Application of METTL5-targeting medicine in treatment of colorectal cancer and preparation of METTL5-targeting medicine

Abstract

The invention relates to a medicine targeting METTL5, in particular to application of the medicine targeting METTL5 in treatment of colorectal cancer and a preparation of the medicine, and belongs to the field of medicine application. The invention provides a new choice for treatment of colorectal cancer, and the technical scheme is that the application of Stafib-1 in treatment of colorectal cancer can relieve colorectal progression and metastasis. The molecular formula of the Stafib-1 is C26H24N2O11P2, the molecular weight of the Stafib-1 is 598, and the CAS number of the Stafib-1 is 1688703 to 26 to 5. The invention discloses that Stafib-1 inhibits occurrence and development of colorectal cancer and enhances anti-tumor resistance through targeted inhibition of METTL5 for the first time, and Stafib-1 can be used for preparing a new medicine for treating colorectal cancer.

Description

Technical Field

[0001] The present invention belongs to the field of pharmaceutical applications, and particularly relates to the application of a drug targeting METTL5 in the treatment of colorectal cancer and its preparations. Background Art

[0002] Colorectal cancer (CRC) is one of the most common cancer types worldwide, and its incidence is related to gender, age, and economy. In recent years, with the improvement of people's economic level and the change of diet structure in China, the number of CRC patients has been increasing continuously. CRC has a hidden onset and can metastasize at an early stage. The number of patients with distant metastasis (stage IV) accounts for about 20%, and the main metastatic sites are the liver and lungs. The five-year survival rate of patients with liver metastasis is less than 40%; the number of patients with local metastasis (stage II and III) accounts for about 35-45%. Currently, the treatment of CRC mainly focuses on surgery supplemented by radiotherapy and chemotherapy, and the tumor recurrence rate after surgery is as high as about 70%. CRC has a hidden onset, and most patients are found to have metastasized when diagnosed. During the process of CRC developing from precancerous lesions to malignancy, significant cellular and genetic heterogeneity is exhibited, causing great difficulties in clinical surgery and treatment. A large number of studies have shown that there is a group of cells with strong self-renewal and multi-directional differentiation potential in tumors, called cancer stem cells (CSCs). At the early stage of CRC development, there is a phenomenon of CSC diffusion, which has been proven to be closely related to CRC invasion, metastasis, and resistance to radiotherapy and chemotherapy. Existing anti-cancer measures cannot effectively act on cancer stem cells, which may be the fundamental reason for the poor prognosis of tumor patients. Whether it is surgery or chemotherapy, the reduction of tumor volume may not be an effective evaluation criterion for CRC treatment. On the contrary, the remaining cancer stem cells in the body may drive CRC to develop in a more aggressive direction. Therefore, studying the self-renewal and differentiation mechanisms of CSCs, exploring molecular markers for diagnosing and evaluating prognosis for CSCs, developing target drugs that are safe, effective, and have low toxic and side effects, and preventing the metastasis of early CRC have important clinical significance.

[0003] The methyltransferase (METTL) protein family plays a key role in RNA modification and can methylate various types of RNA, including mRNA, tRNA, microRNA, rRNA, and mitochondrial RNA. The METTL protein consists of a unique 7-stranded domain structure that binds to the methyl donor SAM and is involved in the m6A modification of RNA. There are two m6A modification sites on ribosomal rRNA, located at position 28S A4220 of the large subunit and position 18S A1832 of the small subunit. Previous studies have reported that METTL5 can specifically bind to ribosomal 18S rRNA without affecting the production and maturation of rRNA. In recent years, there have been some reports on the m6A modification and regulatory mechanism of ribosomal 18S rRNA by METTL5 in liver cancer and breast cancer. It is highly expressed in tumor tissues and is closely related to tumorigenesis, development, and metastasis. However, there is no report on its higher expression in colorectal cancer stem cells and its close relationship with the development and metastasis of colorectal cancer. Summary of the Invention

[0004] To solve the above-mentioned technical problems, the inventors of the present invention unexpectedly found that the present invention provides a new drug option for the treatment of colorectal cancer. The raw material compound of this drug is Stafib-1, and the molecular formula of Stafib-1 is C 26 H 24 N2O 11 P2, with a molecular weight of 598 and a CAS number of 1688703-26-5.

