A double-loaded microneedle of tacrolimus combined with siRNA and a preparation method and application thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a double-drug microneedle of tacrolimus combined with siRNA and a preparation method and application thereof. The double-drug microneedle comprises a backing part and a needle tip part arranged on one side of the backing part, and the needle tip part is obtained by mixing and solidifying tacrolimus, siRNA targeting TNF-alpha, methacrylated gelatin, carrageenan and sodium alginate or by mixing and solidifying tacrolimus, siRNA targeting IL-6 and polyvinyl alcohol. The double-drug microneedle provided in the application simultaneously loads tacrolimus and TNF-alpha siRNA or IL-6 siRNA, realizes the administration of two therapeutic drugs at the same time by one microneedle, and experiments prove that the double-drug microneedle has a better therapeutic effect than the single tacrolimus microneedle.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a dual-drug-loaded microneedle of tacrolimus combined with siRNA, its preparation method, and its application. Background Technology

[0002] Psoriasis is a chronic, relapsing inflammatory skin disease, commonly characterized by scaly, erythematous plaques on the epidermis with well-defined borders, thick scales raised above the skin surface, and significant itching. Treatment methods for psoriasis depend on its severity and location, and currently fall into three categories: topical therapy, phototherapy, and systemic therapy. Topical therapy is primarily for mild to moderate psoriasis patients, and commonly used medications include macrolide immunomodulatory inhibitors, keratolytic agents, coal tar, and corticosteroids. However, the use of single-drug therapy suffers from poor skin penetration, low drug retention rates, lack of long-term controlled release leading to frequent dosing, and serious side effects such as gastrointestinal toxicity, liver damage, bone marrow suppression, and weakened immunity leading to infection. Therefore, there is a need to develop an enteral delivery system with efficient delivery and minimal side effects.

[0003] In recent years, microneedle drug delivery technology has emerged as a novel method for delivering large molecular weight biological drugs. By inserting drug-carrying microneedles into the skin for subcutaneous drug administration, it offers safety, convenience, and high bioavailability, allowing for the achievement of desired therapeutic effects with smaller doses. This provides a new treatment option for psoriasis.

[0004] Tacrolimus (TAC) is a calciphosphatase inhibitor, a macrolide antibiotic, and is commonly used in the treatment of psoriasis with tacrolimus ointment. However, as a delivery carrier, the ointment cannot effectively penetrate the outermost skin barrier, hindering the drug's penetration into the dermis and reducing its therapeutic effect. Furthermore, the ointment's high viscosity, oily texture, slow skin penetration, and poor patient compliance limit the application of tacrolimus ointment for topical treatment.

[0005] Some reports have described combining tacrolimus with microneedle drug delivery technology to create tacrolimus-containing microneedle patches for the treatment of inflammation, tinea, and other skin conditions. However, tacrolimus has low water solubility, limiting the drug loading efficiency of microneedles. Furthermore, tacrolimus may suppress local immunity, and the micro-trauma caused by microneedles may increase the risk of bacterial / fungal colonization, especially in areas with extensive skin lesions.

[0006] Therefore, improving tacrolimus microneedle patches for better treatment of psoriasis remains a technical challenge. Summary of the Invention

[0007] To address the aforementioned technical problems, one objective of this invention is to provide a dual-drug-loaded microneedle combining tacrolimus and siRNA.

[0008] The technical solution adopted in this invention is as follows:

[0009] A dual-drug-loaded microneedle combining tacrolimus and siRNA includes a backing portion and a needle tip disposed on one side of the backing portion, wherein the needle tip is implemented through the following two methods:

[0010] Option A: The needle tip consists of tacrolimus, siRNA targeting TNF-α, methacrylamide gelatin, carrageenan, and sodium alginate, and the components are mixed and cured to obtain the needle tip.

[0011] Option B: The needle tip consists of tacrolimus, siRNA targeting IL-6, and polyvinyl alcohol, which are mixed and cured to obtain the needle tip.

[0012] Preferably, the siRNA targeting TNF-α is linked to a DNA tetrahedron via complementary base pairing. The DNA tetrahedron is composed of complementary bases S1, S2, S3, and S4 of single-stranded DNA. The S1 sequence is shown in SEQ ID NO:1, the S2 sequence in SEQ ID NO:2, the S3 sequence in SEQ ID NO:3, and the S4 sequence in SEQ ID NO:4. The siRNA targeting TNF-α includes a sense strand and an antisense strand. The sense strand sequence is shown in SEQ ID NO:5, and the antisense strand sequence is shown in SEQ ID NO:6.

[0013] The IL-6-targeting siRNA is linked to a DNA tetrahedron via complementary base pairing. The DNA tetrahedron is composed of complementary bases S1, S2, S3, and S4 of single-stranded DNA. The S1 sequence is shown in SEQ ID NO:1, the S2 sequence in SEQ ID NO:2, the S3 sequence in SEQ ID NO:3, and the S4 sequence in SEQ ID NO:4. The IL-6-targeting siRNA includes a sense strand and an antisense strand. The sense strand sequence is shown in SEQ ID NO:7, and the antisense strand sequence is shown in SEQ ID NO:8.

[0014] Preferably, the backing portion has a size of (10-15) × (10-15) mm, and the needle tip is located at the center of the backing portion, including microneedles arranged in a 15×15 array. The needle height of the microneedles is 500-800 μm, and the distance between adjacent needle tips is 600-800 μm.

[0015] The second objective of this invention is to provide a method for preparing a dual-drug-loaded microneedle of tacrolimus and siRNA as described above, comprising the following steps:

[0016] Regarding Option A:

[0017] S1. Prepare a negative mold microneedle array mold based on the designed microneedle patch;

[0018] S2. Preparation of the tip system: Methacrylamide gelatin, carrageenan and sodium alginate are mixed in proportion and heated to dissolve to obtain a base solution; DNA tetrahedral material is prepared, wherein the DNA tetrahedral material is linked to the siRNA targeting TNF-α, and then tacrolimus, DNA tetrahedral material and base solution are mixed in a set proportion to obtain the desired tip system;

[0019] S3. Assembly: Add the microneedle system solution to the negative mold microneedle array mold and fill the tip part of the negative mold microneedle array mold. After UV curing, continue to add the tip system until the backing part of the negative mold microneedle array mold is filled. Dry for at least 24 hours, demold, and obtain the desired dual drug-loaded microneedles.

