Micromolecule peptide from ganoderma lucidum spore powder as well as preparation method, product and application of micromolecule peptide

Abstract

The invention provides a micromolecule peptide derived from ganoderma lucidum spore powder as well as a preparation method, a product and application of the micromolecule peptide, and relates to the technical field of biology. The wall-broken and deoiled ganoderma lucidum spore powder is used as a raw material, the small molecule peptide compound is extracted through the steps of homogeneous extraction, ethanol extraction and the like, and the obtained small molecule peptide compound is high in peptide content and high in proportion of low-molecular-weight small molecule peptide and has a very good inhibition effect on expression of inflammatory factors TNF-alpha, IL-6 and IL-1beta; the proportion of CD3 + CD4 + and CD3 + CD8 + T lymphocytes can be obviously improved, and the compound can be used for preparing products for resisting inflammation or enhancing immunity.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, relates to the preparation of small molecule peptides, and particularly relates to a small molecule peptide derived from Ganoderma lucidum spores, a preparation method thereof, a product and an application. Background Art

[0002] Inflammation is a normal defense response of the host to the stimulation of damaging factors, and it is a complex regulatory process involving multiple cells (such as macrophages, lymphocytes, monocytes, etc.) and multiple factors (signal transducer and activator of transcription, vasoactive amines, cytokines, chemokines, inflammation-related enzymes). The inflammatory response is a unified process of tissue damage and anti-damage in the body. An appropriate inflammatory response is beneficial for the human body to resist damage, but an excessive inflammatory response will lead to the occurrence of persistent tissue damage and also have a more serious impact on people's physical health. Macrophages are formed after monocytes migrating from the blood into tissues and are distributed in different tissues and organs. Macrophages are the central cells mediating the production of inflammatory mediators in the body, so they can be activated by a variety of inflammatory responses, including the bacterial lipopolysaccharide secreted by stimulation with Gram-negative bacteria.

[0003] Lipopolysaccharides (LPS) are a unique component in the cell wall of Gram-negative bacteria, also known as endotoxins, and are macromolecules composed of three different parts:

[0004] (1) O-antigen: Many single sugar chains that can be recognized by the immune system;

[0005] (2) Core oligosaccharide: A small chain of monosaccharides;

[0006] (3) Lipid A: Two glucosamine molecules combined with many fatty acids.

[0007] The fatty component of LPS, namely lipid A, is the biological activity center and the main toxic component of LPS, and is an effective stimulator of the innate immune response, that is, the cause of the toxicity and inflammatory characteristics of LPS. Lipid A is anchored on the cell membrane, and the rest of LPS projects from the cell surface into the surrounding environment. In the blood, LPS binds to monocytes, dendritic cells, macrophages and B cells and induces them to produce transcription factors NF-κB and AP-1; then, these transcription factors stimulate the production of inflammatory cytokines TNF-α, IL-1β, IL-6 and CRP. LPS can also increase the production of nitric oxide, superoxide (a free radical) and eicosanoids (fatty decomposition products that increase inflammation, such as PGE2). In addition, if the level of lipopolysaccharide in the blood is too high, it will also trigger sepsis, a fatal toxin reaction that can cause tissue function damage, organ failure and even death.

[0008] Compounds formed by amino acids linked to each other through peptide bonds are called peptides. Peptides composed of more than 10 amino acids are called polypeptides, and peptides composed of less than 10 amino acids are called small molecule peptides. Small molecule peptides have the following characteristics:

[0009] (1) Small molecule peptides have a simple structure and a small molecular weight. They can be quickly absorbed through the small intestinal mucosa without further digestion and without consuming energy, with the characteristic of 100% absorption. Therefore, the absorption, transformation, and utilization of small molecule active peptides are efficient and complete.

[0010] (2) The ability of small molecule active peptides to directly enter cells is an important manifestation of their biological activity. Small molecule peptides can penetrate the skin barrier, blood-brain barrier, placental barrier, and gastrointestinal mucosal barrier and directly enter cells.

[0011] (3) Small molecule peptides have very high activity, and often a very small amount can play a great role.

[0012] (4) Small molecule peptides have important physiological functions, covering various fields of human hormones, nerves, cell growth, and reproduction. They can regulate the physiological functions of various systems and cells in the body and maintain the normal physiological activities of the human nervous, digestive, reproductive, growth, motor metabolism, circulatory, and other systems.

[0013] (5) Small molecule peptides can not only provide the nutrients required for human growth and development but also have special biological functions. They can prevent and treat thrombosis, hyperlipidemia, and hypertension, relieve inflammation, delay aging, resist fatigue, and improve the body's immunity.

[0014] Small molecule peptides have many excellent physiological activities in living organisms and are a class of compounds with relatively high activity. Due to their simple structure and small molecular weight, their absorption mechanism is very different from that of other substances, resulting in the following physiological characteristics and functions:

[0015] (1) Small molecule peptides can penetrate barriers such as mucous membranes and capillary walls and can even directly enter cells through cell penetration, overcoming the disadvantages that many current drugs cannot directly enter cells and are ineffective against most cell diseases.