[0005] Stafib-1 of the present invention can be made into a solid oral sustained-release preparation drug, preferably a matrix-type sustained-release tablet, enteric-coated capsule, or sustained-release and controlled-release pellet capsule; more preferably a matrix-type sustained-release tablet.

[0006] The matrix-type sustained-release tablet mainly consists of an active ingredient, a matrix material, a lubricant, a filler, and a coating material.

[0007] The matrix material is a chitosan derivative; preferably one or a combination of N-carboxymethyl chitosan and O-carboxymethyl chitosan; more preferably, the matrix material is a combination of N-carboxymethyl chitosan and O-carboxymethyl chitosan, with a weight ratio of 1:1.

[0008] On the basis of maintaining some properties of chitosan, the chitosan derivative improves its water-insolubility and sustained-release performance, can form a stable complex with the drug, realizes the slow release of the drug, and also has certain biological activity and mucosal adhesiveness, which can improve the absorption of the drug in the gastrointestinal tract and is more suitable for the treatment of colorectal cancer.

[0009] The coating material is coating powder.

[0010] The filler is lactose.

[0011] The lubricant is magnesium stearate.

[0012] Preferably, calculated by weight percentage, the prescription composition of the matrix-type sustained-release tablet is as follows:

[0013] Stafib-1: 20-60%

[0014] Chitosan derivative: 30-50%

[0015] Lactose: 10-25%

[0016] Magnesium stearate: 1%

[0017] Coating powder: 3%.

[0018] The preparation process is as follows: Sieving Stafib-1, N-carboxymethyl chitosan, O-carboxymethyl chitosan, chitosan derivative, and lactose respectively, and mixing them according to the prescription ratio; Using 80%-90% ethanol as a wetting agent to make soft materials, drying, and granulating: Adding magnesium stearate as a lubricant and tabletting into cores; Using Coating powder to coat the tablet cores.

[0019] Further preferably

[0020] Calculated by weight percentage, the prescription of the matrix-type sustained-release tablet has the following raw material composition:

[0021] Stafib-1: 40%;

[0022] Chitosan derivative: 40%;

[0023] Lactose: 16%;

[0024] Magnesium stearate: 1%;

[0025] Coating powder: 3%.

[0026] Further preferably

[0027] Calculated by weight percentage, the prescription of the matrix-type sustained-release tablet has the following raw material composition:

[0028] Stafib-1: 40%;

[0029] N-carboxymethyl chitosan: 20%;

[0030] O-carboxymethyl chitosan: 20%;

[0031] Lactose: 16%;

[0032] Magnesium stearate: 1%;

[0033] Coating powder: 3%;

[0034] The preparation process is as follows: Sieving Stafib-1, N-carboxymethyl chitosan, O-carboxymethyl chitosan, chitosan derivative, and lactose respectively, and mixing them according to the prescription ratio; Using 80%-90% ethanol as a wetting agent to make soft materials, drying, and granulating: Adding magnesium stearate as a lubricant and tabletting into cores; Using coating powder to coat the tablet cores.

[0035] Stafib-1 of the present invention can inhibit METTL5, thereby inhibiting the proliferation, metastasis and stem cell spheroid formation of colorectal cancer.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] 1. The present invention has confirmed through animal models that Stafib-1 can significantly inhibit the proliferation, metastasis and stem cell spheroid formation ability of colorectal cancer, thereby verifying that Stafib-1 significantly inhibits the tumorigenic ability of subcutaneous and intestinal tumors in nude mice. Subsequently, on the basis of discovering METTL5 as a new drug target for colorectal cancer, it is first revealed that Stafib-1 inhibits the occurrence and development of colorectal cancer and enhances the anti-tumor effect by inhibiting METTL5. Stafib-1 can be prepared into a new anti-tumor drug that inhibits METTL5, providing a new option for the treatment of colorectal cancer.

[0038] 2. The active ingredient of Stafib-1 of the present invention can be prepared into a matrix-type sustained-release tablet. Using chitosan derivative as a matrix material, on the basis of maintaining some characteristics of chitosan, its water-insolubility and sustained-release performance are improved, and it can form a stable complex with the drug to achieve slow release of the drug. At the same time, it also has certain biological activity and mucosal adhesiveness, which can improve the absorption of the drug in the gastrointestinal tract and is more suitable for the treatment of colorectal cancer.

[0039] 3. The sustained-release tablet prepared by the present invention has good sustained-release effect and simple preparation process, and is suitable for industrial production. Description of the Drawings

[0040] Figure 1 It is the molecular structure of Stafib-1 and the computer prediction of its binding with METTL5 protein.

