines resistant and susceptible to PVY using next-generation sequencing technology and identified the tobacco eIF4E1 gene as a recessive disease-resistant gene for PVY in tobacco, that is, a gene susceptible to PVY. Dluge et al. (Dluge KL., 2018) compared the transcriptome differences between tobacco varieties resistant and susceptible to PVY and found that in the tobacco lines TI 1406 and K326-va with PVY resistance, a large-scale deletion occurred in the chromosomal region where the eIF4E1 gene is located. Since the sequence information of the deletion breakpoint and the connecting fragment of the eIF4E1 gene could not be obtained, a co-dominant marker linked to the eIF4E1 gene could not be developed. The reported excellent allelic mutants of the tobacco eIF4E1 gene mainly include eIF4E1.Kai (Lin SF., 2021), eIF4E1.Ban (Lin Shifeng, 2022), and eIF4E1.Fu (Lin SF., 2021). Among them, eIF4E1.Kai is a single-base insertion mutant, eIF4E1.Ban is a single-base substitution mutant, and eIF4E1.Fu is a partial sequence deletion mutant. However, the molecular markers developed through the above gene mutations cannot effectively distinguish the genotypes of the resistant and susceptible parents, the F1, F2, and backcross progeny of the parental cross in Panxian Daliuye. It is necessary to conduct research and improvement on this. Summary of the Invention
[0004] To overcome the deficiencies of existing molecular markers, the present invention proposes a molecular marker for identifying PVY resistance in tobacco for a novel natural mutant of the eIF4E1 gene obtained through identification. According to the differences between eIF4E1 alleles, primers are designed, and a co-dominant Bi-PASA marker for identifying wild-type and mutant alleles is developed and used for marker-assisted selection; using the molecular marker of the recessive disease-resistant gene for PVY in tobacco of the present invention for assisted selection breeding plays a promoting role in accelerating the breeding process.
[0005] The technical solution of the present invention is: a molecular marker closely linked to the PVY resistance of the sun-cured tobacco variety Panxian Daliuye, the molecular marker is located at the 267-268th sites of the cDNA coding region of the eIF4E1 gene, with a two-base deletion, resulting in a frameshift mutation and generating a premature termination codon in the second exon.
[0006] Preferably, the marker related to the detection of the wild-type locus is named ASM-W, with a fragment size of 547 bp, as shown in SEQ ID No. 1; the marker related to the detection of the mutant locus is named ASM-m, with a fragment size of 355 bp, as shown in SEQ ID No. 2.
[0007] SEQ ID No.1:
[0008] tgtctgccttagatgcatgttgtgttgctcggatgggggcgcgggtatcccataatggtgcagatctaaaggtcggatttgtcatcacataaattttaggattcgaggatatgaattcaactacggttacgggtgctgggatacaaccaataaatgtatgttactacatatataagtatatatttcgattaattaaagttatcaaactaaatctaataattttttcttataaaatataaacacgtaatccggtgtggattccacacccatgtcgtgttgatacgggtgcggcaaagattttgaagagtccgcgcaacttaggatgcatgcaccttgtttggtgagttctttatcagtctaatttctcaaggcacttgagttattgtgcaacttggactatgtcatgcctattttgatattctgcatcttggattagatgttttcaaatgctattatcctgttagcttttgatgaaatccttgaaccatgttgcttaaattctgcaaacAGTGTTTACAATAATATCAACCACCCAAGCAAGTTAGTT
[0009] SEQ ID No.2:
[0010] tctgcaaacAGTGTTTACAATAATATACCACCCAAGCAAGTTAGTTGTGGGAGCAGACTTTCATTGTTTTAAGCATAAAATTGAGCCAAAGTGGGAAGATCCTGTATGTGCGAATGGAGGGAATTGGACAATGAGCTTTAGTAAGGGTAAATCTGATACCAGCTGGCTATACACGgtatgctgaggatattttaatccagttcttaatgttagggcgcagtctcgtaaagttattttcccctttgatattatttcaactcttattttctcatttgggattattgtagCTGCTGGCAATGATTGGACATCAATTCGATCATGGAGAGGAAATTTGTGGAGCAGTAGTTAGCGTCCG
[0011] The present invention also provides primers for identifying the molecular markers closely linked to the PVY resistance of the sun-cured tobacco variety Panxian Daliuye, and the primer sequences are as follows:
[0012] Inner primer A: 5'-TCTGCAAACAGTGTTTACAATAATAgAC-3';
[0013] Inner primer B: 5'-AACTAACTTGCTTGGGTGGcTG-3';
[0014] Outer primer P: 5'-TGTCTGCCTTAGATGCATGTTG-3';
[0015] Outer primer Q: 5'-CGGACGCTAACTACTGCTCCAC-3';
[0016] As shown in SEQ ID NO.3, 4, 5, 6;
[0017] The combination of inner primer B and outer primer P is used to amplify the molecular marker ASM-W;
[0018] The combination of inner primer A and outer primer Q is used to amplify the molecular marker ASM-m.