[0016] (2) Small molecule peptides can participate in the synthesis of enzymes, can stimulate the activity of enzymes, strengthen the function of enzymes, and maintain the stability of enzymes.

[0017] (3) Small molecule peptides can change the permeability of biological membranes (gastrointestinal mucosa, capillary walls, alveoli, cerebrospinal membranes, red blood cell walls, renal

[0018] glomerular basement membrane), achieving the effects of effectively absorbing nutrients and excreting toxins, and can, to a certain extent, defend against the invasion of pathogens.

[0019] (4) Small molecule peptides can control DNA transcription and change the transmission of genetic information.

[0020] (5) Small molecule peptides act as a transport tool for nutrients in the human body. After adsorbing various nutrients required by humans on the main body, they are transported to various cells, organs, and tissues of the human body and are absorbed by the human body together with the main body, performing the dual duties of a carrier tool and a material.

[0021] Since small molecule peptides are short-chain proteins and have multiple functional activities, they have become a research hotspot in food science and medical science. Currently, there are mainly three types of methods for producing small molecule peptides. One is to directly extract natural active functional peptides from natural organisms. The second is to synthesize polypeptides through chemical methods or synthetic biology methods. The third is to produce small molecule peptides by enzymatic hydrolysis of proteins.

[0022] A small molecule polypeptide can be extracted from Phaseolus vulgaris L. var. purpureus by affinity chromatography, ion exchange chromatography and gel permeation chromatography (Nguyen G K T, et al. Novel cyclotides and uncyclotides with highly shortened precursors from Chassalia chartacea and effects of methionine oxidation on bioactivities. [J]. Journal of Biological Chemistry, 2012.). This polypeptide has strong inhibitory effects on Mycosphaerella arachidicola, Mycosphaerella maydis, etc. Guo Zhun obtained the small molecule polypeptide of Spirulina platensis by ultrasonic-assisted extraction method, and separated the extract of the small molecule polypeptide of Spirulina platensis by Sephadex gel permeation chromatography. The research shows that only the small molecule polypeptide with a molecular weight of 3000 Da has antioxidant ability; only the small molecule polypeptide with a molecular weight of 550 Da has inhibitory effect on α-glucosidase (Guo Zhun. Study on the extraction and activity of small molecule polypeptide of Spirulina platensis by foam separation [D]. Beijing Forestry University, 2012.). A 9-peptide Cr-ACP1 with anti-cancer activity was isolated from Cycas pectinata (Mandal S M, et al. Identification and characterization of a bactericidal and proapoptotic peptide from Cycas revoluta seeds with DNA binding properties [J]. Journal of Cellular Biochemistry, 2012.). This peptide can further damage the nucleosome structure by directly binding to DNA, induce apoptosis, inhibit the proliferation of tumor cells, and has high cytotoxic effects on human epidermal cancer cells Hep2 and colon cancer cells HCT15, while having no obvious hemolytic effect on normal red blood cells; in addition, it was also found that this polypeptide has relatively significant antibacterial activity.

[0023] Ganoderma lucidum is a medicinal and edible fungus of the family Polyporaceae and the genus Ganoderma, and it is a traditional precious medicinal material included in the Chinese Pharmacopoeia. Ganoderma spores are a natural plant product that has been widely used in tumor treatment. They are extremely tiny seeds ejected from the mushroom cap during the growth and maturity period of Ganoderma lucidum. As the reproductive cells of Ganoderma lucidum, they are the essence part of Ganoderma lucidum, containing all the genetic active substances of Ganoderma lucidum. The main active ingredients include polysaccharides, triterpenoids, peptides, and are also rich in various amino acids, oligosaccharides, fatty acids, and trace elements. After the Ganoderma spores are broken, it is more conducive to the absorption of the body. It contains special ingredients such as polysaccharide peptides, adenosine, proteins, enzymes, selenium elements, etc., which are richer than those in Ganoderma lucidum. Its pharmacological effects mainly include anti-tumor, anti-inflammatory, anti-viral, liver protection, lowering serum cholesterol, lowering blood sugar, anti-radiation, enhancing immunity, etc., and it has a regulatory and improving effect on the nervous, cardiovascular, and respiratory systems.

[0024] The prior art CN109998005A discloses a formula for a Ganoderma spore powder small molecule peptide solid beverage and its preparation method. This technology first selects 700 - 300 parts of Ganoderma spore powder, 1500 - 750 parts of dry corn, and 15000 - 10000 parts of purified water. After the sample is pulverized, the sample fine powder is obtained through a rotary vibrating sieve, and an appropriate amount of purified water is added and mixed evenly for sufficient moistening. Ultrasonic extraction, separation are carried out, the filtrate is taken, the filtrates are combined, and then finely filtered. After the filtrate is concentrated under negative pressure, it is dried by a vacuum freeze dryer to obtain the dry powder, namely the Ganoderma spore powder small molecule peptide solid beverage. This technology uses a large number of raw materials, with high raw material costs, and the content of small molecule peptides in the product is low.