[0041] Figure 2 It is to determine the action concentration and time of Stafib-1.

[0042] Figure 3 It is the effect of Stafib-1 on the inhibition of METTL5 and the influence on the proliferation and apoptosis of colorectal cells.

[0043] Figure 4Effect of Stafib-1 on colorectal cancer cell metastasis and cancer stem cell sphere formation.

[0044] Figure 5 Effect of Stafib-1 on inhibiting subcutaneous and intestinal tumors in nude mice.

[0045] Figure 6 HE and Ki67 staining effects of subcutaneous tumor tissues in nude mice and METTL5 immunohistochemical results. Detailed implementation mode

[0046] The technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings and embodiments.

[0047] Example 1

[0048] Molecular structure of Stafib-1, and computer prediction of its binding to METTL5 protein.

[0049] Stafib-1 is a derivative of Fosfosal (phosphosalicylic acid) and has been reported as an inhibitor of STAT5. The present invention reveals that Stafib-1 is also an inhibitor of METTL5, and thus can be used as a new drug for the treatment of colorectal cancer.

[0050] Figure 1 Figure A shows the molecular formula of Stafib-1. The molecular formula of Stafib-1 is C26H24N2O11P2, with a molecular weight of 598 and a CAS number of 1688703-26-5.

[0051] Figure 1 Figure B shows the cartoon and surface diagrams of the binding of METTL5 protein to Stafib-1. The METTL5 protein is shown as a green cartoon, and Stafib-1 is shown as a light blue stick.

[0052] Figure 1 Figure C shows the 2D and 3D diagrams of the binding of METTL5 protein to Stafib-1. The C backbone of the METTL5 protein is shown as green, the N atom is shown as blue, the O atom is shown as bright red, the H atom is shown as white, and Stafib-1 is shown as a light blue stick. The salt bridge interaction is shown as a blue dashed line, and the hydrogen bond interaction is shown as a purple dashed line. The longer the hydrogen bond length, the weaker the hydrogen bond interaction. Stafib-1 can form 3 hydrogen bond interactions and 4 salt bridge interactions with the METTL5 protein: the amide hydrogen acts as a hydrogen bond donor to form 1 hydrogen bond interaction with GLN28, with a distance of Two phosphate oxygens act as hydrogen bond acceptors to form 2 hydrogen bond interactions with ARG32 and ALA188, with distances of In addition, Stafib-1 can also form 4 salt bridge interactions with ARG32.

[0053] Example 2

[0054] Determination of the concentration and time of action of Stafib-1

[0055] Figure 2 Figures A-D are used to explore the optimal concentration and action time of Stafib-1 by the CCK8 method, and it is determined that the optimal action concentration of Stafib-1 is 25 nM and 50 nM, and the action time is 24 h.

[0056] The specific experimental method is as follows:

[0057] Cell culture: HCT116 cells were cultured in DMEM medium (containing 10% fetal bovine serum) at 37 °C under 5% CO2 conditions.

[0058] Drug treatment: Stafib-1 was dissolved in DMSO to concentrations of 200 nM, 100 nM, 50 nM, 25 nM, 10 nM, 5 nM, and 1 nM for standby.

[0059] CCK8 experiment: HCT116 cells were digested, counted, and seeded in 96-well plates at 1000 cells per well. After overnight adhesion, different concentrations of Stafib-1 (0, 1, 5, 10, 25, 50, 100, 200 nM) were allowed to act for 12 h, 24 h, 48 h, and 72 h. Then, 10 μl of CCK8 was added to each well, and after incubation in a 37 °C incubator for 30 min, the cells were directly detected in an enzyme-linked immunosorbent assay (ELISA) reader at a wavelength of 450 nm, and the cell survival ratio was calculated.

[0060] Example 3

[0061] Effect of Stafib-1 on METTL5 inhibition and its impact on the proliferation and apoptosis of colorectal cells

[0062] Figure 3 Figures A and B show that Stafib-1 can significantly inhibit the protein and mRNA levels of METTL5.

[0063] Figure 3 Figures C and D describe that Stafib-1 significantly inhibits the proliferation of colorectal cancer and arrests colorectal cancer cells in the G2 phase.