[0020] Regarding Option B:

[0021] S1. Prepare a negative mold microneedle array mold based on the designed microneedle patch;

[0022] S2. Preparation of the tip system: Prepare a DNA tetrahedral material, wherein the DNA tetrahedral material is linked to the siRNA targeting TNF-α, and then mix tacrolimus, the DNA tetrahedral material and polyvinyl alcohol solution in a set ratio to obtain the desired tip system;

[0023] S3. Preparation of backing solution: A polyvinyl alcohol aqueous solution;

[0024] S4. Assembly: The needle tip system is added to the female mold microneedle array mold and fills the needle tip part of the female mold microneedle array mold. After drying, a backing solution is added. The backing solution contacts the needle tip system and fills the backing part of the female mold microneedle array mold. After drying, the mold is demolded to obtain the desired dual drug-loaded microneedles.

[0025] Preferably, the method for preparing DNA tetrahedra linked to siRNA targeting TNF-α is as follows: the siRNA targeting TNF-α and the DNA strands constituting the DNA tetrahedra are diluted to 10 μM working solutions, the working solutions are mixed at a stoichiometric ratio of 1:1, and then annealed in a PCR instrument to obtain the desired DNA tetrahedra linked to siRNA targeting TNF-α.

[0026] The method for preparing DNA tetrahedra linking siRNA targeting IL-6 is as follows: the siRNA targeting IL-6 and the DNA strands constituting the DNA tetrahedra are diluted to 10 μM working solutions, and the working solutions are mixed at a stoichiometric ratio of 1:1 and annealed in a PCR instrument to obtain the desired DNA tetrahedra linking siRNA targeting IL-6.

[0027] Preferably, the DNA tetrahedron is composed of complementary bases of single-stranded DNA S1, S2, S3, and S4, wherein the S1 sequence is shown in SEQ ID NO:1, the S2 sequence is shown in SEQ ID NO:2, the S3 sequence is shown in SEQ ID NO:3, and the S4 sequence is shown in SEQ ID NO:4; the siRNA targeting TNF-α includes a sense strand and an antisense strand, wherein the sense strand sequence is shown in SEQ ID NO:5 and the antisense strand sequence is shown in SEQ ID NO:6; the siRNA targeting IL-6 includes a sense strand and an antisense strand, wherein the sense strand sequence is shown in SEQ ID NO:7 and the antisense strand sequence is shown in SEQ ID NO:8.

[0028] Preferably, in the needle tip system of Scheme A, the final concentration of tacrolimus is 1 mg / mL, the final concentration of the DNA tetrahedron linking the siRNA targeting TNF-α is 1 μM, the final concentration of methacrylamide gelatin is 4 wt%, the final concentration of carrageenan is 0.2 wt%, and the final concentration of sodium alginate is 0.2 wt%.

[0029] In the tip system of scheme B, the final concentration of tacrolimus was 0.1% (w / v), and the final concentration of the DNA tetrahedron linking the siRNA targeting IL-6 was 1 μM.

[0030] Preferably, in Scheme A, the photoinitiator is lithium phenyl (2,4,6-trimethylbenzoyl)phosphate, and the amount of photoinitiator used is 2.5-5% of the mass of methacrylamide gelatin; in Scheme B, the concentration of the polyvinyl alcohol aqueous solution is 4 wt%.

[0031] Preferably, in schemes A and B, 1 to 3 vacuum treatments are performed before the drying process, and the vacuum degree of the vacuum treatment is (8 to 9.5) × 10⁻⁶. -2 Each session lasts 1 to 2 minutes.

[0032] Preferably, in schemes A and B, the drying temperature is 22–35°C.

[0033] The third objective of this invention is to provide an application of the tacrolimus-siRNA dual-drug-loaded microneedle described above in the preparation of dressings for treating psoriasis or in the preparation of topical medicines for treating psoriasis.

[0034] The fourth objective of this invention is to provide a pharmaceutical and medical device composition for treating psoriasis, comprising a dual-drug-loaded microneedle containing tacrolimus and siRNA as described above.

[0035] The beneficial effects of this invention are as follows:

[0036] Based on existing psoriasis treatments, this application proposes for the first time to simultaneously load tacrolimus and TNF-α siRNA or IL-6 siRNA into a microneedle patch, and link the siRNA via DNA tetrahedrons, effectively solving the following problems:

[0037] 1) Tacrolimus is generally administered as an ointment, while TNF-αsiRNA or IL-6siRNA is generally administered by injection. This application prepares microneedles by co-loading the two drugs, so as to achieve the goal of releasing the two drugs in one microneedle patch, and treating psoriasis efficiently and safely.

[0038] 2) siRNA is an RNA interference technology that can knock down the expression of target genes in a sequence-specific manner by mediating the degradation of target mRNA. Reducing the expression of TNF-α or IL-6 through siRNA can decrease the inflammatory response, achieving therapeutic effects on psoriatic lesions and inflammation. However, the safety issues associated with long-term human use of siRNA delivery systems such as liposomes remain unresolved, and siRNA is unstable in vivo, easily leading to off-target effects. This application proposes a novel delivery system—DNA tetrahedrons—for siRNA delivery. DNA nanomaterials possess high designability, modifiability, biocompatibility, and biodegradability. Linking siRNA to DNA tetrahedrons offers advantages such as good biosafety and highly adjustable controlled release, while effectively overcoming the problem of siRNA's easy degradation in vivo.

[0039] 2) This application designs a novel DNA tetrahedron that can effectively prevent siRNA from being degraded in vivo and ultimately delivered to target cells.

[0040] 3) The choice of polymer material is related to the lightness and solubility of the microneedle material. In the tacrolimus and TNF-αsiRNA dual-drug loaded microneedles of this application, methacrylamide gelatin (GelMA) was specially selected as the polymer material. It is miscible with the tacrolimus and TNF-αsiRNA used in this application, and still has high mechanical strength after the drugs are dissolved, so as to maximize the uniformity and effectiveness of the microneedle preparation.