[0025] The prior art CN110592167B discloses a purslane polypeptide extract and its preparation method. The preparation method includes the following steps: taking the dried purslane medicinal material, pulverizing it into a coarse powder, adding petroleum ether for reflux extraction, filtering, and evaporating the solvent to dryness; adding water, adding neutral protease, carrying out warm soaking extraction, adjusting the pH to 9 - 10 with an alkaline solution, then adding alkaline protease, carrying out warm soaking extraction, boiling to inactivate the enzyme, filtering with a filter cloth, concentrating under reduced pressure, and centrifuging to retain the supernatant; passing the supernatant through D101 macroporous resin, collecting the column eluate, washing the column with water, collecting the washing solution, combining the column eluate and the washing solution, and concentrating under reduced pressure; adding ethanol, standing and then filtering by suction, concentrating under reduced pressure and adding water until there is no alcohol; using a dialysis bag with a cut-off molecular weight of 2 kDa, dialyzing at room temperature, concentrating under reduced pressure and then vacuum drying and pulverizing to obtain the purslane polypeptide extract. This technology requires enzyme hydrolysis steps, macroporous resin purification steps, and dialysis bag concentration steps, with cumbersome steps and high costs.

[0026] The extraction of small molecule peptides from Ganoderma spores has received increasing attention, but it also faces the current situation of immature extraction methods, high extraction costs, and poor product quality. Therefore, there is an urgent need for a more efficient preparation method for extracting small molecule peptides from Ganoderma spore powder. Summary of the Invention

[0027] In view of the problems of immature preparation methods, high extraction costs, and poor product quality for extracting small molecule peptides from Ganoderma lucidum spore powder, the present invention provides a small molecule peptide derived from Ganoderma lucidum spore powder, its preparation method, product, and application. The present invention uses methods such as high-pressure homogenization and ethanol extraction, and the obtained small molecule peptide compound has a high peptide content, a high proportion of low molecular weight small molecule peptides, and significant effects in inhibiting the expression of inflammatory factors and increasing the proportion of immune cells.

[0028] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0029] On the one hand, the present invention provides a preparation method of a small molecule peptide, comprising the following steps:

[0030] S1: Mix defatted Ganoderma lucidum spore powder with water, perform pressurized homogenization and emulsification, and solid-liquid separation to obtain an emulsion and spore wall shells;

[0031] S2: Concentrate the emulsion to obtain a concentrated solution;

[0032] S3: Add edible ethanol to the concentrated solution, stir evenly and then centrifuge, and take the supernatant;

[0033] S4: Concentrate the supernatant, and obtain a small molecule peptide compound after drying.

[0034] Preferably, in step S1, the defatted Ganoderma lucidum spore powder is mixed with water evenly according to a mass ratio of 1:4 - 1:20.

[0035] Specifically, in step S1, the defatted Ganoderma lucidum spore powder is mixed with water evenly according to a mass ratio of 1:10 or 1:12.

[0036] Preferably, the pressurized homogenization in step S1 includes predispersion and homogenization.

[0037] Preferably, in step S1, the pressurized homogenization is to perform predispersion once first, and then perform homogenization 1 - 8 times.

[0038] Preferably, the pressurized homogenization in step S1 is repeated twice, and the emulsions are combined.

[0039] Specifically, in step S1, a high-pressure homogenizer is used to perform predispersion once first, then perform homogenization and circulation 4 times, and then repeat high-pressure homogenization once, and combine the emulsions of the two times.

[0040] The above-mentioned pressure homogenization is generally carried out by a high-pressure homogenizer. The high-pressure homogenization means that the material in the high-pressure homogenizer is transported by a pump to the homogenization chamber, and under the action of high pressure, the material passes through the homogenization valve. In the homogenization valve, the material is subjected to high-speed shearing, cavitation, impact and other effects, and the macromolecules and particles in the material are broken into small molecules and fine particles. Then, the homogenized material is discharged from the homogenization valve. The high-pressure homogenization process is mainly affected by three effects, namely impact force, shear force and cavitation effect. Among them, the impact force refers to the force generated when the material flows through the impact ring under high pressure and collides with the impact ring wall or other materials. It is an important homogenization force in the high-pressure homogenizer. The shear force is generated through the narrow channel in the homogenization valve. In the narrow channel of the homogenization valve, the flow rate of the material will increase sharply, thus generating a strong shear force. The cavitation effect means that when the material flows through the homogenization valve under high pressure, in its narrow channel, the flow rate of the material will increase sharply, resulting in a pressure drop. When the pressure drops to the critical value, the dissolved gas in the material will vaporize to form cavities. The cavities will expand rapidly under the impact of high-pressure fluid and generate strong impact force and shear force, thereby destroying the particles in the material and achieving the purpose of homogenization. The shear force in the high-pressure homogenizer has a synergistic effect with the impact force and the cavitation effect, which can promote each other, thereby improving the homogenization effect. Pressure is one of the most important parameters of the high-pressure homogenizer and determines the homogenization effect. Generally speaking, the higher the pressure, the better the homogenization effect; the number of homogenization times, that is, the number of times the material passes through the homogenizer, is also a key parameter. Generally speaking, the more the number of homogenization times, the better the homogenization effect. In addition to high-pressure homogenization extraction, common extraction methods also include water extraction method, ultrasonic extraction method and enzyme extraction method.

