Annular RNA (Ribonucleic Acid)-based spot type in-vivo in-situ CAR (Chimeric Antigen Receptor) and tumor vaccine combined immunotherapy technology and application thereof

Abstract

The invention discloses a combined treatment strategy of in-vivo in-situ CAR (Chimeric Antigen Receptor) immunotherapy and a cancer vaccine based on circular RNA (Ribonucleic Acid), which is the first novel tumor immunotherapy which combines an in-vivo in-situ CAR-T / M technology based on circular RNA and a circular RNA cancer vaccine technology, and the technology can be used for rapidly and efficiently generating CAR-T / M cells in vivo; and under the clamping action of a corresponding circular RNA cancer vaccine, a synergistically enhanced anti-tumor immunotherapy effect is further generated. Besides, the specific non-complementary region of the I-type intron from tetrahymena is split, and the in-vitro efficient cyclization of RNA can be realized through the self-splicing of the I-type intron under the conditions of no homologous arm and no additional GTP catalysis.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to an off-the-shelf in-situ CAR combined with a tumor vaccine in vivo based on circular RNA for immunotherapy technology and its application. Background Art

[0002] The tumor microenvironment (TME) is a complex comprehensive system formed by the interaction of tumor cells with surrounding tissues and immune cells. The immune cells in the tumor microenvironment mainly include T lymphocytes, B lymphocytes, NK cells, macrophages, DC cells, etc. T lymphocytes play a major role in tumor immunity and mainly kill tumor cells. However, due to the immunosuppressive effect of the tumor microenvironment and the immune escape mechanism of tumor cells, they often evade the killing effect of T cells and then proliferate rapidly. Therefore, anti-tumor drugs targeting the reactivation of T cell immune responses have always been crucial in the field of biomedicine. In addition, through single-cell sequencing, it is found that in the tumor microenvironment, the immune cells with a relatively large number are tumor-associated macrophages (TAM), and most of them are M2 type that promotes tumor growth. Some studies have shown that in breast cancer, the proportion of M2 type TAM in the tumor microenvironment is more than 50%. Therefore, reprogramming macrophages in the tumor microenvironment to promote their polarization into anti-tumor M1 type macrophages and enhancing the phagocytosis of macrophages have gradually received the favor of many researchers in recent years.

[0003] The concept of CAR (Chimeric antigen receptor) was first proposed by scientist G. Gross (G. Gross et al., Proc Natl Acad Sci USA, 1989) in 1989. Developed to date, the CAR-T (Chimeric antigen receptor T cell) therapy, which transduces CAR molecules into T cells in vitro by genetic engineering means, has become an important immunotherapy and has been approved for clinical treatment of leukemia and lymphoma. Along with the remarkable effects achieved by CAR-T in the treatment of clinical hematological tumors, more and more research and resources have started to tilt towards CAR technology. Currently, the research on CAR technology mainly focuses on the optimization of CAR-T technology and the application of CAR technology in other cells to target the treatment of different diseases. CAR is mainly composed of three parts: an extracellular region, a transmembrane region, and an intracellular region. The extracellular region is often a single-chain antibody (Single-Chain Fragment Variable, scFv), which is responsible for recognizing and binding to the target antigen; the transmembrane region is mostly a hinge region, playing an anchoring role; the intracellular region consists of a co-stimulatory factor and a signal transduction domain. Researchers reprogram T cells through CAR technology to make T cells express tumor-associated antigen receptors, thereby exerting the targeted anti-tumor effect of T cells. In 2008, institutions such as the Fred Hutchison Cancer Research Institute first used CAR-T technology to treat B-cell lymphoma.

[0004] To date, CAR-T therapy has become an important immunotherapy and has been approved for clinical treatment of leukemia and lymphoma. Currently, there are approximately 6 CAR-T drugs approved for marketing, but their indications are all hematological tumors. In solid tumors, due to the immunosuppressive effect of the tumor microenvironment, the treatment effect of CAR-T is not ideal. In recent years, more and more research and resources have started to tilt towards CAR technology. Currently, the research on CAR technology mainly focuses on the optimization of CAR-T technology and the application of CAR technology in other immune cells such as NK cells and macrophages to target the treatment of different diseases.

[0005] Circular RNAs (circRNAs) are a class of single-stranded RNAs without 5'-caps and 3'-poly(A) tails, which form closed circular topological structures through covalent bonds. Due to their circular structures, they are protected from nuclease degradation and thus have high stability. For some time after their discovery, circular RNAs were considered rare and non-functional aberrant splicing by-products. However, in the past decade, there has been a fundamental shift in the view that circular RNAs are prevalent and functionally important molecules in biology. This is largely attributed to the emergence of RNA-seq technology, which has revealed the widespread presence and evolutionary conservation of circular RNAs in eukaryotes. Circular RNAs have specific biological functions in terms of RNA ligands, miRNA sponges, protein sponges, antisense circular molecules, innate immune activators, innate immune inhibitors, protein translation, and biomarkers.

[0006] In organisms, pre-mRNAs are spliced into mRNAs after the removal of introns. This is achieved by the spliceosome acting on the 5'- and 3'-splice sites of introns, resulting in the splicing of introns and the ligation of exons to form mRNAs, namely forward splicing. However, most circular RNAs produced in organisms are not generated through forward splicing but by back splicing. Back splicing does not occur at the two ends of introns but at the two ends of exons (i.e., the 3'-end of the first intron and the 5'-end of the second intron). This splicing event circularizes the exons to form circular RNAs.

[0007] Due to their high stability, the application of circular RNAs in nucleic acid drugs has attracted attention, especially in the in vitro preparation of circular RNAs. The current methods mainly include: one is chemical synthesis, which involves the synthesis and ligation of special nucleotide derivatives; the second is the ligation of the ends of linear RNAs catalyzed by nucleic acid ligases; the third is based on the self-splicing properties of intron ribozymes to ligate the ends of linear RNAs.