[0041] 4) Among the tacrolimus and TNF-αsiRNA dual-drug microneedles, tacrolimus has the best solubility in polyvinyl alcohol. Carrageenan and sodium alginate are two common natural polysaccharides with excellent anti-inflammatory and antibacterial activities, but their mechanical strength cannot meet the needs of practical applications. In this application, carrageenan, sodium alginate and methacrylamide gelatin are mixed, which not only improves the hardness of the microneedles, but also gives the microneedles a certain anti-inflammatory effect.

[0042] 5) The microneedles are simultaneously loaded with tacrolimus and either TNF-α siRNA or IL-6 siRNA, enabling the simultaneous delivery of two therapeutic drugs in a single microneedle patch. This solves the problems of frequent injections and high risk of disease transmission associated with existing tacrolimus treatments for psoriasis. Animal experiments have demonstrated that the combined use of these two drugs in microneedles has better therapeutic effects than microneedles loaded with tacrolimus alone. Attached Figure Description

[0043] Figure 1 The graph shows the solubility of tacrolimus in polymer solutions. Figure A shows the solubility of tacrolimus in four polymer solutions, from left to right: 4% PVA (clear), 10% PVP (slightly turbid), 5% GelMA (slightly turbid), 5% HAMA (slightly turbid), and 5% HA (turbid). Figure B shows the solubility of sodium alginate and carrageenan in four high-strength biomaterials, from left to right: 5% GelMA, 10% PVA, 10% PVP, and 5% HAMA. Figure C shows the solubility of tacrolimus in each solution in B, from left to right: Alg+L-car+ (5% GelMA, 10% PVA, 10% PVP, and 5% HAMA).

[0044] Figure 2 This is a schematic diagram of the connection of DNA tetrahedral loaded siRNA involved in this application.

[0045] Figure 3 The image shows the characterization results of the DNA tetrahedrons loaded with siRNA prepared in this application, where A is the DNA tetrahedron loaded with IL-6 siRNA and B is the DNA tetrahedron loaded with TNF-α siRNA.

[0046] Figure 4 To design a female mold microneedle array mold, A in the figure is a top view and B is a cross-sectional view.

[0047] Figure 5 The images show magnified microscopic images of the tacrolimus and TNF-αsiRNA dual-drug-loaded microneedles prepared in this application, where A is the overall image and B is a magnified image of the needle tip.

[0048] Figure 6 The images show magnified microscopic images of the tacrolimus and IL-6 siRNA dual-drug-loaded microneedles prepared in this application, where A is the overall image and B is a magnified image of the needle tip.

[0049] Figure 7 The results are transdermal tests of the dual-drug-loaded microneedles prepared in this application, where A is a dual-drug-loaded microneedle of tacrolimus and IL-6 siRNA, and B is a dual-drug-loaded microneedle of tacrolimus and TNF-α siRNA.

[0050] Figure 8The tip dissolution test was performed on the dual-drug-loaded microneedles prepared in this application, wherein A is a dual-drug-loaded microneedle of tacrolimus and IL-6 siRNA, and B is a dual-drug-loaded microneedle of tacrolimus and TNF-α siRNA.

[0051] Figure 9-13 The results of mouse trials using microneedles dual-drug delivery systems for tacrolimus and IL-6 siRNA are as follows. Figure 9 The condition of psoriasis on the backs of mice in different drug administration groups; Figure 10 The PASI scores of mice in different drug administration groups are shown in the figure. A represents the changes in erythema index, B represents the changes in scaling index, and C represents the changes in skin thickness index. Figure 11 Spleen index of mice in different drug administration groups; Figure 12 The histopathological observation of mouse skin tissue in different drug administration groups; Figure 13 The levels of IL-6(A) and TNF-α(B) in the serum of mice in different drug administration groups.

[0052] Figure 14-18 The results of mouse trials using microneedles containing tacrolimus and TNF-α siRNA dual-drug delivery systems are as follows. Figure 14 The condition of psoriasis on the backs of mice in different drug administration groups; Figure 15 The PASI scores of mice in different drug administration groups are shown in the figure. A represents the changes in erythema index, B represents the changes in scaling index, and C represents the changes in skin thickness index. Figure 16 Spleen index of mice in different drug administration groups; Figure 17 The histopathological observation of mouse skin tissue in different drug administration groups; Figure 18 The levels of IL-6(A) and TNF-α(B) in the serum of mice in different drug administration groups. Detailed Implementation

[0053] To facilitate understanding, the technical solution of the present invention will be described in more detail below with reference to the embodiments.

[0054] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this article can be purchased from the market or prepared by existing methods.

[0055] For ease of description, siRNA targeting TNF-α is called TNF-α siRNA, and siRNA targeting IL-6 is called IL-6 siRNA. The term "DNA tetrahedron loaded with siRNA" is used as a general term for DNA tetrahedra loaded with either TNF-α siRNA or IL-6 siRNA.

[0056] Example 1

[0057] Solubility test of tacrolimus in polymer solutions

[0058] 1. Test the clarity of five polymer materials after dissolution: polyvinyl alcohol (PVA), methacrylamide gelatin (GelMA), methacrylamide hyaluronic acid (HAMA), hyaluronic acid (HA), and polyvinylpyrrolidone (PVP).

[0059] Prepare solutions of the following polymer materials:

[0060] 1. 4% PVA: Accurately weigh 40 mg of polyvinyl alcohol, add 1 mL of deionized water, heat in a 70°C water bath and stir for one hour, then let it stand at room temperature for later use.

[0061] 2.5% GelMA: Accurately weigh 50 mg of methacrylamide gelatin into an EP tube, add 1 mL of PBS solution containing 0.25% LAP, heat in a 70°C water bath while stirring, and keep away from light until ready for use;

[0062] 3.5% HAMA: Accurately weigh 50 mg of methacrylamide hyaluronic acid, add 1 mL of PBS solution containing 0.25% LAP, heat in a 60°C water bath, and keep away from light until ready for use;

[0063] 4.5% HA: Accurately weigh 50mg of hyaluronic acid, add 1mL of deionized water, heat in a 50℃ water bath and stir for half an hour, then set aside for use;

[0064] 5. 10% PVP: Accurately weigh 100 mg of polyvinylpyrrolidone, add 1 mL of deionized water and shake until dissolved, then set aside for use;

[0065] The commonly used clinical concentration of tacrolimus is 0.1%. Accurately weigh 2 μL of 5% tacrolimus (5 mg tacrolimus dissolved in 100 μL of water) and add it to 98 μL of 4% PVA solution. Observe the clarity of the drug after dissolving in the polymer materials. Following the same method, weigh equal amounts of tacrolimus and add them to five other polymer materials, comparing the clarity of the tacrolimus solution in each. Figure 1 As shown in Figure A, the solution of tacrolimus dissolved in 4% PVA material is clear and transparent, indicating that it has the best solubility in 4% PVA material. To improve clinical treatment efficacy and increase the utilization rate of biomaterials, PVA was selected as the component for the final microneedle preparation.