[0064] The specific experimental protocol is as follows:

[0065] RT-PCR experiment: Total RNA was extracted from the cells in the drug-free group and the Stafib-1 groups at 25 nM and 50 nM using the Trizol method. 1 μL of Revert Aid reverse transcriptase was added, and reverse transcription of the RNA was carried out at 42 °C for 60 min and then at 70 °C for 10 min. Using the reverse transcription product cDNA as a template, three replicates were made for each target gene. The reaction system was as follows: 5 μL of SYBR Green, 1.5 μL each of the upstream and downstream primers (diluted 30 - 50 times, final concentration 3 μM - 2 μM), and 2 μL of the template (final concentration 0.1 ng / 3 μL, which can be diluted 5 - 20 times according to the template concentration). The total volume of the system was 10 μL. 18S was used as an internal reference for each target gene. The general PCR program was 94 °C for 5 min; 94 °C for 30 sec, 55 °C for 30 sec, 72 °C for 1 min, and 72 °C for 10 min. After the experiment, the ΔΔt value was calculated.

[0066] The primers for the target genes were:

[0067] Human METTL5 Forward: AAGGAACTAGAGAGTCGCCTG

[0068] Human METTL5 Reverse: GCGGCCTGGTAGGATACTG

[0069] Human 18S Forward: TGAGAAGACGGTCGAACTTGACT

[0070] Human 18S Reverse: GCATTGTTCCAAAGGCATCCACT

[0071] WB experiment: The cells in the drug-free group and the Stafib-1 groups at 25 nM and 50 nM were lysed with cell lysis buffer containing protease inhibitors, and the cell protein concentration was measured by the BCA method. Vertical slab electrophoresis was carried out using SDS-polyacrylamide, with a voltage of 80 - 110 V. After electrophoresis, a PVDF membrane of the same size as the separating gel was cut out, immersed in methanol for activation, and then, using a BIO-RAD electrophoresis apparatus, porous filter pads, thick filter paper, separating gel, PVDF membrane, thick filter paper, and porous filter pads were clamped in order from the anode to the cathode, maintaining a constant current of 350 mA for 2 h. After the transfer, the membrane was blocked with BSA blocking solution (5%) at room temperature for 1 h, and primary antibodies against MTTL5 and GAPDH were added and incubated overnight at 4 °C. The next day, secondary antibodies against rabbit and mouse were added and incubated at room temperature for 2 h. Finally, the PVDF membrane was scanned using an Odyssey CLX Infrared Imaging System to save the fluorescent bands.

[0072] Cell cloning experiment: HCT116 suspension was seeded in a six-well plate at 2000 cells per well, treated with Stafib-1 for 2 weeks, the cell aggregation was observed, photographed under a microscope, and at least three replicates were performed for each well.

[0073] Cell apoptosis experiment: Annexin V-FITC / propidium iodide (PI) double staining was used to detect cell apoptosis. After the cells were treated with Stafib-1, they were washed with ice-cold PBS, digested with trypsin and collected. Annexin V-FITC / propidium iodide (PI) were incubated together at room temperature for 15 min. After washing 1-3 times with PBS, the fluorescence intensity in the cells was detected by flow cytometry. Among them, cells treated with cisplatin (10 μg / ml) for 12 h were used as the positive control group.

[0074] Example 4

[0075] Effect of Stafib-1 on the metastasis and cancer stem cell sphere formation of colorectal cancer cells

[0076] Figure 4 Figures A and B show that Stafib-1 can significantly inhibit the invasion and metastasis of colorectal cancer cells. The bar chart is a statistical chart of the number of cells with colorectal cancer invasion and metastasis.

[0077] Figure 4 Figure C shows that Stafib-1 can significantly inhibit the ability of cancer stem cells to form spheres. The bar chart is a statistical chart of the average diameter of cancer stem cell spheres.

[0078] The specific experimental protocol is as follows:

[0079] Colorectal cancer invasion and metastasis: Transwell was used to measure the ability of migrating and invading CRC cells. Fresh medium was added to the lower chamber. CRC cells (5×10 5 ) were seeded in the upper chamber and cultured in serum-free medium. For the invasion assay, the upper chamber was pretreated with Matrigel, and CRC cells (5×10 5 ) were seeded in the upper chamber and cultured in serum-free medium. At the end of the experimental time point, the cells were fixed with formaldehyde, stained with crystal violet, photographed under a microscope, and three independent experiments were performed respectively. At least three fields of view were photographed for each group, and the number of migrating and invading cells was observed and counted.