[0008] Nucleic acid drugs are another type of drug that has been extensively studied after small molecule drugs and protein drugs. Driven by linear RNAs, circular RNAs have witnessed great development. Endogenous circular RNAs can serve as new drug targets or biomarkers for disease diagnosis, while artificially prepared circular RNAs can target multiple targets and exert functions within cells. Currently, circular RNAs have made significant breakthroughs in the fields of infectious vaccines, tumor vaccines, CAR-T, protein replacement therapy, gene editing, etc. Therefore, the preparation of circular RNAs is crucial for their applications.

[0009] Cancer vaccines have been one of the research hotspots in recent years. Their principle is to introduce tumor antigens into the patient's body in various forms, such as tumor cells, tumor-associated proteins or polypeptides, genes expressing tumor antigens, etc., to overcome the immunosuppressive state caused by tumors, enhance immunogenicity, activate the patient's own immune system, and induce cellular and humoral immune responses in the body, so as to achieve the purpose of controlling or eliminating tumors. Using genetic engineering technology, the gene encoding tumor-specific antigen is loaded onto a recombinant viral vector or plasmid DNA and directly injected into the human body. With the help of the vector itself or the human gene expression system, it can continuously induce specific humoral and cellular immunity, which is an incomparable advantage of genetic engineering vaccines compared with other cancer vaccines, and thus has become a research hotspot in cancer biotherapy.

[0010] Using circular RNA for the preparation of in vivo in situ CAR and cancer vaccines and combining them to amplify the immune effect is a new technology development. In view of this, the present invention is proposed. Summary of the Invention

[0011] To solve the above technical problems, the present invention provides a therapeutic drug containing a disease antigen and / or a CAR molecule. First, the circular RNA drug prepared from a ribonucleic acid construct containing a CAR enters the body through a targeting delivery vector to generate in situ CAR, which is an "off-the-shelf" immunotherapy. The targeted immune cells include T cells, macrophages, natural killer cells, neutrophils, γδ T cells, etc., and engineered immune cells are generated in situ. Second, the cancer vaccine prepared from a ribonucleic acid construct containing a tumor antigen specifically stimulates T cells to produce tumor-specific T cells to achieve immunotherapy. Third, the circular RNA drug containing a CAR and the cancer vaccine containing an antigen are used in combination, and good therapeutic effects can be achieved without the addition of adjuvants.

[0012] The first object of the present invention is to provide a circular RNA-based drug, and the drug includes at least one of the following:

[0013] (1) A ribonucleic acid construct with an antigen as the target gene;

[0014] (2) A ribonucleic acid construct with a chimeric antigen receptor as the target gene;

[0015] The ribonucleic acid construct contains the following elements from the 5' end to the 3' end:

[0016] Partial P9 region and P10 region of type I intron containing a 3' cleavage site (the target cleavage site contains ωG),

[0017] Target gene,

[0018] The P1-P8 regions and part of the P9 region of the group I intron containing the 5' splice site (there is a U:G pairing between the target splice site and the IGS);

[0019] The group I intron contains 10 paired double-helix regions P1-P10 from the 5' end to the 3' end. The above elements are obtained by splitting the group I intron, and the splitting is to split the group I intron into two fragments at the non-complementary region or adjacent non-complementary region near the 9th helix region P9 close to the 3' end.

[0020] Preferably, the drug is a combined drug, that is:

[0021] The present invention provides an anti-tumor product, and the anti-tumor product includes a container containing the following independently packaged preparations: a preparation containing a ribonucleic acid construct with a chimeric antigen receptor as the target gene; a preparation containing a ribonucleic acid construct with an antigen (tumor antigen) as the target gene.

[0022] Furthermore, when the drug is a combined drug, the ribonucleic acid construct containing the chimeric antigen receptor is injected into the tumor, and the ribonucleic acid construct containing the antigen is injected intramuscularly.

[0023] Furthermore, in the ribonucleic acid construct with an antigen as the target gene, an EPM-EABR sequence is connected to the end of the antigen, preferably the C-terminus.

[0024] Furthermore, the antigen can be a tumor antigen, including an antigen containing a B cell epitope or a T cell epitope.

[0025] Furthermore, the ribonucleic acid construct prepares a circular RNA drug to enter the body through a liposome delivery vector to generate neutralizing antibodies and T cell immune responses, and is characterized in preparing vaccines for anti-infectious diseases and anti-tumor.

[0026] Furthermore, the sequences of part of the P9 region and the P10 region of the group I intron containing the 3' splice site are as shown in SEQ ID NO.1.

[0027] Furthermore, the sequences of the P1-P8 regions and part of the P9 region of the group I intron containing the 5' splice site are as shown in SEQ ID NO.3.

[0028] Furthermore, the ribonucleic acid construct is codon-optimized or not.

[0029] Furthermore, the schematic diagram of the secondary structure of the group I intron is shown in Figure 1 , and the specific sites of the complementary regions and non-complementary regions of P1-P10 are shown in Figure 2 .

[0030] Furthermore, it includes modifications to the complementary regions of P1 - P10, and the modifications include one or more of addition, deletion, and mutation.

[0031] Furthermore, it includes modifications to the non - complementary regions of P1 - P10, and the modifications include one or more of addition, deletion, and mutation.

[0032] Furthermore, the ribonucleic acid construct may optionally include one or more of homology arms that promote cyclization and expression, RNA triplex, spacer sequences, and UTR sequences.