[0066] 2. Test the solubility of tacrolimus in methacrylamide gelatin (GelMA) + carrageenan, GelMA + sodium alginate, and GelMA + carrageenan + sodium alginate.

[0067] First, a mixed solution of sodium alginate (Alg) and carrageenan (L-car) was prepared, and the solubility of the mixed solution with four high-strength biomaterials, namely methacryloyl gelatin (GelMA), methacryloyl hyaluronic acid (HAMA), polyvinyl alcohol (PVA), and polyvinylpyrrolidone (PVP), was investigated.

[0068] Prepare a mixed solution of several materials:

[0069] (1) 2% carrageenan: Accurately weigh 60mg L-car into an EP tube, add 3mL of double-distilled water, heat in a 60℃ water bath and stir, and set aside for use;

[0070] (2) 2% sodium alginate: accurately weigh 60 mg Alg into an EP tube, add 3 mL of double-distilled water, heat in a 60°C water bath and stir, and set aside for use;

[0071] (3) 5% GelMA: Accurately weigh 50 mg GelMA into an EP tube, add 1 mL of 0.25% LAP, heat in a 60°C water bath while stirring, and keep away from light until ready for use;

[0072] (4) 5% HAMA: Accurately weigh 50 mg HAMA into an EP tube, add 1 mL of 0.25% LAP, heat in a 60°C water bath while stirring, and keep away from light until ready for use;

[0073] (5) 10% PVA: Accurately weigh 100 mg PVA into an EP tube, add 1 mL of deionized water, heat in a 70°C water bath and stir, and set aside for use;

[0074] (6) 10% PVP: Accurately weigh 100 mg PVP into an EP tube, add 1 mL of deionized water, heat in a 70°C water bath and stir, and set aside for use;

[0075] 100 μL of mixed solutions of Alg, L-car, and the four high-strength biomaterials were prepared, with Alg and L-car each at a concentration of 10% and the four high-strength biomaterials at a concentration of 80%. Figure 1 As shown in Figure B, from left to right, the solutions are mixed solutions of Alg+L-car+GelMA, Alg+L-car+PVA, Alg+L-car+PVP, and Alg+L-car+HAMA. All four solutions are clear and transparent. Tacrolimus was dissolved in ethanol to a concentration of 5%. The final concentration of tacrolimus in the materials was 1 mg / mL; therefore, 2 μL of tacrolimus was added to each of the four mixtures. The mixtures containing tacrolimus were centrifuged for 30 seconds and then heated in a water bath to dissolve. Figure 1As shown in Figure C, all four tubes show varying degrees of suspension. The solution on the left, containing Alg+L-car+GelMA+TAC, exhibits the least and most uniform suspension. Therefore, this mixed material was chosen as the microneedle tip system.

[0076] Example 2

[0077] Preparation of DNA tetrahedra loaded with siRNA

[0078] TNF-α siRNA consists of a sense strand and an antisense strand:

[0079] Chain of Justice: TTCATACACC CGUCGUAGCAAACCACCAATT (SEQ ID NO:5) ansense chain: UUGGUGGUUUGCUACGACGTG (SEQ ID NO:6)

[0080] IL-6 siRNA consists of a sense strand and an antisense strand:

[0081] Chain of Justice: TTCATACACC The ansaurus of UUCUCCGAACGUGUCACGUTT (SEQ ID NO:7) is: ACGUGACACGUUCGGAGAATT (SEQ ID NO:8)

[0082] A DNA tetrahedron is composed of complementary bases S1, S2, S3, and S4 of a single-stranded DNA. The sequences of each strand in the DNA tetrahedron used to carry TNF-α siRNA or IL-6 siRNA are as follows.

[0083] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO: 1)

[0084] S2:ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG(SEQ ID NO:2)

[0085] S3: GGTGTATGAA ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC(SEQ ID NO:3)

[0086] S4: ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO: 4)

[0087] The underlined portion of S3 and the positive strand sequence above represents the complementary base pairing portion of the two strands. S1-S4 form a DNA tetrahedron through complementary base pairing. The design principle is as follows: Figure 2 As shown.

[0088] DNA tetrahedra loaded with siRNA (hereinafter referred to as TDN-siRNA) can be achieved through the following methods:

[0089] Step 1: Dilute six single-stranded DNAs: Centrifuge the primer tubes (1000–3000 rpm) for several minutes to allow the DNA to gather at the bottom of the tube. After adding an appropriate amount of double-distilled water, cap the tube, heat in a water bath, and vortex to mix thoroughly, ensuring the DNA is fully dissolved and the DNA stock solution concentration is approximately 100 μM. Further dilute to obtain a 10 μM working solution.

[0090] Step 2: Mix the six single strands in a stoichiometric ratio of 1:1:1:1:1:1. The mixed solution contains TM buffer (10 μM Tris-HCl pH = 8.0, 50 μM MgCl2), resulting in a final concentration of 1 μM for the six single strands. Anneal the siRNA in a PCR instrument using a 95℃ for 10 min followed by a 4℃ for 20 min annealing process to obtain TDN-siRNA.

[0091] The formed TDN-siRNA was characterized using 8% non-denaturing polyacrylamide gel electrophoresis (native PAGE), such as... Figure 3 As shown in Figures A and B, both the tetrahedral channel and the TDN-siRNA channel have clear and distinct bands at the corresponding positions on the ladder, indicating that TDN-siRNA was successfully synthesized.