[0041] Preferably, in step S1, the pressure during pre-dispersion by the pressure homogenizer is not greater than 800 bar, and the pressure during homogenization is 800 bar - 5000 bar.

[0042] Specifically, in step S1, the pressure during pre-dispersion by the pressure homogenizer is 700 bar, and the pressure during homogenization is 1200 bar.

[0043] Preferably, in step S2, the emulsion is pumped into the concentration tank and concentrated under reduced pressure to a relative density of 1.01 - 1.10. The vacuum degree for concentration under reduced pressure ranges from -0.05 Mpa to -0.09 Mpa, and the temperature is 60°C - 80°C.

[0044] Specifically, in step S2, the emulsion is pumped into the concentration tank and concentrated under reduced pressure to a relative density of 1.08. The vacuum degree for concentration under reduced pressure is -0.07 Mpa, and the temperature is 70°C.

[0045] Preferably, in step S3, 2 - 5 times the volume of 95% ethanol is added to the concentrated liquid, stirred evenly, allowed to stand for 12 h, centrifuged, and the supernatant is taken.

[0046] Ethanol extraction method is a solvent-based extraction method. Utilizing the good solubility and permeability of ethanol, it can effectively extract active substances in cells. Ethanol extraction method has wide applications in the preparation of plant extracts and drug research and development, including traditional Chinese medicine extraction, natural product extraction, and drug research and development, etc. Ethanol extraction method can be used to extract active ingredients in plants, such as alkaloids, polyphenolic substances, etc., and can also be used to extract active ingredients in natural products, such as natural pigments, aromatic substances, etc. In addition, ethanol extraction method can also be used for preliminary screening in drug research and development and the extraction of active substances. Ethanol extraction method has the following advantages: alcohol solvents are easy to remove and recycle; the alcohol extraction process will not cause losses such as protein decomposition, and the activity of the extract is relatively high; alcohol extraction is suitable for extracting some volatile compounds.

[0047] Specifically, in step S3, 3 times the volume of 95% ethanol is added to the concentrated solution, stirred evenly, left standing for 12 h, centrifuged, and the supernatant is taken.

[0048] Preferably, in step S4, the supernatant is concentrated to a relative density of 1.01 - 1.10, and after spray drying, a small molecule peptide compound is obtained.

[0049] Specifically, in step S4, the supernatant is concentrated to a relative density of 1.06, and after spray drying, a small molecule peptide compound is obtained.

[0050] Specifically, in step S4, the peptide content of the small molecule peptide compound is 20.7%, and the proportion of small molecule peptides with a molecular weight less than 500 daltons is 91.64%.

[0051] On the other hand, the present invention provides a small molecule peptide, which is prepared according to the above preparation method.

[0052] On the other hand, the present invention provides the application of the small molecule peptide in the preparation of products for relieving inflammation or enhancing immunity.

[0053] On the other hand, the present invention provides a product, which contains the above small molecule peptide.

[0054] Preferably, the product includes food, health products or drugs.

[0055] Compared with the prior art, the present invention has the following beneficial effects:

[0056] The present invention uses methods such as high-pressure homogenization extraction and ethanol extraction to extract small molecule peptides from defatted Ganoderma lucidum spores powder with broken walls. The obtained small molecule peptide compound has a high peptide content and a high proportion of small molecule peptides with a molecular weight less than 500 daltons, and has a good inhibitory effect on the expression of inflammatory factors TNF-α, IL-6 and IL-1β, and can increase CD3 + CD4 + and CD3+ CD8 + The proportion of T lymphocytes can be used to prepare products for anti - inflammation or immune enhancement. Brief Description of the Drawings

[0057] Figure 1 Effects of small - molecule peptides obtained by different methods on IL - 6 expression at two concentration levels (compared with the control group: #P < 0.0001; compared with the model group: ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05).

[0058] Figure 2 Effects of small - molecule peptides obtained by different methods on IL - 1β expression at two concentration levels (compared with the control group: #P < 0.0001; compared with the model group: ****P < 0.0001, ***P < 0.001,

[0059] **P < 0.01, *P < 0.05).