[0019] The present invention also provides the application of the above-mentioned primers for identifying the molecular markers closely linked to the PVY resistance of the sun-cured tobacco variety Panxian Daliuye in breeding.
[0020] Advantages of the present invention: Through biological inoculation experiments and PCR amplification and sequencing analysis, it is found that there is a two-base deletion (without a large-scale deletion of flanking sequences) at the 267-268th sites in the cDNA coding region of the eIF4E1 gene of the PVY-resistant sun-cured tobacco variety Panxian Daliuye, resulting in a frameshift mutation and the generation of a premature termination codon in the second exon. Using this mutation site, a site-specific co-dominant Bi-PASA marker is developed, including outer primers P and Q, and inner primers A and B. Inner primer B is a wild-type eIF4E1 allele-specific reverse primer, and when combined with the forward outer primer P, the amplified gene fragment length is 547 bp, as shown in SEQ ID No. 1; inner primer A is a mutant eIF4E1 allele-specific forward primer, and when combined with the reverse outer primer Q, the amplified gene fragment length is 355 bp, as shown in SEQ ID No. 2. Using this marker, the genotypes of the backcross progeny of the sun-cured tobacco variety Panxian Daliuye as a PVY resistance donor parent can be accurately selected. The markers and primers of the present invention can be used as molecular markers in the identification of tobacco germplasm resources and breeding assistant selection. Selecting germplasm materials or progeny with the mutant type of Panxian Daliuye can improve the selection efficiency and accelerate the breeding process. Brief Description of the Drawings
[0021] Figure 1 : Leaf symptoms of tobacco hybrid combinations (F1) and their parents after inoculation with PVY at the seedling stage.
[0022] Figure 2 : Molecular marker detection of the 3'-end and 5'-end sequences of the eIF4E1 gene in Panxian Daliuye. A. Detection results of the 5'-end dominant molecular marker; B. Detection results of the 3'-end dominant molecular marker. M. DL 2000 DNA Marker; 1. TN90; 2. Honghuadajinyuan; 3. Panxian Daliuye.
[0023] Figure 3 : PCR amplification (agarose gel electrophoresis) of the eIF4E1 gene in Panxian Daliuye. M1: DL2000 DNA Marker; 1: Amplification product using cDNA as a template; M2: DL 10000 DNA Marker; 2: Amplification product using genomic DNA as a template.
[0024] Figure 4 : cDNA and genomic DNA sequence alignment of the eIF4E1 gene of Panxian Daliuye and Honghuadajinyuan.
[0025] Figure 5 : Design of two-way allele-specific PCR primers.
[0026] Figure 6: Amplification of genomic DNA of resistant and susceptible materials by Bi-PASA genetic marker primers. M, DL2000 marker; 1, Panxian Dayeliu; 2, Honghuadajinyuan × Panxian Dayeliu; 3, K326 × Panxian Dayeliu; 4, Guiyan 5 × Panxian Dayeliu; 5, Honghuadajinyuan; 6, K326; 7, Guiyan 5; A. Amplification result of P / B primer; B. Amplification result of A / Q primer; C. Amplification result of P / B / A / Q primer.
[0027] Figure 7 : Amplification of Bi-PASA genetic marker in F2 population and parents. P1, Honghuadajinyuan; P2, Panxian Dayeliu; 1 - 22, individual plants of F2 generation; R, resistant individual plants; S, susceptible individual plants.
[0028] Figure 8 : Detection results of Bi-PASA genetic marker for some individual plants in backcross offspring. P1, Honghuadajinyuan; P2, Panxian Dayeliu; 1 - 22, individual plants of backcross offspring.
[0029] Figure 9 : Schematic diagram comparing conventional improvement breeding (A) for transferring single recessive gene, dominant molecular marker-assisted selection breeding (A), and co-occurrence molecular marker-assisted selection breeding (B). Detailed implementation manners
[0030] To make the above objects, features, and advantages of the present invention more obvious and understandable, the following will describe the detailed implementation manners of the present invention with reference to the accompanying drawings. Many specific details are set forth in the following description to fully understand the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the connotation of the present invention. Therefore, the present invention is not limited by the specific implementations disclosed below.