[0092] Example 3

[0093] Preparation of dual-drug-loaded microneedles

[0094] 1. For the tacrolimus and TNF-α siRNA dual-load regimen, the following steps are included:

[0095] Step 1: Preparation of photoinitiator

[0096] Add 20 mL of PBS to 0.05 g of LAP (photoinitiator, lithium phenyl (2,4,6-trimethylbenzoyl)phosphate), and heat in a 35°C water bath for 15 min, shaking several times during the process, to obtain a 0.25% photoinitiator solution. The photoinitiator solution should be protected from light and stored at 4°C.

[0097] Step 2: Preparation of the needle tip system solution

[0098] Prepare a 600 μL microneedle solution system. Weigh 0.025 g of GelMA and dissolve it in 500 μL of LAP solution to obtain a 5% GelMA solution. Place the GelMA solution in a 70℃ water bath for later use. Weigh 0.002 g of carrageenan and dissolve it in 100 μL of double-distilled water to obtain a 2% carrageenan solution. Place the carrageenan solution in a 70℃ water bath for later use. Weigh 0.002 g of sodium alginate and dissolve it in 100 μL of double-distilled water to obtain a 2% sodium alginate solution. Place the sodium alginate solution in a 70℃ water bath for later use. Dissolve tacrolimus in ethanol to obtain a 5% tacrolimus solution.

[0099] Take 480 μL of GelMA, 60 μL of carrageenan, and 60 μL of sodium alginate to obtain a mixed material. Add 12 μL of tacrolimus and 60 μL of TDN-siRNA prepared in Example 2 to the mixed system to obtain a microneedle tip solution system.

[0100] Step 3: Preparation of dual-drug-loaded microneedles

[0101] Prepare a female microneedle array mold according to the designed microneedle shape. See Figure 4 In this embodiment, the microneedle array mold is made of polydimethylsiloxane. The microneedle dimensions are as follows: needle height 600μm, bottom diameter 300×300μm, needle tip distance 600μm, number array of 15×15, microneedle patch size 11.7×11.7mm, and groove depth 2mm.

[0102] The needle tip system was poured into the microneedle array mold. After the needle tip system was evenly dispersed, the mold was placed in a vacuum-sealed container, and a vacuum operation was performed with a vacuum degree of -0.089. The vacuum operation was repeated 3 times, with each vacuum operation lasting 1 minute. After defoaming, the solution was added until the microneedle mold was completely covered. The vacuuming, defoaming, and solution addition operation was repeated 3 times. The final solution addition was made until the liquid surface was slightly convex.

[0103] After curing the mold with ultraviolet light for 1 minute, it was placed in a 28°C oven to dry for 24 hours. The mold was then demolded to obtain the dual-drug-loaded microneedle patch.

[0104] The above demolding can be performed using existing demolding technologies. A typical demolding process involves attaching a 3M biofilm to the surface of the microneedle backing layer (i.e., the back side of the microneedles, the side without microneedles). The function of this membrane is to facilitate easy peeling of the microneedle array, preventing bending and breakage of the microneedles during the peeling process, and allowing for easy handling and placement. The microneedles are then separated from the mold to obtain the final product.

[0105] It should be emphasized that the microneedles are made by using a tip solution to prepare an integrated tip and backing. The additional tip solution should be added before the tip is completely dry. The curing and drying procedures can be adjusted according to the specific case.

[0106] The prepared dual-drug-loaded microneedles were observed under a microscope, such as... Figure 5 As shown in Figure A, the prepared microneedles are free of defects caused by air bubbles, exhibit uniform height, and have sharp and intact tips. Further characterization of the microneedles was performed using scanning electron microscopy, as shown below. Figure 5 As shown in Figure B, the microneedle tips are intact and the array is neat.

[0107] 2. For the tacrolimus and IL-6 siRNA dual-load regimen, the steps are as follows:

[0108] Step 1: Preparation of the needle tip system solution

[0109] Weigh 5 mg of tacrolimus powder into a 0.2 mL EP tube, add 100 μL of water (with a small amount of 75% ethanol to aid dissolution) until dissolved. The concentration of tacrolimus in the tacrolimus solution is 5% (w / v).

[0110] Weigh 8 mg of PVA precisely and place it in a 0.2 mL EP tube. Add 100 μL of water and stir until dissolved. The resulting solution is an 8% (w / v) PVA solution.

[0111] 100 μL of the 2 μm TDN-siRNA prepared in Example 2 and 4 μL of 5% tacrolimus were accurately measured and added to 100 μL of 8% PVA solution. The mixture was stirred until dissolved to obtain the microneedle tip system (denoted as Solution 1, S1). The concentration of tacrolimus in the system was 0.1% (w / v), the concentration of PVA was 5% (w / v), and the concentration of TDN-siRNA tetrahedrons was 1 μM.

[0112] Step 2: Prepare a 4 wt% polyvinyl alcohol aqueous solution as a backing solution;

[0113] Step 3: Preparation of dual-drug-loaded microneedles

[0114] Prepare a female microneedle array mold according to the designed microneedle shape. See Figure 4 In this embodiment, the microneedle array mold is made of polydimethylsiloxane (PDMS). The microneedle dimensions are as follows: needle height 600μm, bottom diameter 300×300μm, needle tip distance 600μm, number array of 15×15, microneedle patch size 11.7×11.7mm, and groove depth 2mm.

[0115] The prepared needle tip system solution was uniformly dispersed in a microneedle array mold. The mold was placed in a vacuum-sealed container, and a vacuum operation was performed with a vacuum degree of -0.089 for 2 minutes. Air bubbles generated on the liquid surface during the vacuuming process were removed, and liquid was continuously added until the microneedle mold was completely covered. The mold was then placed in a 28°C oven and dried for 4 hours. The mold was removed, and backing solution was added until it was flush with the mold surface. It was dried again for 5 hours, and then demolded to obtain the dual-drug-loaded microneedles.

[0116] The prepared dual-drug-loaded microneedles were observed under a microscope, such as... Figure 6 As shown in Figure A, the prepared microneedles exhibit excellent morphology, with sharp and intact tips. Further characterization of the microneedles was performed using scanning electron microscopy, as shown... Figure 6 As shown in Figure B, the microneedle tips are intact and the array is neat.