[0060] Figure 3 Effects of small - molecule peptides obtained by different methods on the expression of TNF - α, IL - 6 and IL - 1β in the brains of mice (compared with the control group: #P < 0.0001, P < 0.001, ##P < 0.01, #P < 0.05; compared with the model group: ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05).

[0061] Figure 4 Effects of small - molecule peptides obtained by different methods on the subtypes and proportions of T lymphocytes in the circulating blood of mice (compared with the control group: #P < 0.0001, P < 0.001, ##P < 0.01, #P < 0.05; compared with the model group: ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05). Detailed Implementation Modes

[0062] It should be noted that, unless otherwise specified, the raw materials used in the present invention are all ordinary commercially available products, and their sources are not specifically limited. Table 1 below describes the key materials and instruments.

[0063] Table 1 Description of Key Materials and Instruments

[0064]

[0065]

[0066] Example 1: A Preparation Method of Small - Molecule Peptides Derived from Ganoderma Spore Powder

[0067] Take the Ganoderma lucidum spore powder after supersonic airflow wall-breaking and supercritical extraction, and homogenize and extract it twice with a high-pressure homogenizer; for the first time, use 12 times the amount of water, pre-disperse it once at 700 bar, and then homogenize and circulate it 4 times at 1200 bar; for the second time, use 10 times the amount of water, pre-disperse it once at 700 bar, and then homogenize and circulate it 4 times at 1200 bar. The emulsion is separated by a plate and frame filter press, and the emulsions of the two times are combined. Pump the emulsion into a concentration tank, and concentrate it under reduced pressure to a relative density of 1.08. The vacuum degree of reduced pressure concentration is -0.07 Mpa, and the temperature is 70 °C. Add 3 times the volume of 95% ethanol to the concentrated solution, stir evenly, stand for 12 h, centrifuge, take the supernatant and concentrate it to a relative density of 1.06, and then spray-dry it to obtain the small molecule peptide compound.

[0068] Example 2: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0069] Take the Ganoderma lucidum spore powder after supersonic airflow wall-breaking and supercritical extraction, and homogenize and extract it twice with a high-pressure homogenizer; for the first time, use 4 times the amount of water, pre-disperse it once at 700 bar, and then homogenize and circulate it 4 times at 1200 bar; for the second time, use 20 times the amount of water, pre-disperse it once at 700 bar, and then homogenize and circulate it 4 times at 1200 bar. The emulsion is separated by a plate and frame filter press, and the emulsions of the two times are combined. The others are the same as in Example 1.

[0070] Example 3: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0071] Take the Ganoderma lucidum spore powder after supersonic airflow wall-breaking and supercritical extraction, and homogenize and extract it twice with a high-pressure homogenizer; for the first time, use 12 times the amount of water, pre-disperse it once at 800 bar, and then homogenize and circulate it 4 times at 1200 bar; for the second time, use 10 times the amount of water, pre-disperse it once at 600 bar, and then homogenize and circulate it 4 times at 1200 bar. The emulsion is separated by a plate and frame filter press, and the emulsions of the two times are combined. The others are the same as in Example 1.

[0072] Example 4: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0073] Take the Ganoderma lucidum spore powder after supersonic airflow wall-breaking and supercritical extraction, and homogenize and extract it twice with a high-pressure homogenizer; for the first time, use 12 times the amount of water, pre-disperse it once at 600 bar, and then homogenize and circulate it 4 times at 800 bar; for the second time, use 10 times the amount of water, pre-disperse it once at 800 bar, and then homogenize and circulate it 4 times at 5000 bar. The emulsion is separated by a plate and frame filter press, and the emulsions of the two times are combined. The others are the same as in Example 1.

[0074] Example 5: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0075] Take the Ganoderma lucidum spore powder after supersonic airflow wall-breaking and supercritical extraction, and homogenize and extract it 2 times with a high-pressure homogenizer; for the first time, use 12 times the amount of water, pre-disperse it once at 600 bar, and then homogenize and circulate it 4 times at 2000 bar; for the second time, use 10 times the amount of water, pre-disperse it once at 800 bar, and then homogenize and circulate it 4 times at 4000 bar. The emulsion is separated by a plate-and-frame filter press, and the emulsions of the two times are combined. The others are the same as in Example 1.

[0076] Example 6: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0077] Take the Ganoderma lucidum spore powder after supersonic airflow wall-breaking and supercritical extraction, and homogenize and extract it 2 times with a high-pressure homogenizer; for the first time, use 12 times the amount of water, pre-disperse it once at 700 bar, and then homogenize and circulate it 1 time at 1200 bar; for the second time, use 10 times the amount of water, pre-disperse it once at 700 bar, and then homogenize and circulate it 8 times at 1200 bar. The emulsion is separated by a plate-and-frame filter press, and the emulsions of the two times are combined. The others are the same as in Example 1.