[0033] Furthermore, the homology arms are located on the extended arms of the complementary regions of P1 - P10, or at the 5' end of the split 3' intron and the 3' end of the 5' intron. Preferably, the length of the homology arms in the ribonucleic acid construct is 1 - 400 nt.

[0034] Furthermore, the RNA triplex is located between P1 and P10.

[0035] Furthermore, the spacer sequence contains a polyA sequence or a polyA - C sequence.

[0036] Furthermore, the target gene includes a sequence for initiating translation and a coding sequence (encoding CAR, antigen, etc.).

[0037] Furthermore, the sequence for initiating translation in the ribonucleic acid construct includes one or more of an IRES sequence, an m6A motif, a CITE sequence, and a kozak sequence.

[0038] Furthermore, the sequence of the ribosome entry site is as shown in SEQ ID NO.2.

[0039] The second object of the present invention is to provide a preparation method of the above - mentioned drug, including the following steps: subjecting the ribonucleic acid construct linked with a tumor antigen and / or a chimeric antigen receptor to IVT, DNase I treatment, RNase R treatment, HPLC, and CIP treatment, and finally purifying and enriching to obtain circular RNA.

[0040] Furthermore, modified nucleotides are added during the process of preparing the ribonucleic acid construct into circular RNA, and the proportion is 0% - 100%.

[0041] Furthermore, the circular RNA prepared from the ribonucleic acid construct is transfected into cells to express the target protein.

[0042] The beneficial effects of the present invention:

[0043] The present invention uses circular RNA as a CAR molecule expression vector for in vivo in situ treatment of diseases, which is an "off-the-shelf" new immunotherapy. Compared with traditional adoptive CAR-T cell therapy, it does not require extraction of patients' T-cells for transduction and amplification in vitro, has low cost and simple operation, greatly saving medical resources; uses targeted LNP as a transport vector, which can target a variety of specific cells, transiently express CAR molecules in a large number of macrophages in solid tumors, and can also produce effective therapeutic effects on solid tumors, breaking through the limitation of the existing adoptive CAR-T cell therapy that is only effective for some hematological tumors; when treating with the present invention, there is no need to perfuse a large amount of CAR-T cells, avoiding the related toxic effects caused by the perfusion of a large number of T cells in a short time.

[0044] Using circular RNA as a CAR molecule vector has the advantages of reversibility and controllability. It can directly translate proteins and perform functions in the cytoplasm without the need to be transported into the nucleus, and there is no safety risk of integration into genomic DNA.

[0045] Compared with mRNA, circular RNA is more stable as a CAR molecule vector, is not easily degraded, and can produce higher levels and more stable expression in vivo.

[0046] The present invention prepares circular RNA based on group I intron splicing, solves the circularization of large molecular RNA, and removes the limitation of molecular size.

[0047] Compared with the existing ribozyme self-splicing mechanism for preparing circular RNA, the present invention has a high circularization efficiency without additional addition of GTP, and has less residual linear precursor (RNA precursor). The processing steps are relatively reduced, which is beneficial to industrial preparation.

[0048] The exogenous sequence introduced by the group I intron of Tetrahymena used in the present invention is much less than that of the existing group I intron, so the innate immunogenicity can be reduced and the expression level can be increased.

[0049] The present invention uses the group I intron of Tetrahymena to achieve efficient circularization without the need to add homologous arm sequences.

[0050] The present invention has created a new method for splitting the group I intron structure, and achieved the preparation of circular RNA by splitting in the non-complementary region of P9. Applying it to the non-complementary regions of different domains P1-P10 of the group I intron can also achieve the circularization of RNA.

[0051] The present invention combines the "off-the-shelf" new immunotherapy with tumor vaccines, which is a new technical strategy. The two complement each other and multiply expand the immune effect of the body. Brief Description of the Drawings

[0052] Figure 1 It is a schematic diagram of the secondary structure of Tetrahymena type I intron.

[0053] Figure 2 It is a method (STS-P9 cyclization method) for in vitro cyclization by splitting based on specific non-complementary regions of Tetrahymena type I introns.

[0054] Figure 3 It is CircRNA CAR Experimental results of expressing CAR protein on the membranes of T cells and macrophages (Note: CircRNA CAR is cyclized by the PIE method).

[0055] Figure 4 It is CircRNA CAR Experimental results showing that macrophages transfected with CircRNA CAR exhibit effective tumor phagocytosis and pro-inflammatory polarization in vitro (Note: CircRNA

[0056] Figure 5 It is macrophages transfected with CircRNA CAR and T cells show effective tumor killing in vitro (Note: CircRNA CAR is cyclized by the PIE method).

[0057] Figure 6 It is LNP-circRNA Anti-HER2-CAR Experimental results showing significant inhibition of tumor growth and increased survival rate in mice (Note: CircRNA CAR is cyclized by the PIE method).

[0058] Figure 7 It is CircRNA Anti-HER2-CAR combined with CircRNA HER2-EPM-EABR Vaccine shows experimental results of synergistically enhanced anti-tumor immunotherapy effect in tumor-bearing mice (Note: CircRNA CAR is cyclized by the PIE method). Detailed implementation manners

[0059] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the specific embodiments cited are not intended to limit the present invention.