[0080] Sphere culture of stem cells: The HCT116 suspension was seeded in a low-adhesion 96-well plate (300 - 500 cells) or a 6-well plate (1000 - 2000 cells). The tumor stem cell induction medium was prepared with serum-free DMEM and contained 2% B27, β-fibroblast growth factor (β-FGF, 20 ng / mL), epidermal growth factor (EGF, 20 ng / ml), 100 U / ml penicillin, and 100 μg / ml streptomycin. The cells were treated with Stafib-1, and the formation of stem cell spheres was observed under a microscope after 3, 6, and 9 days of cell growth.

[0081] Example 5

[0082] Effect of Stafib-1 on inhibiting subcutaneous and intestinal tumors in nude mice

[0083] Figure 5 Figure A shows a schematic diagram of the procedures for subcutaneous tumorigenesis model and intestinal chemical carcinogenesis model in nude mice.

[0084] Figure 5 Figure B shows that after Stafib-1 acts on the subcutaneous tumors grown in nude mice, it can significantly inhibit the continued development of subcutaneous tumors. Compared with the control group, the tumor volume of the tissue treated with Stafib-1 is significantly smaller. The dot plot is a statistical chart of the volumes of the drug group and the control group.

[0085] Figure 5 Figure C shows that during the process of azoxymethane-induced intestinal cancer formation in nude mice, after intraperitoneal injection of Stafib-1, the number of intestinal tumors can be significantly alleviated. The dot plot is a statistic of the number of intestinal tumors with or without the action of Stafib-1.

[0086] Feeding conditions for BALB / c nude mice:

[0087] Temperature: The room temperature suitable for nude mice is 26 - 28 °C (78 - 82 °F).

[0088] Humidity: The relative humidity should be maintained at 40 - 60%.

[0089] Ventilation: Ventilation and air change are required 10 - 15 times per hour. Particles larger than 0.3 μm in the air are removed by a high-efficiency filter (99.9%). A filtering device is set at the air outlet to prevent contamination during air backflow. In the laminar air flow room, the positive pressure of the air is at least 0.65 cm / H2O.

[0090] Lighting: The light and dark cycle should be maintained at 10 hours of light and 14 hours of darkness per day. Artificial lighting is used, and the lighting is constant throughout the year.

[0091] Subcutaneous tumor model in nude mice: The HCT116 cells in the logarithmic growth phase were prepared into a single-cell suspension, and the cell concentration was adjusted to 2×10 7 / mL. According to the inoculation amount of 0.1 mL per mouse, inject the cell suspension subcutaneously into the right axilla of nude mice. Continuously observe for 3 weeks after injection. When the diameter of the subcutaneous tumor reaches 0.5 cm, inject Stafib-1 (2 μg / kg). After 4 weeks, collect the tissues for subsequent HE, Ki67, and METTL5 staining.

[0092] Chemical carcinogenesis model of azoxymethane (AOM) in nude mice: AOM is prepared into a solution with a concentration of 1.25 g / L using physiological saline. Select 6-week-old female ICR mice and intraperitoneally inject them at a dose of 10 mg / kg body weight once a week for 4 consecutive weeks. Then, at the same time as the experimental group, intraperitoneally inject Stafib-1 (2 μg / kg) for 4 weeks. After that, euthanize the nude mice, take the intestinal tissues, photograph and observe them, and reserve them for later use.

[0093] Example 6

[0094] HE and Ki67 staining effects of subcutaneous tumor tissues in nude mice and METTL5 immunohistochemical results

[0095] Figure 6 Figure A of [description] is the HE staining of subcutaneous tumor tissues. The results show that after the action of Stafib-1, the tissue disorder of subcutaneous tumors decreases.

[0096] Figure 6 Figure B of [description] is the Ki67 staining of subcutaneous tumor tissues. The results show that after the action of Stafib-1, the number of nuclei in subcutaneous tumor tissues is mostly normal, indicating that the proliferation level of tissue cells has recovered.

[0097] Figure 6 Figure B of [description] is the immunohistochemical staining of METTL5 in subcutaneous tumor tissues. The results show that after the action of Stafib-1, the expression of METTL5 protein in subcutaneous tumor tissues is significantly reduced.