[0078] Comparative Example 1: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0079] Take the Ganoderma lucidum spore powder after supersonic airflow wall-breaking and supercritical extraction, and extract it with water 2 times; for the first time, use 12 times the amount of water, heat it under oil bath reflux for 2 h; for the second time, use 10 times the amount of water, heat it under oil bath reflux for 2 h, filter it with a plate-and-frame filter press, and combine the filtrates. Pump the filtrate into a concentration tank, concentrate it under reduced pressure to a relative density of 1.08, the vacuum degree of reduced pressure concentration is -0.07 Mpa, and the temperature is 70 °C. Add 3 times the volume of 95% ethanol to the concentrated solution, stir evenly, let it stand for 12 h, centrifuge, take the supernatant and concentrate it to a relative density of 1.06, and spray-dry it to obtain the small molecule peptide compound.

[0080] Comparative Example 2: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0081] Take the Ganoderma lucidum spore powder after supersonic airflow wall-breaking and supercritical extraction, and extract it by ultrasonic wave 2 times; for the first time, use 12 times the amount of water, extract it by ultrasonic wave at a power of 800 W for 0.5 h; for the second time, use 10 times the amount of water, extract it by ultrasonic wave at a power of 800 W for 0.5 h. The extract is separated by a centrifuge into the supernatant and the precipitate, and the centrifuged supernatants are combined. Pump the supernatant into a concentration tank, concentrate it under reduced pressure to a relative density of 1.08, the vacuum degree of reduced pressure concentration is -0.07 Mpa, and the temperature is 70 °C. Add 3 times the volume of 95% ethanol to the concentrated solution, stir evenly, let it stand for 12 h, centrifuge, take the supernatant and concentrate it to a relative density of 1.06, and spray-dry it to obtain the small molecule peptide compound.

[0082] Comparative Example 3: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0083] Take the Ganoderma lucidum spore powder after supersonic airflow wall-breaking and supercritical extraction, and add enzymes for extraction; first add 10 times the amount of water, add a saturated sodium citrate solution to adjust the pH to 6, then add papain at 2% of the mass of the spore powder, and extract at 50°C for 2 hours by warm soaking; use a NaOH solution to adjust the pH of the extraction solution to 9.0, then add alkaline protease at 2% of the mass of the spore powder, and extract at 50°C for 2 hours by warm soaking; after the warm soaking is completed, boil to inactivate the enzyme for 20 minutes and filter. Pump the filtrate into a concentration tank, and concentrate it under reduced pressure to a relative density of 1.08, with a reduced pressure concentration vacuum degree of -0.07 Mpa and a temperature of 70°C. Add 3 times the volume of 95% ethanol to the concentrated solution, stir evenly, let it stand for 12 hours, centrifuge, take the supernatant and concentrate it to a relative density of 1.06, and spray-dry it to obtain the small molecule peptide compound.

[0084] Comparative Example 4: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0085] The difference between this comparative example and Example 1 is that 1 times the volume of 95% ethanol is added to the concentrated solution, and the others are the same as in Example 1.

[0086] Comparative Example 5: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0087] The difference between this comparative example and Example 1 is that 4 times the volume of 80% ethanol is added to the concentrated solution, and the others are the same as in Example 1.

[0088] Comparative Example 6: A method for preparing small molecule peptides from Ganoderma lucidum spore powder

[0089] The difference between this comparative example and Example 1 is that 3 times the volume of 65% ethanol is added to the concentrated solution, and the others are the same as in Example 1.

[0090] Example 7: Determination of small molecule peptides

[0091] The small molecule peptide compounds obtained in Examples 1-6 and Comparative Examples 1-6 were determined, and the specific determination method is as follows:

[0092] Detect the relative molecular mass distribution of peptides according to the method in Appendix A of GB / T 22492-2008 Soybean Peptide Powder, and detect the peptide content according to the method in Appendix B of GB / T 22492-2008 Soybean Peptide Powder.

[0093] The determination results of different small molecule peptide compounds are shown in Table 2. Among different extraction methods, the peptide content in the compounds extracted by the high-pressure homogenization method is the highest, and the proportion of low-molecular-weight small molecule peptides is the highest; among different ethanol extraction methods, the peptide content in the compounds obtained with 3 times the volume of 95% ethanol is the highest, and the proportion of low-molecular-weight small molecule peptides is the highest, indicating that the extraction effect of high-pressure homogenization extraction combined with 3 times the volume of 95% ethanol extraction is the best.