[0060] Example 1

[0061] (1)Design and construction of the CircRNA-STS-P9 structure: It contains a T7 promoter, a 3' intron, a kozak sequence, a target gene, an IRES, and a 5' intron;

[0062] (2)Design and construction of the CAR structure: It contains a CD28 signal peptide, a 1x flag tag, HER2-scFv (original, optimization 1-3), a CD8 hinge region, a CD28 transmembrane region, a 4-1BB intracellular region, and a CD3ζ intracellular region;

[0063] (3)Design and construction of the Vaccine structure: It contains the extracellular region of the HER2 antigen, the transmembrane domain, and the EPM-EABR domain;

[0064] The specific nucleotide sequences are as follows:

[0065] T7 promoter (SEQ ID NO.1):

[0066] TAATACGACTCACTATAGG

[0067] 3' intron (SEQ ID NO.2):

[0068] AAGTATATTGATTAGTTTTGGAGTACTCGTAAGGT

[0069] kozak sequence (SEQ ID NO.3):

[0070] GCCACC

[0071] CVB3-IRES (SEQ ID NO.4):

[0072] TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAA

[0073] 5' Intron (SEQ ID NO.5):

[0074] CTCTCTAAATAGCAATATTTACCTTTGGAGGGAAAAGTTATCAGGCATGCACCTGGTAGCTAGTCTTTAAACCAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAAAGGGGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGGACATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGATCTTCTGTTGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGGGAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCTCCTTAATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCGCTGGGAACTAATTTGTATGCGA The target gene is:

[0075] CAR original(SEQ ID NO.6):

[0076]

[0077] CTAGCTCACTGAGCGCAAGCGTGGGTGACCGCGTGACGATCACGTGTC

[0078] GCGCCTCCCAGGATGTTAACACCGCAGTGGCCTGGTATCAGCAGAAGCC

[0079] CGGAAAGGCTCCGAAGCTGCTGATATATAGCGCTTCATTTCTGGAGAGC

[0080] GGGGTGCCAAGTAGGTTTAGCGGGTCCAGATCCGGCACCGATTTTACCC

[0081] TTACTATCTCTAGCCTCCAGCCCGAGGACTTTGCCACCTACTACTGCCAG

[0082] CAGCATTACACCACTCCTCCAACCTTCGGCCAGGGCACAAAGGTGGAA

[0083] ATCAAGGGCTCCACCTCTGGATCCGGCAAGCCCGGATCTGGCGAGGGAT

[0084] CCACCAAGGGCGAAGTACAACTGGTTGAGTCTGGAGGAGGGTTGGTAC

[0085] AGCCAGGTGGCAGCCTGAGGCTGTCTTGTGCAGCATCAGGCTTTAATAT

[0086] TAAGGACACATATATCCATTGGGTTAGGCAAGCCCCTGGTAAGGGCCTC

[0087] GAGTGGGTTGCTAGAATTTACCCCACCAACGGCTACACACGGTACGCCG

[0088] ACTCTGTGAAGGGCCGATTTACCATCTCTGCCGACACCTCCAAGAACAC

[0089] TGCTTATCTGCAGATGAACAGCCTCAGGGCTGAGGATACTGCCGTGTATT

[0090] ACTGCAGCCGATGGGGCGGCGACGGGTTTTACGCTATGGACGTTTGGGG

[0091] TCAGGGAACGCTGGTCACAGTGAGCTCTGCGGCCGCtGGTACCACCACA

[0092] ACGCCCGCTCCTCGGCCACCGACGCCAGCGCCAACTATTGCGAGTCAGC

[0093] CTCTCAGTCTGCGACCTGAGGCTTGTCGACCAGCAGCCGGAGGCGCAG

[0094] TGCACACGAGGGGGCTGGACTTCGCCTGTGATAGAAGACCTCCTTCTAA

[0095] GCCCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCT

[0096] TGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAAACGGGGCAG

[0097] AAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAA

[0098] CTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAG

[0099] AAGGAGGATGTGAACTGGCTAGCCTGAGAGTGAAGTTCAGCAGGAGCG

[0100] CAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGC

[0101] TCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTG

[0102] GCCGGGACCCTGAGATGGGGGGAAAGCCGCAGAGAAGGAAGAACCCT

[0103] CAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCC

[0104] TACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCA

[0105] CGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGAC

[0106] GCCCTTCACATGCAGGCCCTGCCCCCTCGCTAATAGTGAACCGGTAAAA

[0107] AACAAAAAACAAAACGGCTATTATGCGTTACCGGCGAGACGCTACGGA

[0108] CT

[0109] CAR optimization 1(SEQ ID NO.7):

[0110]

[0111] CAR optimization 2(SEQ ID NO.8):