[0098] Preparation before the experiment: After euthanizing the nude mice, quickly dissect the subcutaneous tumor tissues and place them in 4% paraformaldehyde for fixation (the volume is more than 10 times that of the tissue). Fixation time: 24 - 48 hours (avoid over-fixation affecting antigenicity). Rinse the fixed tissues with PBS and perform subsequent dehydration treatment. Gradient ethanol dehydration: 70% ethanol → 80% ethanol → 90% ethanol → 95% ethanol → 100% ethanol (1 - 2 hours for each step). Clearing: Xylene I → Xylene II (1 hour for each step). Wax impregnation: Immerse in paraffin at 60°C twice (1 hour each time). Embedding: Place the tissues in an embedding cassette and cool and solidify them into wax blocks. Sectioning: Cut 4 - 5 μm thick sections with a paraffin slicer and attach them to adhesive-free glass slides. Bake the slides in an oven at 60°C for 2 hours to enhance the adhesion of the sections.

[0099] Hematoxylin and Eosin staining (HE) staining: Dewaxing and hydration in xylene I and II for 10 minutes each → Gradient ethanol (100% → 95% → 80% → 70%) for 5 minutes each → Distilled water wash. Stain with hematoxylin solution for 5 - 10 minutes, differentiate with 1% hydrochloric acid ethanol for several seconds, return to blue in running water for 15 - 30 minutes, and then stain with eosin solution for 1 - 3 minutes. Dehydrate with gradient ethanol (70% → 80% → 90% → 95% → 100%) → Clear in xylene → Mount with neutral balsam. Microscopic observation: The cell nucleus is blue and the cytoplasm is red.

[0100] Ki67 staining: Dewaxing and hydration follow the same steps as HE staining. Antigen retrieval is performed with citrate buffer (pH 6.0) (medium heat for 10 minutes), incubate with 3% H2O2 at room temperature in the dark for 10 minutes to block endogenous peroxidase, block with 5% BSA or normal serum at room temperature for 30 minutes. Dropwise add Ki67 primary antibody, incubate overnight at 4°C or for 1 hour at 37°C. Incubate with HRP-labeled secondary antibody at room temperature for 30 minutes. Develop color with DAB chromogenic solution in the dark. Result interpretation: Ki67 positive: Brown granules in the cell nucleus; negative: Colorless or light blue.

[0101] METTL5 immunohistochemical staining: Dewaxing, hydration, antigen retrieval, and blocking are the same as for Ki67. Incubate with anti-METTL5 primary antibody at 4°C overnight, and the next day incubate with HRP-labeled anti-rabbit secondary antibody at room temperature for 30 minutes. Dropwise add DAB chromogenic solution in the dark until positive signals appear (brown), immediately stop with running water, stain the nucleus with hematoxylin for 2 minutes, return to blue in running water for 15 minutes, dehydrate with gradient ethanol, clear in xylene, and then mount.

[0102] Example 7

[0103] For the Stafib-1 sustained-release tablets of the present invention, calculated by weight percentage, the prescription composition of the matrix-type sustained-release tablets is as follows:

[0104] Stafib-1: 55%

[0105] N-carboxymethyl chitosan: 30%

[0106] Lactose: 11%

[0107] Magnesium stearate: 1%

[0108] Coating powder: 3%

[0109] The preparation process of the Stafib-1 sustained-release tablets is as follows:

[0110] ① Pass Stafib-1, N-carboxymethyl chitosan, and lactose through a 90-mesh sieve respectively;

[0111] ② Mix Stafib-1, N-carboxymethyl chitosan, and lactose in the prescription ratio;

[0112] ③ Use 80%-90% ethanol as a wetting agent, make it into soft materials, dry, and size the granules:

[0113] ④ Add magnesium stearate (1%) as a lubricant and press into cores;

[0114] ⑤ Use Coating powder (3%) to coat the tablet cores.

[0115] Example 8

[0116] For the Stafib-1 sustained-release tablets of the present invention, calculated by weight parts, the prescription composition of the matrix-type sustained-release tablets is:

[0117] Stafib-1: 21%

[0118] O-carboxymethyl chitosan: 50%

[0119] Lactose: 25%

[0120] Magnesium stearate: 1%

[0121] Coating powder: 3%

[0122] The preparation process is the same as that in Example 7.

[0123] Example 9

[0124] For the Stafib-1 sustained-release tablets of the present invention, calculated by weight parts, the prescription composition of the matrix-type sustained-release tablets is:

[0125] Stafib-1: 40%

[0126] N-carboxymethyl chitosan: 40%

[0127] Lactose: 16%

[0128] Magnesium stearate: 1%

[0129] Coating powder: 3%

[0130] The preparation process is the same as that in Example 7.