[0117] Example 4

[0118] Transdermal performance characterization of dual-drug-loaded microneedles

[0119] Fix the mouse, remove the hair on its back with a hair removal device, apply an appropriate amount of hair removal cream to the hair removal area, leave it for 30 seconds, and then wipe the hair removal cream completely clean with a damp cotton ball. Apply a small amount of hair removal cream to the area where the hair was not completely removed, leave it for 10 seconds, wipe it completely clean with a damp cotton ball, and then dry the skin on the back with a dry cotton ball.

[0120] Mice were euthanized by cervical dislocation, and the skin on their backs was cut off and fully spread and fixed with a needle. Double-sided tape was attached to one side of a hammer, and then microneedles were attached. Using a force of about 10N, the two types of dual-drug-loaded microneedles prepared in Example 3 were pressed vertically onto the skin and held in place for 3 minutes. After removing the hammer, the pressed areas were stained with methylene blue, left for about 1 minute, and then washed off.

[0121] like Figure 7 The image shows the transdermal performance of two types of dual-drug-loaded microneedles. The microneedle array is clear and complete, indicating that both designs have high mechanical strength after drug loading and good transdermal performance, meeting the application requirements.

[0122] Example 5

[0123] Tip dissolution test of dual drug-loaded microneedles

[0124] The dual-drug-loaded microneedles prepared in Example 4 were cut into 3-4 pieces, each containing two rows of arrays. Skin from the back of a mouse was taken, and a sealing film was used instead of double-sided tape to extend and adhere to one end of a hammer. One microneedle was gently placed on the mouse's back skin, and immediately pressed vertically with the hammer. After pressing for 5 minutes, the hammer was removed, the microneedle was taken off, and it was attached parallel to the side of the 96-well plate cap with double-sided tape for subsequent observation. Subsequently, microneedle patches were obtained after pressing for 10 minutes, 15 minutes, and 20 minutes, respectively, using the same method.

[0125] Microneedle patches dissolved at different times were observed under an upright fluorescence microscope, such as... Figure 8 As shown in Figures A and B, both types of microneedles basically dissolved after 20 minutes.

[0126] Example 6

[0127] The therapeutic effect of tacrolimus and IL-6 siRNA dual-drug micro-targets on an imiquimod-induced mouse psoriasis model

[0128] 1. Establishment and grouping of a mouse psoriasis model for drug administration

[0129] Thirty 6-week-old male BALB / c mice were used as experimental animals. These mice were randomly divided into six groups of five mice each: control group, model group, positive control group, tacrolimus-loaded microneedle group, IL-6 siRNA-loaded microneedle group, and dual-drug-loaded microneedle group. The treatment method was as follows: The back hair of the mice was shaved to create a hairless area of ​​approximately 3*3 cm. After shaving, the skin was gently cleaned with physiological saline to ensure no hair residue remained.

[0130] Control group: Apply petroleum jelly ointment daily for nine consecutive days;

[0131] Model group: Apply 5% imiquimod ointment to the shaved area at the same time every day for five consecutive days, and apply petroleum jelly to the shaved area from day 6 to day 9;

[0132] Positive control group: Mice were shaved and 5% imiquimod ointment was applied to the shaved area at the same time every day for five consecutive days. Tacrolimus ointment was applied on days 6-9, once a day at a concentration of 0.1 mg / mL, 0.1 mL / time.

[0133] Tacrolimus-loaded microneedle group: After shaving the hair of mice, 5% imiquimod ointment was applied to the shaved area at the same time every day for five consecutive days. On days 6-9, tacrolimus-loaded microneedles (prepared using the same microneedle preparation method as in Example 3, but without IL-6 siRNA) were administered to each mouse. The microneedles were applied for 10 minutes until the tip of the needle was completely dissolved.

[0134] IL-6 siRNA-only group: After shaving the hair of mice, 5% imiquimod ointment was applied to the shaved area at the same time every day for five consecutive days. On days 6-9, IL-6 siRNA-only microneedles (prepared using the same microneedle preparation method as in Example 3, but without tacrolimus) were administered to each mouse. During administration, the microneedles were pressed for 10 minutes until the tip of the needle was completely dissolved.

[0135] Dual-drug-loaded microneedle group: After the mice were shaved, 5% imiquimod ointment was applied to the shaved area at the same time every day for five consecutive days. Dual-drug-loaded microneedles (prepared in Example 3) were administered to each mouse on days 6-9. Each mouse was given the microneedles for 10 minutes until the tip of the needle was completely dissolved.

[0136] 2. Observation of mouse psoriasis model and PASI score

[0137] The extent of damage to the backs of mice in each group was observed visually, such as... Figure 9 As shown, psoriasis improved to varying degrees in all treatment groups during the treatment period. The PASI score was calculated daily during drug administration and model establishment. The PASI score includes skin thickness, psoriasis condition, and erythema condition. In the evaluation of the psoriasis lesion area and severity index, a higher score indicates more severe psoriasis symptoms. Figure 10 As shown in the AC diagram, compared with the normal group mice, the PASI score of the model group mice remained elevated for 7 days after modeling. Compared with the model group mice, the PASI scores of mice in all treatment groups decreased after drug administration. Among them, the PASI score of mice in the dual-load microneedle drug administration group decreased more significantly and the treatment effect was better, and the difference was statistically significant.

[0138] 3. Mouse body weight and spleen index

[0139] (1) Mouse body weight was measured before the start of the experiment (day 0) and after each day of drug treatment using an electronic balance accurate to 0.01 g. Mice were placed on the electronic balance, and the weight of each mouse was measured and recorded separately. The change in body weight on day 10 relative to day 0 was calculated. Compared with the normal group mice, the body weight of the model group mice continued to decrease. Compared with the model group mice, the body weight of mice in each drug treatment group gradually decreased during the modeling period, and the body weight of mice gradually recovered during the drug treatment period, reaching a level close to that of the same day 0 mouse on day 10.

[0140] (2) On the 10th day, all mice were euthanized. On the same day, the spleens of the mice were removed and weighed.

[0141] Spleen index = Spleen mass of mouse (mg) / Body weight of mouse (g)

[0142] like Figure 11The results showed that the spleen index of the model group mice was significantly increased compared with the normal group mice. Compared with the model group mice, the spleen index of each drug-treated group mice was decreased to varying degrees. This indicates that the spleen volume of psoriatic mice treated with the drug decreased; there was no difference in spleen size between the drug-loaded microneedle group and the TAC ointment treatment group, indicating that the microneedle group had a significant therapeutic effect.