[0094] Table 2 Compound data obtained by different extraction methods

[0095]

[0096]

[0097] Example 8: Anti-inflammatory activity detection (in vitro experiment)

[0098] The anti-inflammatory activities of the small molecule peptide compounds obtained in Example 1 and Comparative Examples 1-3 were detected. The specific experimental method is as follows:

[0099] The different small molecule peptide compounds were respectively formulated into sample solutions of 1 mg / mL and 2 mg / mL. When the RAW264.7 cells grew to about 40% confluence, the original culture medium was aspirated. The control group was added with 2 mL of DMEM medium, the model group was added with 2 mL of LPS (1 μg / mL) solution, and the sample group was added with 2 mL of different small molecule peptide sample solutions containing LPS (1 μg / mL). The cells were placed in a CO2 incubator and incubated for another 24 h, rinsed twice with PBS, the RNA of each group of cells was extracted, and the concentration and quality of the RNA were measured by a NanoDrop One ultra-micro ultraviolet-visible spectrophotometer. According to the operation method of the RNA reverse transcription kit, the RNA was reverse transcribed into cDNA. According to the operation method of the real-time quantitative PCR kit, SYBR Green I fluorescence dye method was used to amplify the cDNA, and the relative expression levels of IL-6 and IL-1β were calculated based on the Ct values; three parallel experiments were set for each group.

[0100] The treatment results of different sample solutions are shown in Table 3 and Table 4. Table 3 shows the effects of small molecule peptides obtained by different methods on the expression of IL-6 and IL-1β at the 1 mg / ml level, and Table 4 shows the effects of small molecule peptides obtained by different methods on the expression of IL-6 and IL-1β at the 2 mg / ml level; the data in the tables were statistically sorted into a column chart, as Figure 1 and Figure 2 shown.

[0101] Table 3 Comparison of the effects of small molecule peptides with different treatment methods (1 mg / mL)

[0102]

[0103] Table 4 Comparison of the effects of small molecule peptides with different treatment methods (2 mg / mL)

[0104]

[0105] The results showed that after LPS stimulation of RAW264.7 in the model group, the expressions of IL-6 and IL-1β were significantly increased. The small molecule peptides treated by 4 methods had good inhibitory effects on the expressions of IL-6 and IL-1β at two concentration levels. Moreover, the higher the concentration of the small molecule peptides, the stronger the inhibitory effect, indicating that all 4 small molecule peptides had significant anti-inflammatory activities. At the same concentration level, the small molecule peptides treated by high-pressure homogenization had more significant down-regulation of the relative expressions of IL-6 or IL-1β and better effects, and could be used to prepare products for relieving inflammation.

[0106] Example 9: Detection of anti-neuroinflammatory activity (in vivo experiment)

[0107] The small molecule peptide compounds obtained in Example 1 and Comparative Examples 1-3 were detected for anti-neuroinflammatory activity. The specific experimental method was as follows:

[0108] (1) Sample preparation

[0109] An appropriate amount of the small molecule peptide compounds prepared in Example 1 and Comparative Examples 1-3 was taken and formulated into a sample solution of 10 mg / mL with sterile water for standby.

[0110] (2) Experimental animals

[0111] 6-week-old ICR mice, weighing 18-22 g, were purchased from the Experimental Animal Center of Zhejiang Academy of Medical Sciences and raised in the SPF-level experimental animal environment of Zhejiang Shouxian Valley Phytomedicine Research Institute Co., Ltd. The optimal temperature was 20-26 °C, the environmental relative humidity was 50%-60%, and the mice had free access to food and water.

[0112] (3) Experimental method

[0113] Sixty ICR mice, with an equal number of males and females, were adaptively fed for 7 days. The mice were randomly divided into a normal control group, a sleep deprivation model group, and a small molecule peptide group (100 mg / kg / day) according to their body weights, with 10 mice in each group. Among them, the mice in the small molecule peptide group were intragastrically administered the specified dose of the sample solution once a day for 9 consecutive days. The normal control group and the sleep deprivation model group were given an equal amount of sterile water once a day. On the 8th day after administering the sample, the mice in the sleep deprivation model group and the small molecule peptide group were transferred to a sleep deprivation instrument for 48 hours of sleep deprivation. After the experiment, the body weights of the mice were measured, and the mice were sacrificed to obtain brain tissues. The expression levels of TNF-α, IL-6, and IL-1β in the brain tissues were detected by qPCR. The experimental method refers to the reference "Pan H, et al. Autophagic flux disruption contributes to Ganoderma lucidum polysaccharide-induced apoptosis in human colorectal cancer cells via MAPK / ERK activation. Cell Death Dis, 2019, 10(6):456". The primer sequences used for qPCR detection are shown in Table 5.

[0114] Table 5 Primer sequences for qPCR experiments

[0115] gene upstream sequence (5’-3’) downstream sequence (5’-3’) TNF-α GCCTCCCTCTCATCAGTTCTA GGCAGCCTTGTCCCTTG IL-6 AGACCCAGATTGTGACTTGC CGAGATACTTCATCCTACCCA IL-1β GTCCTCAGAAGCTAACCATCTCC CCAGAGCCTATGACTCCATGTC GAPDH TGAACGGGAAGCTCATGG GAGCTTCACAAAGTTGTCATTGAG

[0116] (4) Experimental results

[0117] The expression levels of TNF-α, IL-6, and IL-1β in the brain tissues of mice in each group are shown in Table 6; the data in the table were statistically sorted into a column chart, as Figure 3 shown.