[0112] AAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCACGCCGGAAACGCAATAGCCGAAAAACAAAAAACAAAAAAAACA

[0113] AAAAAAAAACCAAAAAAACAAAACACATTAAAACAGCCTGTGGGTTGA

[0114] TCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCT

[0115] TTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACA

[0116] CACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGC

[0117] ACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAA

[0118] GGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACA

[0119] CCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCA

[0120] GGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGC

[0121] GTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACA

[0122] TGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAAT

[0123] GCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGT

[0124] GTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCG

[0125] TGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCG

[0126] TTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATAT

[0127] ATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTA

[0128] CAATTCATTGTTAAGTTGAATACAGCAAAACTAGtGCCACCATGCTGCGG

[0129] CTGCTGCTGGCTCTGAACCTGTTCCCTTCCATCCAAGTGACCGGCGGCT

[0130] CTAGCGATTACAAAGATGACGACGACAAATGCAAGGATATTCAGATGAC

[0131] CCAGAGCCCTAGCTCTCTGTCTGCCTCTGTGGGCGACCGGGTGACCATC

[0132] ACCTGCCGGGCCAGCCAGGACGTGAACACAGCCGTGGCCTGGTACCAA

[0133] CAAAAGCCCGGCAAGGCCCCTAAGCTGCTGATCTACTCTGCCTCTTTCC

[0134] TGGAAAGCGGAGTGCCGAGCCGTTTTTCTGGCTCCCGGAGCGGCACCG

[0135] ACTTCACCCTGACCATCAGCAGCCTGCAGCCTGAGGACTTCGCCACCTA

[0136] CTATTGTCAGCAGCACTACACCACCCCTCCTACATTCGGCCAGGGAACA

[0137] AAGGTGGAAATCAAGGGAAGCACAAGCGGCAGTGGCAAACCTGGCAG

[0138] CGGCGAGGGCAGCACCAAGGGAGAGGTGCAGCTGGTGGAATCCGGAG

[0139] GCGGCCTGGTCCAGCCCGGCGGAAGCCTGAGACTGAGCTGCGCCGCCA

[0140] GCGGCTTCAACATCAAGGACACCTACATCCACTGGGTGCGGCAGGCCCC

[0141] AGGTAAGGGCCTCGAGTGGGTGGCCAGAATCTACCCCACAAACGGCTA

[0142] CACAAGGTACGCCGACAGCGTGAAAGGCAGATTCACAATTTCTGCTGAT

[0143] ACCAGCAAGAATACCGCCTACCTGCAGATGAACAGCCTGAGAGCCGAA

[0144] GATACCGCTGTGTACTACTGCAGCCGGTGGGGCGGAGATGGATTCTACG

[0145] CCATGGACGTGTGGGGCCAGGGCACACTGGTGACCGTGTCCAGCGCCG

[0146] CTGCCGGAACCACAACAACCCCTGCACCCAGACCTCCTACCCCTGCCCC

[0147] TACCATCGCCTCTCAGCCTCTGAGCCTCAGACCTGAGGCCTGCAGACCC

[0148] GCGGCTGGCGGCGCCGTGCACACCAGAGGCCTGGACTTTGCCTGCGAC

[0149] AGACGGCCACCTAGCAAGCCCTTCTGGGTCCTGGTGGTGGTGGGCGGC

[0150] GTGCTGGCCTGTTACTCCCTGCTGGTGACAGTGGCTTTTATCATCTTCTG

[0151] GGTCAGAAAGCGGGGTCGGAAAAAGCTGCTGTACATCTTTAAGCAGCC

[0152] TTTCATGCGGCCTGTGCAGACCACCCAAGAAGAGGACGGCTGCAGCTG

[0153] CAGATTCCCCGAGGAAGAGGAAGGAGGGTGTGAACTGGCCTCCCTGAG

[0154] AGTGAAGTTCAGCAGAAGCGCTGATGCCCCCGCCTACCAGCAGGGACA

[0155] AAACCAGCTGTACAACGAGCTGAACCTGGGCAGAAGAGAAGAGTACG

[0156] ACGTTCTGGATAAGAGAAGAGGCCGCGACCCCGAGATGGGCGGCAAGC

[0157] CTCAGAGACGGAAGAACCCCCAGGAGGGCCTGTACAATGAGCTGCAGA

[0158] AAGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAAGGCGAGA

[0159] GAAGACGCGGAAAAGGCCATGATGGCCTGTATCAGGGCCTTTCTACAGC

[0160] CACTAAGGACACCTATGACGCCCTGCACATGCAGGCCCTGCCTCCAAGA

[0161] TGATAGTGAACCGGTAAAAAACAAAAAACAAAACGGCTATTATGCGTTA

[0162] CCGGCGAGACGCTACGGACT

[0163] CAR optimization 3(SEQ ID NO.9):

[0164] AAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCACGCCGGAAACGCAATAGCCGAAAAACAAAAAACAAAAAAAACAAAAAAAAAACCAAAAAAACAAAACACATTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACA

[0165] CCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCA

[0166] GGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGC

[0167] GTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACA

[0168] TGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAAT

[0169] GCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGT

[0170] GTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCG

[0171] TGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCG

[0172] TTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATAT

[0173] ATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTA

[0174] CAATTCATTGTTAAGTTGAATACAGCAAAACTAGtGCCACCATGCTGAGA

[0175] CTGCTCCTGGCCCTGAACCTGTTCCCTAGCATCCAAGTGACCGGCGGCA

[0176] GCAGCGATTACAAAGATGACGACGACAAATGCAAGGACATTCAGATGA

[0177] CACAGAGCCCTAGCAGCCTGAGCGCTAGCGTGGGCGACAGAGTGACCA

[0178] TCACCTGCAGAGCTAGCCAAGACGTGAACACCGCCGTGGCCTGGTATCA

[0179] GCAGAAGCCCGGCAAGGCCCCCAAGCTGCTGATCTACAGCGCTAGCTTC

[0180] CTGGAGAGCGGCGTGCCTAGCAGATTCAGCGGCAGCAGAAGCGGCACC

[0181] GACTTCACCCTGACCATCAGCAGCCTGCAGCCCGAGGACTTCGCCACCT

[0182] ACTACTGTCAGCAGCACTACACCACCCCCCCCACCTTCGGCCAAGGCAC

[0183] CAAGGTGGAGATTAAGGGGAGCACAAGCGGCTCCGGCAAACCTGGCAG

[0184] CGGCGAGGGCTCCACAAAAGGGGAAGTGCAGCTGGTCGAGTCCGGCG

[0185] GGGGGCTGGTGCAGCCTGGCGGGTCCCTGAGACTGAGCTGCGCCGCTA

[0186] GCGGCTTCAACATCAAGGATACCTATATTCACTGGGTGAGACAAGCCCC

[0187] CGGCAAGGGCCTGGAGTGGGTGGCTAGAATCTACCCCACCAACGGCTA

[0188] CACAAGATACGCCGACAGCGTGAAGGGCAGATTCACCATCAGCGCCGA

[0189] CACAAGCAAGAACACCGCCTACCTGCAGATGAACAGCCTGAGAGCCGA

[0190] GGACACCGCCGTGTACTACTGCAGCAGATGGGGCGGCGACGGCTTCTAC

[0191] GCCATGGACGTGTGGGGCCAAGGCACACTCGTGACAGTCAGCAGCGCC

[0192] GCCGCTGGGACCACAACCACCCCCGCCCCTAGACCCCCTACACCCGCCC

[0193] CTACAATTGCTAGCCAACCCCTGAGCCTGAGACCCGAGGCCTGCCGGCC

[0194] TGCCGCTGGGGGCGCTGTGCACACAAGAGGCCTGGACTTCGCCTGCGA

[0195] CAGAAGACCCCCTAGCAAGCCCTTCTGGGTGCTCGTCGTGGTGGGCGG

[0196] CGTGCTGGCCTGCTACAGCCTGCTGGTGACCGTGGCCTTCATCATCTTCT

[0197] GGGTGAGAAAGAGAGGCAGAAAGAAGCTGCTGTACATCTTCAAGCAGC

[0198] CCTTCATGAGACCCGTGCAGACCACCCAAGAGGAGGACGGCTGCAGCT

[0199] GCAGATTCCCCGAGGAAGAGGAGGGCGGCTGCGAGCTGGCTAGCCTGA

[0200] GAGTGAAGTTCAGCAGAAGCGCCGACGCCCCCGCCTATCAGCAAGGGC

[0201] AGAATCAGCTGTACAACGAGCTGAACCTGGGCAGAAGAGAGGAGTACG

[0202] ACGTGCTGGACAAGAGAAGAGGCAGAGACCCCGAGATGGGCGGCAAG

[0203] CCTCAGAGAAGAAAGAACCCCCAAGAGGGCCTGTATAACGAGCTGCAG

[0204] AAGGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAG

[0205] AGACGGAGAGGCAAGGGCCACGACGGCCTGTACCAAGGCCTGAGCAC

[0206] CGCCACCAAGGACACATATGACGCCCTGCACATGCAAGCCCTGCCCCCT

[0207] AGATAATAGTGAACCGGTAAAAAACAAAAAACAAAACGGCTATTATGCG

[0208] TTACCGGCGAGACGCTACGGACT

[0209] circRNA vaccine(SEQ ID NO.10):

[0210] AAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCACGCCGGAAACGCAATAGCCGAAAAACAAAAAACAAAAAAAACAAAAAAAAAACCAAAAAAACAAAACACATTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCG

[0211] TGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCG

[0212] TTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATAT

[0213] ATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTA

[0214] CAATTCATTGTTAAGTTGAATACAGCAAAACTAGTGCCACCATGgatgcaatg

[0215] aagagagggctctgctgtgtgctgctgctgtgtggagcagtcttcgtttcgcccagccaggaaatccatgcccgattca