[0143] 4. Histopathological observation and scoring of mouse skin tissue

[0144] At the end of the experiment (day 10), mice were anesthetized and euthanized, and skin tissue was harvested. The skin tissue was immediately placed in 4% paraformaldehyde for dehydration, paraffin embedding, sectioning, and HE staining. HE-stained sections were observed and photographed under a microscope to record pathological changes in the skin tissue. The vertical distance from the stratum corneum to the basal layer of the epidermis was randomly measured at three points from each section to analyze the epidermal thickening.

[0145] like Figure 12 As shown, compared with the normal group mice, the model group mice exhibited significantly thickened epidermis, angiogenesis, inflammatory cell infiltration, incomplete and hyperkeratosis, thinning of the granular layer, and thickening and irregular elongation of the acanthosis. Compared with the model group mice, all drug-treated groups showed varying degrees of improvement in the above pathological changes.

[0146] 5. ELISA detection of serum IL-6 and TNF-α

[0147] At the end of the experiment (day 10), blood was collected from the eyes of all mice, centrifuged, and serum was obtained. Following the reagent manufacturer's instructions, the sample was added to the wells of an ELISA plate. After the colorimetric reaction stopped, dual-wavelength detection was performed using a microplate reader, with the detection wavelength set to 450 nm and the reference wavelength to 610 nm. The concentrations of IL-6 and TNF-α in the sample were calculated.

[0148] like Figure 13 As shown, compared with the normal group mice, the expression of IL-6 and TNF-α in the serum of the model group mice was significantly increased, and the difference was statistically significant. Compared with the model group, the expression of IL-6 and TNF-α in the serum of the two single-loaded microneedle administration groups, the dual-loaded microneedle administration group, and the TAC ointment treatment group was significantly decreased, and the differences were statistically significant. This shows that dual-loaded microneedles have a better therapeutic effect.

[0149] Example 8

[0150] The therapeutic effect of tacrolimus and TNF-αsiRNA dual-drug micro-targets on an imiquimod-induced mouse psoriasis model

[0151] 1. Establishment and grouping of a mouse psoriasis model for drug administration

[0152] Forty-eight 6-week-old male BALB / c mice were used as experimental animals. These mice were randomly divided into six groups of eight mice each: control group, model group, positive control group, single-drug-loaded microneedle group 1 (containing only tacrolimus), single-drug-loaded microneedle group 2 (containing only TDN-siRNA), and dual-drug-loaded microneedle group. The treatment method was as follows: The back hair of the mice was shaved to create a hairless area of ​​approximately 3*3 cm. After shaving, the skin was gently cleaned with physiological saline to ensure no hair residue remained.

[0153] Control group: Apply petroleum jelly ointment daily for nine consecutive days;

[0154] Model group: Apply 5% imiquimod ointment to the shaved area at the same time every day for five consecutive days, and apply petroleum jelly to the shaved area from day 6 to day 9;

[0155] Positive control group: Mice were shaved and 5% imiquimod ointment was applied to the shaved area at the same time every day for five consecutive days. Tacrolimus ointment was applied on days 6-9, once a day at a concentration of 0.1 mg / mL, 0.1 mL / time.

[0156] Tacrolimus-loaded microneedle group: After shaving the hair of mice, 5% imiquimod ointment was applied to the shaved area at the same time every day for five consecutive days. On days 6-9, tacrolimus-loaded microneedles (prepared using the same microneedle preparation method as in Example 3, but without TDN-siRNA) were administered to each mouse. During administration, the microneedles were pressed for 10 minutes until the tip of the needle was completely dissolved.

[0157] TNF-α siRNA-loaded group: After shaving the hair of mice, 5% imiquimod ointment was applied to the shaved area at the same time every day for five consecutive days. On days 6-9, TNF-α siRNA-loaded microneedles (prepared using the same microneedle preparation method as in Example 3, but without tacrolimus) were administered to each mouse. During administration, the microneedles were pressed for 10 minutes until the tip of the needle was completely dissolved.

[0158] Dual-drug-loaded microneedle group: After the mice were shaved, 5% imiquimod ointment was applied to the shaved area at the same time every day for five consecutive days. Dual-drug-loaded microneedles (prepared using the same microneedle preparation method as in Example 3) were administered to mice on days 6-9. Each mouse pressed the microneedle for 10 minutes until the tip of the needle was completely dissolved.

[0159] 2. Observation of mouse psoriasis model and PASI score

[0160] The extent of damage to the backs of mice in each group was observed visually, such as... Figure 14As shown, psoriasis improved to varying degrees in all treatment groups during the treatment period. Patients were scored daily during drug administration and model establishment, and PASI scores were calculated. PASI scores include skin thickness, psoriasis condition, and erythema condition. In the evaluation of psoriasis lesion area and severity index, a higher score indicates more severe psoriasis symptoms. Figure 15 As shown in the AC diagram, compared with the normal group mice, the PASI score of the model group mice remained elevated for 7 days after modeling. Compared with the model group mice, the PASI scores of mice in all treatment groups decreased after drug administration. Among them, the PASI score of mice in the dual-load microneedle drug administration group decreased more significantly and the treatment effect was better, and the difference was statistically significant.

[0161] 3. Mouse body weight and spleen index

[0162] (1) Mouse body weight was measured before the start of the experiment (day 0) and after each day of drug treatment using an electronic balance accurate to 0.01 g. Mice were placed on the electronic balance, and the weight of each mouse was measured and recorded separately. The change in body weight on day 10 relative to day 0 was calculated. Compared with the normal group mice, the body weight of the model group mice continued to decrease. Compared with the model group mice, the body weight of mice in each drug treatment group gradually decreased during the modeling period, and the body weight of mice gradually recovered during the drug treatment period, reaching a level close to that of the same day 0 mouse on day 10.

[0163] (2) On the 10th day, all mice were euthanized. On the same day, the spleens of the mice were removed and weighed.