[0031] 1. Allelic detection of PVY resistance gene in Panxian Dayeliu tobacco
[0032] In the early stage of the present invention, through the collection and disease resistance identification of hundreds of tobacco germplasm resources at home and abroad, it was found that the sun-cured tobacco variety Panxian Dayeliu showed high resistance (HR) in the PVY inoculation identification at the seedling stage.
[0033] It is known that the resistance of the burley tobacco variety TN90 to PVY is controlled by a recessive gene locus (va), specifically caused by the deletion of the tobacco PVY-susceptible gene eIF4E1 (Sierro et al., 2014; Dluge et al., 2018). To detect the allelic relationship between Panxian Dayeliu and TN90 in terms of PVY resistance, resistant-resistant and resistant-susceptible hybrid combinations were prepared using Panxian Dayeliu, TN90, and the susceptible flue-cured tobacco variety Honghuadajinyuan, and identified by the artificial rubbing inoculation method. The results showed that the F1 generations of the resistant-resistant combinations prepared with Panxian Dayeliu and TN90 were all resistant, while the F1 generations of the resistant-susceptible combinations prepared with Panxian Dayeliu and Honghuadajinyuan were all susceptible ( Figure 1 ). The above results indicate that there is allelism between the PVY-resistant genes of Panxian Dayeliu and TN90, that is, it is inferred that the PVY resistance of Panxian Dayeliu is also caused by the deletion of the susceptible gene eIF4E1.
[0034] In recent years, there have been increasing reports on the mutation of the tobacco eIF4E1 gene. It has been found that the eIF4E1 gene of tobacco PVY-resistant materials can undergo several different forms of mutations, including the most common complete gene sequence deletion mutation, single-base insertion, single-base substitution, and large fragment deletion mutations, etc. In this study, PCR amplification experiments were first carried out on the genomic DNA of Panxian Dayeliu using the reported primer combinations of dominant molecular markers at the 5' end and 3' end of the eIF4E1 gene (Table 1). The results showed that the eIF4E1 gene in Panxian Dayeliu did not undergo the common complete gene sequence deletion mutation ( Figure 2 ).
[0035] Table 1 Information of PCR amplification primers for allelic detection of the eIF4E1 gene in Panxian Dayeliu
[0036]
[0037] 2. Identification of a new allele of eIF4E1 in Panxian Dayeliu
[0038] To finally determine whether the eIF4E1 gene in Panxian Dayeliu has mutated, in this study, the full-length DNA and cDNA sequences of the eIF4E1 gene were amplified using the tobacco eIF4E1 gene full-sequence amplification primers eIF4E1_F and eIF4E1_R with Panxian Dayeliu as the material ( Figure 3 ). Then, the DNA and cDNA sequences obtained by sequencing were compared with the data of Honghuadajinyuan (a PVY-susceptible material containing the wild-type eIF4E1 gene) in the Chinese Tobacco Genome Database, and it was found that the eIF4E1 gene of Panxian Dayeliu had a 2-base deletion at the 267-268th sites in the cDNA coding region of the eIF4E1 gene, resulting in a frameshift mutation and the generation of a premature termination codon in the second exon ( Figure 4)。To distinguish the eIF4E1 gene mutation types found in Panxian big willow leaves from the previously reported mutation types, the novel eIF4E1 allele found in Panxian big willow leaves was named eIF4E1.Pan.
[0039] eIF4E1_F: CAAGTACCCTTTTCCTACTAAAATCTATAACTAAG;
[0040] eIF4E1_R: GGCATTAATTCAAAACCAAACGAG;
[0041] As shown in SEQ ID NO.7, 8.
[0042] 3. Establishment and application of co-dominant molecular markers for eIF4E1 mutant alleles in Panxian big willow leaves
[0043] 3.1 Extraction of tobacco genomic DNA
[0044] An F1, F2, and BC population was constructed by crossing the PVY-resistant tobacco variety Bunkun Village sun-cured tobacco with the susceptible tobacco variety K326. The genomic DNA of tobacco samples was extracted using the AxyPrep Genomic DNA Miniprep Kit (Axygen). To minimize and simplify the DNA extraction steps, the dried samples were pretreated with a Geno / Grinder 2010 SPEX high-throughput animal and plant tissue grinder before the conventional extraction steps of the Axygen kit. This method uses the mechanical impact generated by grinding beads under high-speed oscillation to break the cell walls and cell membranes of the samples, releasing the cell contents, including genomic components, for downstream extraction and purification. Specifically: Cut about 100 mg of tobacco leaves and place them in a 2 ml centrifuge tube. Dry them in a 55 °C drying oven for 24 h. After grinding them into a fine powder using the grinder, add 520 μl of freshly prepared lysis buffer (350 μl PBS, 0.9 μl RNase A, 150 μl Buffer C-L, 20 μl Proteinase K) to lyse the cells, and perform the remaining steps according to the instructions.