[0216] gaagaACCCAGGTATGCACCGGCACGGACATGAAGCTTAGACTCCCCGCA

[0217] AGCCCGGAAACGCATTTGGACATGCTGAGACACCTCTATCAGGGTTGCC

[0218] AGGTAGTGCAGGGAAACCTGGAGCTGACATACTTGCCAACTAATGCATC

[0219] CCTGTCTTTTCTGCAAGACATCCAGGAGGTTCAGGGGTATGTGCTGATT

[0220] GCCCATAATCAAGTGCGCCAAGTTCCGCTGCAACGGCTCAGAATCGTTC

[0221] GGGGCACACAGCTGTTTGAAGACAATTATGCGCTGGCCGTGCTGGACAA

[0222] TGGCGATCCACTGAATAATACGACCCCTGTTACGGGCGCCTCACCTGGG

[0223] GGGTTGAGGGAGCTGCAGCTTAGATCACTCACTGAGATTCTGAAAGGC

[0224] GGGGTGCTGATTCAGCGGAACCCTCAACTGTGCTACCAGGACACAATCC

[0225] TCTGGAAGGACATTTTTCACAAGAACAACCAGCTGGCCTTGACCTTGAT

[0226] CGACACCAATAGATCCCGGGCTTGCCACCCTTGCAGTCCAATGTGCAAG

[0227] GGCTCAAGATGTTGGGGCGAGAGCAGTGAGGATTGCCAGAGCCTGACA

[0228] AGGACAGTATGCGCTGGTGGCTGCGCACGGTGTAAAGGTCCTCTGCCTA

[0229] CAGATTGTTGTCATGAGCAGTGTGCAGCCGGGTGTACCGGGCCTAAGCA

[0230] TTCAGATTGCCTGGCCTGCCTCCACTTCAATCACTCCGGCATTTGCGAGC

[0231] TGCATTGTCCAGCTCTGGTGACCTACAATACCGACACGTTCGAGTCAAT

[0232] GCCGAACCCAGAAGGGCGGTATACCTTCGGTGCTTCCTGTGTCACCGCA

[0233] TGTCCCTACAACTATCTGAGCACCGACGTTGGTTCCTGCACTTTGGTCTG

[0234] CCCCCTCCATAACCAAGAAGTCACTGCAGAGGATGGAACACAGCGCTG

[0235] CGAGAAGTGTTCAAAACCATGTGCCAGAGTGTGTTACGGACTGGGTATG

[0236] GAACATCTCCGGGAGGTGAGGGCGGTCACGTCTGCCAACATTCAGGAA

[0237] TTTGCCGGTTGCAAGAAGATCTTCGGTTCATTGGCTTTCCTCCCTGAAAG

[0238] TTTTGATGGAGACCCAGCTAGTAATACAGCCCCTCTCCAGCCTGAACAA

[0239] TTGCAGGTGTTTGAGACTCTCGAGGAAATTACCGGATACCTTTACATCAG

[0240] CGCATGGCCAGATAGCCTGCCGGACCTGTCAGTGTTCCAGAACCTGCAG

[0241] GTGATTCGCGGCCGGATTCTCCACAATGGCGCATACTCCTTGACCTTGCA

[0242] AGGGCTGGGCATCAGTTGGCTGGGCCTTAGAAGTCTCCGGGAACTGGG

[0243] AAGTGGATTGGCCCTGATACACCACAACACCCATCTGTGCTTCGTGCATA

[0244] CCGTGCCGTGGGATCAGCTGTTCCGGAACCCTCATCAAGCACTGCTGCA

[0245] CACGGCAAACAGACCAGAGGATGAGTGTGTGGGAGAGGGTCTCGCCTG

[0246] TCATCAGCTCTGCGCCCGAGGCCACTGTTGGGGGCCCGGACCAACCCA

[0247] GTGTGTTAACTGCTCCCAGTTTCTGCGGGGTCAGGAGTGCGTCGAAGAG

[0248] TGTAGAGTGTTGCAGGGTCTGCCGCGCGAGTATGTGAATGCACGACATT

[0249] GTCTCCCGTGTCACCCCGAGTGTCAGCCTCAGAACGGCAGTGTGACCTG

[0250] CTTCGGACCAGAGGCTGATCAGTGTGTCGCCTGCGCTCACTATAAAGAT

[0251] CCTCCATTCTGCGTAGCTAGATGTCCATCTGGCGTAAAACCCGACCTCAG

[0252] TTACATGCCCATCTGGAAGTTCCCAGACGAAGAAGGGGCATGTCAGCCT

[0253] TGTCCCATTAATTGTACTCACTCTTGCGTGGACCTCGACGACAAGGGCT

[0254] GCCCCGCTGAGCAGAGGGCGTCCCCTCTGACCTCTATCATCTCCGCAGT

[0255] CGTGGGCATACTCCTCGTCGTGGTGCTGGGAGTCGTATTCGGCATCCTTA

[0256] TCAAGCGCAGGCAGCAGAAAATTAGAAAGTATGATATCGCCCTGCCAGG

[0257] AAATCCCGACCATAGAGAAATGGGCGAAACGCTGCCGGAAGAGGTGGG

[0258] AGAGTACCGGCAGCCTTCTGGTGGATCCGTTCCCGTGAGCCCTGGACCA

[0259] CCGTCAGGGTTGGAGCCCACCAGCAGCTCCCCATATggtggtggttctTTCAAT

[0260] TCCTCCATCAACAACATCCACGAAATGGAAATTCAGCTGAAGGATGCGC

[0261] TCGAGAAAAACCAACAGTGGTTGGTGTATGATCAGCAGAGAGAAGTAT

[0262] ACGTCAAGGGTTTGCTGGCTAAGATCTTCGAGCTCGAGAAAAAGACCG

[0263] AAACAGCAGCACATAGCCTTCCCTAATAGTGAACCGGTAAAAAACAAA

[0264] AAACAAAACGGCTATTATGCGTTACCGGCGAGACGCTACGGACT

[0265] (4) Linearize the plasmid containing the target gene, and obtain circular RNA through in vitro transcription (IVT) technology, DNase I treatment, and RNA purification. Further purify and enrich the circular RNA through different treatments (including RNase R, HPLC, CIP) to prepare high-purity circular RNA;

[0266] (5) Treat the purified circular RNA with RNase R and observe by electrophoresis whether circularization is successful. Perform reverse transcription-PCR (RT-PCR) on the purified circular RNA and sequence the target band to determine that the circular RNA is successfully prepared and the ligation site is correct;

[0267] (6) Transfect the purified circular RNA into 293T cells and detect it by fluorescence microscopy and flow cytometry after 24 hours. Since the IRES sequence that initiates translation is located downstream of GFP, only the observation of green fluorescence indicates successful circularization.

[0268] (7) Change the target gene of the circular RNA construct to a tumor antigen (in this invention, the HER2 tumor antigen is taken as an example), prepare a circular RNA vaccine, inject it into mice through the LNP delivery system, and detect the innate immunogenicity, humoral immune level, cellular immune level, and anti-tumor ability.

[0269] (8) Change the target gene of the circular RNA construct to a CAR molecule, prepare a circular RNA in situ CAR, inject it into subcutaneous tumor-bearing model mice through a delivery vector with targeting function, and record the tumor formation and death conditions of the mice.

[0270] (9) Prepare and optimize the lipid nanoparticles (LNP) complex LNP-circular RNA targeting T cells / macrophages, and measure and characterize parameters such as the particle size, encapsulation efficiency, and particle homogeneity of the nanoparticle complex;

[0271] (10) Transfect the LNP-circular RNA complex into T cells / macrophages in vitro and detect the expression level of the CAR molecule on the cell surface by Western blot and flow cytometry;

[0272] (11) Respectively co-culture the prepared CAR-T / M cells with tumor cells of different tumors such as HER2 + SK-OV-3-LUC cells, A549-LUC-CD19, MC38-LUC-CD19, MC38-LUC-HER2, at effector cell:tumor cell (E:T) = 2:1, 4:1, 8:1 for co-culture. After 48 hours, detect the killing effect of effector cells on tumor cells by the Luciferase reporter gene experiment; meanwhile, use the Annexin V / PI kit to detect the effect of effector cells on tumor cell apoptosis;

[0273] (12) Establish a subcutaneous tumor-bearing model and use the tumor cell line HER2 cultured in vitro +SK-OV-3-LUC cells, A549-LUC-CD19, MC38-LUC-CD19, and MC38-LUC-HER2 were respectively mixed with Matrigel and subcutaneously inoculated into the back of C57BL / 6 mice to form tumors. The tumor formation in mice was observed daily and the tumor size was measured. The experiment was conducted when the subcutaneous tumor volume reached about 60 mm 3 or so;

[0274] (13) LNP-circular RNA was delivered into mice by intratumoral injection. The survival of mice in each group was observed daily, and the changes in tumor size of mice were observed through an in vivo imaging system. The survival curve and tumor growth curve of mice were plotted.