[0131] Example 10

[0132] For the Stafib-1 sustained-release tablets of the present invention, calculated by weight parts, the prescription composition of the matrix-type sustained-release tablets is:

[0133] Stafib-1: 40%

[0134] N-carboxymethyl chitosan: 20%

[0135] O-carboxymethyl chitosan: 20%

[0136] Lactose: 16%

[0137] Magnesium stearate: 1%

[0138] Coating powder: 3%

[0139] The preparation process is the same as that in Example 7.

[0140] Comparative Example 1

[0141] For the Stafib-1 sustained-release tablets, calculated by weight proportion, the prescription composition of the matrix-type sustained-release tablets is as follows:

[0142] Stafib-1: 70%

[0143] O-Carboxymethyl chitosan: 10%

[0144] Lactose: 16%

[0145] Magnesium stearate: 1%

[0146] Coating powder: 3%

[0147] The preparation process is the same as that in Example 7.

[0148] Comparative Example 2

[0149] For the Stafib-1 sustained-release tablets, calculated by weight proportion, the prescription composition of the matrix-type sustained-release tablets is as follows:

[0150] Stafib-1: 40%

[0151] HPMC K100M: 40%

[0152] Lactose: 16%

[0153] Magnesium stearate: 1%

[0154] Coating powder: 3%

[0155] Preparation process: Mix Stafib-1, HPMC K100M and lactose evenly, use a dry granulator to compress them into large tablets or blocks, crush them into granules of appropriate size, screen and size them, add magnesium stearate, mix thoroughly, press tablets, control the tablet weight and pressure, and use coating powder to prepare a coating solution and carry out coating treatment.

[0156] Comparative Example 3

[0157] For the Stafib-1 sustained-release tablets, calculated by weight proportion, the prescription composition of the matrix-type sustained-release tablets is as follows:

[0158] Stafib-1: 40%

[0159] Ethylcellulose: 40%

[0160] Lactose: 16%

[0161] Magnesium stearate: 1%

[0162] Coating powder: 3%

[0163] The preparation process is as follows:

[0164] Mix Stafib-1, ethylcellulose and lactose evenly, compress them into large tablets or blocks using a dry granulator, crush them into granules of appropriate size, screen and size them, add magnesium stearate, mix thoroughly, tableting, control the tablet weight and pressure, and use coating powder to prepare a coating solution for coating treatment.

[0165] Verification examples

[0166] 1: Dissolution verification

[0167] Purpose: To evaluate whether the drug release behavior of the sustained-release tablets prepared in Examples 7-10 and Comparative Examples 1-3 conforms to the sustained-release characteristics.

[0168] Method:

[0169] Adopt the paddle method in the Chinese Pharmacopoeia, 900 mL of phosphate buffer solution (pH 6.8), rotation speed 50 rpm, temperature 37 ± 0.5 °C.

[0170] Sampling time points: 1, 2, 4, 8, 12, 24 hours, and the cumulative release amount is determined by HPLC method (n = 6).

[0171] The data are shown in Table 1:

[0172] Table 1 Cumulative release amount determined by HPLC method (%) of Examples 7-10 and Comparative Examples 1-3

[0173]

[0174] Conclusion:

[0175] The release curves of Examples 7-10 conform to the Higuchi model (R 2 = 0.994), and the release is nearly complete in 24 hours, meeting the requirements of sustained-release preparations (target: ≥ 95% in 24 hours); while Comparative Examples 1-3 do not meet the requirements of sustained-release preparations.

[0176] 2: Accelerated stability verification

[0177] Purpose: To investigate the quality changes of the sustained-release tablets prepared in Examples 7-10 and Comparative Examples 1-3 under high temperature and high humidity conditions.

[0178] Condition: 40 °C / 75% RH, 0, 1, 3, 6 months (n = 3).

[0179] Detection indicators:

[0180] Related substances (HPLC method): total impurities, maximum single impurity.

[0181] Content (HPLC external standard method).

[0182] Dissolution (cumulative release amount in 24 hours).