[0045] 3.2 Establishment of co-dominant Bi-PASA molecular markers
[0046] Two-way allele-specific primers were designed for the base deletion site of the eIF4E1 gene in Panxian big willow leaf. Two forward and reverse eIF4E1 gene-specific outer primers (P and Q) were designed at 300 - 600 bp upstream and downstream of the base deletion site, and two forward and reverse inner primers (A and B) were designed at the base deletion site. A is the eIF4E1.Pan specific primer, and B is the eIF4E1.S specific primer. One mismatched base G and C were artificially introduced at the third position from the end (-3 position) of the 3' end of the two inner primers respectively to improve the specificity and stability of the amplification reaction (Table 2)( Figure 5 ).
[0047] Table 2 Primer information of co-dominant Bi-PASA molecular markers for eIF4E1 mutant alleles in Panxian big willow leaf
[0048] Primer Name Primer Sequence (5′-3′) Inner Primer A TCTGCAAACAGTGTTTACAATAATAgAC Inner Primer B AACTAACTTGCTTGGGTGGcTG Outer Primer P TGTCTGCCTTAGATGCATGTTG Outer Primer Q CGGACGCTAACTACTGCTCCAC
[0049] As shown in SEQ ID NO.3, 4, 5, 6.
[0050] The PCR reaction system and conditions in the detection of co-dominant Bi-PASA molecular markers are as follows:
[0051] 1) PCR reaction system (20 μl):
[0052] Primix Taq 10 μl <![CDATA[ddH2O]]> 7.6 μl Template DNA (80 ng / μl) 0.8 μl Inner Primer A (10 mM) 0.4 μl Inner Primer B (10 mM) 0.4 μl Outer Primer P (10 mM) 0.4 μl Outer Primer Q (10 mM) 0.4 μl
[0053] 2) PCR reaction cycle program:
[0054]
[0055] 3) Take 5 μl of the amplification product and perform electrophoresis detection on 1% agarose gel.
[0056] 3.3 Validation of the effectiveness of co-dominant Bi-PASA molecular markers
[0057] To verify the effectiveness of the design of two-way allele-specific PCR primers, PCR amplification was performed using the DNA of different types of tobacco materials as templates. As can be seen from Figure 6 -A, the P / B primer combination amplified a 547 bp electrophoresis band in tobacco plants with heterozygous mutant (Honghuadajinyuan × Panxian big willow leaf, K326 × Panxian big willow leaf, Guiyan No. 5 × Panxian big willow leaf) and wild-type (Honghuadajinyuan, K326, Guiyan No. 5) genotypes, and no electrophoresis band was amplified in tobacco plants with homozygous mutant (Panxian big willow leaf) genotype. As can be seen from Figure 6 -B, the A / Q primer combination amplified a 355 bp electrophoresis band in homozygous and heterozygous mutant tobacco plants, and no electrophoresis band was amplified in pure wild-type tobacco plants. Figure 6-C represents the Bi-PASA detection results with the addition of the P / B / A / Q primer combination. In homozygous mutant tobacco plants, one 355bp electrophoresis band and one 854bp electrophoresis band were amplified; in heterozygous mutant tobacco plants, one 355bp electrophoresis band, one 548bp electrophoresis band, and one 854 / 856bp electrophoresis band were amplified; in wild-type tobacco plants, one 548bp electrophoresis band and one 856bp electrophoresis band were amplified. Among different genotypes of tobacco plants, the presence, absence, or intensity of the electrophoresis bands of the outer primer amplification products (854bp, 856bp, and 854 / 856bp) do not affect the allele typing detection results.
[0058] 3.4 PVY resistance identification of the F2 population
[0059] At the seedling stage, the virus sap rubbing inoculation method was used to identify the PVY resistance of the F2 population of 500 individual plants constructed from Honghuadajinyuan and Panxiandaliuye. The disease resistance of individual plants was investigated 20 days after inoculation. Among the identified population, 380 individual plants were susceptible and 120 individual plants were resistant, conforming to the segregation ratio of 3:1, indicating that the PVY resistance of Panxiandaliuye is controlled by a recessive single gene (expressed by the r gene).