[0275] (14) LNP-circular RNA and circular RNA vaccine were co-administered into mice by intratumoral injection. The survival of mice in each group was observed daily, and the changes in tumor size of mice were observed through an in vivo imaging system. The survival curve and tumor growth curve of mice were plotted.

[0276] The specific steps are as follows:

[0277] Design and construction of the circRNA-STS-P9 structure: including T7 promoter, 3' intron, kozak sequence, target gene, IRES, 3' intron;

[0278] The plasmid containing the target gene GFP was linearized, and circular RNA was obtained through in vitro transcription (IVT) technology, DNase I treatment, and purification. Further enrichment of circular RNA was achieved through RNase R treatment and purification, HPLC purification, and CIP treatment and purification to prepare high-purity circular RNA;

[0279] Gel electrophoresis was performed on the circular RNA after RNase R treatment to observe whether cyclization was successful. Reverse transcription-PCR (RT-PCR) was performed on circular RNA, and the target band was sequenced to determine that the circular RNA was successfully prepared and the ligation site was correct;

[0280] The purified circular RNA was transfected into 293T cells and detected by fluorescence microscopy and flow cytometry 24 hours later to obtain fluorescence imaging results, GFP positive rate, and MFI fluorescence expression level.

[0281] Change the target gene of the circular RNA construct to a tumor antigen, prepare a circular RNA vaccine, first transfect 293T cells, and verify the expression of the antigen by WB and ELISA. Then inject mice through the LNP delivery system, administer the drug once every three days for three times. After 4 weeks, detect the innate immunogenicity (including MCP-1, IL-6, IP-10, TNF-α, IFN-α, RANTES), humoral immune level and cellular immune level (detection of related cytokines such as IL-4, IL-6, IFN-γ, TNF-α, IL-2), as well as the anti-tumor ability.

[0282] Change the target gene of the circular RNA construct to the HER2 CAR molecule, and prepare circular RNA. First, after transfecting circular RNA HER2 CAR into Jurkat, THP-1, and RAW264.7 cells, co-incubate the prepared CAR-T / M cells with SK-OV-3-LUC and MC38-HER2-LUC cells at different effector-to-target ratios, and then detect the killing effect of CAR-T / M cells on tumor cells by luciferase. Inject circular RNA HER2 CAR into subcutaneous tumor-bearing model mice (SK-OV-3-LUC, MC38-HER2-LUC cells) through the targeted delivery system. When the tumor volume reaches 60 mm 3 inject LNP-circular RNA HER2CAR by intravenous injection and intratumoral multi-point injection, administer the drug once every three days for three times. At the end of the experiment, take tumors, lymph nodes, spleens, and peripheral blood, isolate cells, detect the proportions of T cells and M1 macrophages by flow cytometry, and the expression of circRNA Anti-HER2-CAR in them, and observe and record the survival status of mice and tumor volume every day.

[0283] The results are as Figure 3-7 .

[0284] The above-described embodiments are merely preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. A drug based on circular RNA, characterized in that, The drug comprises at least one of the following: (1) A ribonucleic acid construct with an antigen as the target gene; (2) A ribonucleic acid construct with a chimeric antigen receptor as the target gene; Wherein, the ribonucleic acid construct comprises the following elements from the 5'-end to the 3'-end: Part of the P9 region and P10 region of a type I intron containing a 3' splice site, The target gene, The P1-P8 region and part of the P9 region of a type I intron containing a 5' splice site; The type I intron contains 10 paired double-helix regions P1-P10 from the 5'-end to the 3'-end. The above elements are obtained by splitting the type I intron, and the splitting is to split the type I intron into two fragments at the non-complementary region or adjacent non-complementary region near the 9th helix region P9 at the 3'-end.

2. The drug according to claim 1, characterized in that, The antigen includes tumor antigens.

3. The drug according to claim 1, characterized in that, The circular RNA drug prepared from the ribonucleic acid construct enters the body through a liposome delivery vector.

4. The drug according to claim 1, characterized in that, The sequences of the part of the P9 region and P10 region of the type I intron containing a 3' splice site are as shown in SEQ ID NO.1; the sequences of the P1-P8 region and part of the P9 region of the type I intron containing a 5' splice site are as shown in SEQ ID NO.

3.

5. The drug according to claim 1, characterized in that, In the ribonucleic acid construct with an antigen as the target gene, an EPM-EABR sequence is linked to the end of the antigen.

6. The drug according to claim 1, characterized in that, When the drug contains both a ribonucleic acid construct with an antigen as the target gene and a ribonucleic acid construct with a chimeric antigen receptor as the target gene, the ribonucleic acid construct containing the chimeric antigen receptor is injected intratumorally, and the ribonucleic acid construct containing the antigen is injected intramuscularly.

7. The drug according to claim 1, characterized in that, The target gene includes a sequence for initiating translation.

8. The drug according to claim 7, characterized in that, The sequence for initiating translation includes one or more of an IRES sequence, an m6A motif, a CITE sequence, and a kozak sequence.

9. A method for preparing the drug according to any one of claims 1-8, characterized in that, It includes the following steps: The ribonucleic acid construct linked with a tumor antigen and / or a chimeric antigen receptor is subjected to IVT, DNase I treatment, RNase R treatment, HPLC, and CIP treatment, and finally purified and enriched to obtain circular RNA.

10. The preparation method according to claim 9, characterized in that, Modified nucleotides are added during the process of preparing the ribonucleic acid construct into circular RNA, and the proportion is 0%-100%.

Images