[0183] The data is shown in Table 2:

[0184] Table 2 Other physical indicators of Examples 7 - 10 and Comparative Examples 1 - 3

[0185]

[0186]

[0187] Conclusion:

[0188] For Examples 7 - 10, the total impurities ≤ 2.0%, single impurity ≤ 1.0%, content ≥ 95%, and dissolution ≥ 95% at 6 months, meeting the ICH Q1A accelerated stability requirements; while for Comparative Examples 1 - 3, the total impurities > 2.0%, single impurity > 1.0%, content < 95%, and dissolution < 95% at 6 months, not meeting the ICH Q1A accelerated stability requirements.

[0189] 3: Verification of related substances and content uniformity

[0190] Purpose: To evaluate the initial quality consistency of the sustained-release tablets prepared in Examples 7 - 10 and Comparative Examples 1 - 3.

[0191] Method:

[0192] Related substances: Determine total impurities and single impurity by HPLC method.

[0193] Content uniformity: Take 10 tablets and determine by HPLC method (standard: 90 - 110%).

[0194] The data is shown in Table 1:

[0195] Table 3 Related substance contents (%) of Examples 7 - 10 and Comparative Examples 1 - 3

[0196] Sample Total Impurities (%) Maximum Single Impurity (%) Content (% ± RSD) Example 7 0.5 0.2 99.8±1.2 Example 8 0.6 0.3 100.5±1.0 Example 9 0.4 0.2 98.9±0.8 Example 10 0.3 0.1 100.6±0.5 Comparative Example 1 1.6 1.2 98.3±2.2 Comparative Example 2 1.5 0.9 97.2±2.6 Comparative Example 3 1.8 1.2 98.4±2.5

[0197] Conclusion:

[0198] The total impurities of the sustained-release tablet samples prepared in Examples 7-10 were ≤0.6%, the single impurity was ≤0.3%, and the content RSD was <2%, meeting the uniformity requirements of the Chinese Pharmacopoeia; while the total impurities of the sustained-release tablet samples prepared in Comparative Examples 1-3 were >0.6%, the single impurity was >0.3%, and the content RSD was >2%, not meeting the uniformity requirements of the Chinese Pharmacopoeia.

[0199] Through the above verification, the Stafib-1 sustained-release tablet has good sustained-release performance, stability and production consistency.

Claims

1. A compound for treating colorectal cancer, characterized in that, The structural formula of the said compound is as follows:

2. The compound according to claim 1, wherein The said compound can inhibit METTL5, thereby inhibiting the proliferation, metastasis and stem cell spheroid formation of colorectal cancer.

3. The compound according to claim 1, wherein The said compound can be made into a solid oral sustained-release preparation drug.

4. The compound according to claim 3, wherein, The said compound is made into a matrix-type sustained-release tablet, enteric-coated capsule or sustained-release and controlled-release pellet capsule.

5. The compound according to claim 4, characterized in that, The said compound is made into a matrix-type sustained-release tablet.

6. The compound according to claim 5, characterized in that, The said matrix-type sustained-release tablet is mainly composed of an active ingredient, a matrix material, a lubricant, a filler and a coating material.

7. The compound according to claim 6, wherein The said matrix material is one or a combination of N-carboxymethyl chitosan and O-carboxymethyl chitosan. Further, the said matrix material is a combination of N-carboxymethyl chitosan and O-carboxymethyl chitosan, and the weight ratio is 1:

1.

8. The compound according to claim 6, characterized in that, The coating material is coating powder, the filler is lactose, and the lubricant is magnesium stearate.

9. The compound according to claim 5, wherein Calculated by weight percentage, the prescription composition of the said matrix-type sustained-release tablet is as follows: Stafib-1: 21-55%; Chitosan derivative: 30-50%; Lactose: 16-30%; Magnesium stearate: 1%; Coating powder: 3%; Further preferably, Stafib-1: 40%; Chitosan derivative: 40%; Lactose: 16%; Magnesium stearate: 1%; Coating powder: 3%.

10. A matrix sustained-release tablet containing Stafib-1, characterized in that, Calculated by weight percentage, the prescription of the said matrix-type sustained-release tablet has the following raw material composition: Stafib-1: 40%; N-carboxymethyl chitosan: 20%; O-carboxymethyl chitosan: 20%; Lactose: 16%; Magnesium stearate: 1%; Coating powder: 3%; The preparation process is as follows: Sieve Stafib-1, chitosan derivative and lactose respectively, and mix them according to the prescription ratio; Use 80%-90% ethanol as a wetting agent to make a soft material, dry it, granulate it: Add magnesium stearate as a lubricant and press it into cores; Use Coat the tablet core with the coating powder.

Images