[0060] 3.5 Genotyping individual plants of the F2 population using molecular markers
[0061] The Bi-PASA method was used to verify the genotyping of individual plants in the F2 segregating population. The results are as Figure 7 shown. For individual plants 3, 5, 11, 15, and 20, one 355bp electrophoresis band and one 854bp electrophoresis band were amplified, which are homozygous mutant individual plants; for individual plants 4, 6, 10, 14, 19, and 21, one 547bp electrophoresis band and one 856bp electrophoresis band were amplified, which are wild-type individual plants; the remaining individual plants had electrophoresis bands of 355bp, 547bp, and 854 / 856bp simultaneously, and they are heterozygous mutant plants. The above genotyping results are consistent with the disease resistance identification results. Homozygous mutant individual plants are resistant to PVY, while wild-type and heterozygous mutant individual plants are susceptible to PVY.
[0062] 3.6 Application of the Bi-PASA molecular marker in the backcross improvement of tobacco PVY resistance
[0063] For the seeds of the backcross progeny (such as BC1F1, BC2F1, BCnF1) prepared from parents resistant and susceptible to PVY, they were raised by conventional methods. When the tobacco seedlings had 4 - 5 leaves, genomic DNA was extracted using methods such as DNA preparation kits, and PCR amplification was performed using the Bi-PASA molecular marker primers. The PCR reaction system and reaction program were as described above. The PCR products were subjected to agarose gel electrophoresis, photographed, and recorded ( Figure 8 ).
[0064] Then, judge whether the individual plants of the tobacco BCnF1 generation carry the PVY resistance gene (r gene) according to the following criteria: The individual plants with both 355bp and 547bp electrophoretic bands in the backcross progeny are heterozygous mutant individual plants (genotype Rr), such as Figure 8 individual plants No. 2, 5, 6, 8, 9, 11, 13, 15, 16, 18, 20, and 22; The individual plants with a 547bp electrophoretic band but without a 355bp electrophoretic band in the backcross progeny are wild-type individual plants (genotype RR), such as Figure 8 individual plants No. 1, 3, 4, 7, 10, 12, 14, 17, 19, and 21. The selected heterozygous mutant individual plants can continue to be selected by backcrossing or self-crossing combined with the established Bi-PASA molecular marker, and the heterozygous mutant individual plants (genotype Rr) or homozygous mutant individual plants (genotype rr) of the eIF4E1 gene are screened out, and further cultivated into a new PVY-resistant tobacco variety.
[0065] In the process of backcross improvement breeding for transferring single recessive genes, compared with conventional backcross improvement breeding ( Figure 9 -A) or dominant molecular marker-assisted selection breeding ( Figure 9 -A), co-dominant molecular marker-assisted selection breeding ( Figure 9 -B) can directly distinguish the RR and Rr genotypes of BCnF1 individual plants, screen out Rr genotype individual plants, without self-crossing for one generation, and the improvement progress can be shortened by half. Conventional backcross improvement breeding or dominant molecular marker-assisted selection breeding both require self-crossing for one generation, and then PVY inoculation identification or molecular identification of the self-crossed progeny individual plants is carried out to screen out rr genotype individual plants, which is time-consuming and laborious.
Claims
1. A molecular marker tightly linked to the PVY resistance of the sun-cured tobacco variety Panxian Daliushe, characterized in that: The molecular marker is located at the 267-268th position of the cDNA coding region of the eIF4E1 gene, where a double base deletion occurs, resulting in a frameshift mutation and generating a premature termination codon in the second exon.
2. The molecular marker tightly linked to PVY resistance of the sun-cured tobacco variety Panxian Daliushe according to claim 1, characterized in that: The marker associated with wild-type site detection is named ASM-W, and the fragment size is 547 bp, as shown in SEQ ID No.1; the marker associated with mutant site detection is named ASM-m, and the fragment size is 355 bp, as shown in SEQ ID No.
2.
3. A primer for identifying a molecular marker tightly linked to the PVY resistance of the sun-cured tobacco variety Panxian Daliushe in claim 1 or 2, characterized in that: The primer sequences are as follows: Internal primer A: 5′-TCTGCAAACAGTGTTTACAATAATAgAC-3′; Internal primer B: 5′-AACTAACTTGCTTGGGTGGcTG-3′; Outer primer P: 5′-TGTCTGCCTTAGATGCATGTTG-3′; Outer primer Q: 5′-CGGACGCTAACTACTGCTCCAC-3′; As shown in SEQ ID NO.3, 4, 5, 6; The combination of inner primer B and outer primer P was used to amplify the molecular marker ASM-W; The combination of inner primer A and outer primer Q was used to amplify the molecular marker ASM-m.
4. Use of the primers described in claim 3 for identifying molecular markers tightly linked to the PVY resistance of the sun-cured tobacco variety Panxian Daliushe in breeding.