[0164] Spleen index = Spleen mass of mouse (mg) / Body weight of mouse (g)

[0165] like Figure 16 As shown, the spleen index of the model group mice was significantly increased compared with the normal group mice. Compared with the model group mice, the spleen index of each drug-treated group mice was decreased to varying degrees. This indicates that the spleen volume of psoriatic mice treated with the drug is reduced; there was no difference in spleen size between the single-drug-loaded microneedle group and the TAC ointment group, while the dual-drug-loaded microneedle group showed a significant therapeutic effect.

[0166] 4. Histopathological observation and scoring of mouse skin tissue

[0167] At the end of the experiment (day 10), mice were anesthetized and euthanized, and skin tissue was harvested. The skin tissue was immediately placed in 4% paraformaldehyde for dehydration, paraffin embedding, sectioning, and HE staining. HE-stained sections were observed and photographed under a microscope to record pathological changes in the skin tissue. The vertical distance from the stratum corneum to the basal layer of the epidermis was randomly measured at three points from each section to analyze the epidermal thickening.

[0168] like Figure 17As shown, compared with the normal group mice, the model group mice exhibited significantly thickened epidermis, angiogenesis, inflammatory cell infiltration, incomplete and hyperkeratosis, thinning of the granular layer, and thickening and irregular elongation of the acanthosis. Compared with the model group mice, all drug-treated groups showed varying degrees of improvement in the above pathological changes.

[0169] 5. ELISA detection of serum IL-6 and TNF-α

[0170] At the end of the experiment (day 10), blood was collected from the eyes of all mice, centrifuged, and serum was obtained. Following the reagent manufacturer's instructions, the sample was added to the wells of an ELISA plate. After the colorimetric reaction stopped, dual-wavelength detection was performed using a microplate reader, with the detection wavelength set to 450 nm and the reference wavelength to 610 nm. The concentrations of IL-6 and TNF-α in the sample were calculated.

[0171] like Figure 18 As shown, compared with the normal group mice, the expression of IL-6 and TNF-α in the serum of the model group mice was significantly increased, and the difference was statistically significant. Compared with the model group, the expression of IL-6 and TNF-α in the serum of the two single-loaded microneedle administration groups, the dual-loaded microneedle administration group, and the TAC ointment treatment group was significantly decreased, and the differences were statistically significant. This shows that dual-loaded microneedles have a better therapeutic effect.

[0172] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A dual-drug-loaded microneedle for tacrolimus combined with siRNA, comprising a backing portion and a needle tip disposed on one side of the backing portion, characterized in that, The needle tip consists of tacrolimus, siRNA targeting TNF-α, methacrylamide gelatin, carrageenan, and sodium alginate, and the components are mixed and cured to obtain the needle tip. The siRNA targeting TNF-α is linked to a DNA tetrahedron via complementary base pairing. The DNA tetrahedron is composed of complementary bases S1, S2, S3, and S4 of single-stranded DNA. The S1 sequence is shown in SEQ ID NO:1, the S2 sequence in SEQ ID NO:2, the S3 sequence in SEQ ID NO:3, and the S4 sequence in SEQ ID NO:

4. The siRNA targeting TNF-α includes a sense strand and an antisense strand. The sense strand sequence is shown in SEQ ID NO:5, and the antisense strand sequence is shown in SEQ ID NO:

6. The preparation method of dual-drug-loaded microneedles includes the following steps: S1. Prepare a negative mold microneedle array mold based on the designed microneedle patch; S2. Preparation of the tip system: Methacrylamide gelatin, carrageenan and sodium alginate are mixed in proportion and heated to dissolve to obtain a base solution; DNA tetrahedral material is prepared, wherein the DNA tetrahedral material is linked to the siRNA targeting TNF-α; tacrolimus, DNA tetrahedral material and base solution are then mixed in a set proportion to obtain the desired tip system; S3. Assembly: Add the needle tip system solution to the negative mold microneedle array mold and fill the needle tip part of the negative mold microneedle array mold. After UV curing, continue to add the needle tip system until the backing part of the negative mold microneedle array mold is filled. Dry for at least 24 hours, demold, and obtain the desired dual drug-loaded microneedles.

2. The dual-drug-loaded microneedle of tacrolimus and siRNA according to claim 1, characterized in that, The backing portion has dimensions of (10~15)×(10~15) mm, and the needle tip is located at the center of the backing portion, including microneedles arranged in a 15×15 array. The needle height of the microneedles is 500~800 μm, and the distance between adjacent needle tips is 600~800 μm.

3. The dual-drug-loaded microneedle of tacrolimus and siRNA according to claim 1, characterized in that, The method for preparing DNA tetrahedra linked to siRNA targeting TNF-α is as follows: the siRNA targeting TNF-α and the DNA strands constituting the DNA tetrahedra are diluted to 10 μM working solutions, and the working solutions are mixed at a stoichiometric ratio of 1:1 and annealed in a PCR instrument to obtain the desired DNA tetrahedra linked to siRNA targeting TNF-α.

4. The dual-drug-loaded microneedle of tacrolimus and siRNA according to claim 3, characterized in that, In the needle tip system, the final concentration of tacrolimus is 1 mg / mL, the final concentration of the DNA tetrahedron linking the siRNA targeting TNF-α is 1 μM, the final concentration of methacrylamide gelatin is 4 wt%, the final concentration of carrageenan is 0.2 wt%, and the final concentration of sodium alginate is 0.2 wt%. The photoinitiator is lithium phenyl (2,4,6-trimethylbenzoyl)phosphate, and the amount of photoinitiator used is 2.5-5% of the mass of methacrylamide gelatin.

5. The dual-drug-loaded microneedle of tacrolimus and siRNA according to claim 1, characterized in that, Before drying, 1 to 3 vacuum treatments are performed, with a vacuum degree of (8 to 9.5) × 10⁻⁶. -2 The drying time is 1-2 minutes per cycle; the drying temperature is 22-35℃.

6. The use of a dual-drug-loaded microneedle of tacrolimus and siRNA as described in claim 1 or 2 in the preparation of dressings for treating psoriasis or in the preparation of topical medicines for treating psoriasis.

7. A pharmaceutical device composition for treating psoriasis, comprising a dual-drug-loaded microneedle of tacrolimus and siRNA as described in claim 1 or 2.

Images