[0118] Table 6 Comparison of the effects of small molecule peptides with different treatment methods

[0119]

[0120] The results showed that compared with the normal control group, the expression levels of TNF-α, IL-6, and IL-1β in the brain tissues of mice in the sleep deprivation model group were significantly increased. Small molecule peptides treated by 4 methods all had a certain inhibitory effect on the expression of TNF-α, IL-6, and IL-1β in the brain tissues, and the small molecule peptides treated by the high-pressure homogenization method had the best inhibitory effect on TNF-α, IL-6, and IL-1β in the brain tissues and could be used to prepare products for relieving inflammation.

[0121] Example 10: Detection of immunomodulatory activity (in vivo experiment)

[0122] The immunomodulatory activities of the small molecule peptide compounds obtained in Example 1 and Comparative Examples 1-3 were detected. The specific experimental method is as follows:

[0123] (1) Sample preparation

[0124] An appropriate amount of the small molecule peptide compounds prepared in Example 1 and Comparative Examples 1-3 was taken and formulated into a sample solution of 10 mg / mL with sterile water for standby.

[0125] (2) Experimental animals

[0126] ICR mice were purchased from the Experimental Animal Center of Zhejiang Academy of Medical Sciences and raised in the SPF-level experimental animal environment of Zhejiang Shouxian Valley Phytomedicine Research Institute Co., Ltd. The optimal temperature was 20-26 °C, the environmental relative humidity was 50%-60%, and the mice had free access to food and water.

[0127] (3) Experimental method

[0128] Sixty ICR mice, 30 males and 30 females, including 10 mice at 3 months old (body weight 30-35 g) and 50 mice at 14 months old (body weight 40-50 g), were adaptively fed for 7 days. The 14-month-old mice were randomly divided into an old model group and a small molecule peptide group (100 mg / kg / day) according to body weight, and the 3-month-old mice were used as the young control group, with 10 mice in each group. Among them, the small molecule peptide group was given the specified dose of the sample solution by gavage for 8 consecutive weeks, once a day. The young control group and the old model group were given an equal amount of sterile water, once a day. The body weights of the mice were measured 24 hours after the last gavage treatment. Then the mice were sacrificed, and blood was collected from the abdominal aorta. Flow cytometry was used to detect the proportions of circulating blood CD3 + CD4 + and CD3 + CD8 + T lymphocytes. The specific detection method refers to the reference "Yang J, et al. Protective effects of Ganoderma lucidum spores on estradiol benzoate-induced TEC apoptosis and compromised double-positive thymocyte development. Front Pharmacol, 2024, 15: 1419881".

[0129] (4) Experimental results

[0130] The detection results of the subtypes and proportions of circulating blood T lymphocytes in each group of mice are shown in Table 7; the data in the table were statistically sorted into a column chart, as Figure 4 shown.

[0131] Comparison of the effects of small molecule peptides with different treatment methods

[0132]

[0133] The results showed that compared with the young control group, the proportions of CD3 + CD4 + and CD3 + CD8 + T lymphocytes in the circulating blood of the elderly model group mice were significantly decreased. The small molecule peptides treated by 4 methods all had a certain promoting effect on the proportions of CD3 + CD4 + and CD3 + CD8 + T lymphocytes, and the increase in the proportions of CD3 + CD4 + and CD3 + CD8 + T lymphocytes was related to the enhancement of immunity. Among them, the small molecule peptides treated by the high-pressure homogenization method had a significantly stronger promoting effect on CD3 + CD4 + and CD3 + CD8 + T lymphocytes than those treated by the heat reflux method and the enzyme extraction method, and were superior to the small molecule peptides treated by the ultrasonic extraction method, and could be used to prepare products for enhancing immunity.

[0134] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than a limitation on the protection scope of the present invention. Any simple modification or equivalent replacement made by those of ordinary skill in the art to the technical solution of the present invention does not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A preparation method of a small molecule peptide, characterized in that, It includes the following steps: S1: Mix the wall-broken and defatted ganoderma lucidum spores powder with water, perform pressure homogenization and emulsification, and solid-liquid separation to obtain an emulsion and spore wall shells; S2: Concentrate the emulsion to obtain a concentrated solution; S3: Add edible ethanol to the concentrated solution, stir evenly and then centrifuge, and take the supernatant; S4: Concentrate the supernatant, and obtain a small molecule peptide compound after drying.

2. The preparation method according to claim 1, wherein In step S1, the wall-broken and defatted ganoderma lucidum spores powder is mixed evenly with water at a mass ratio of 1:4 - 1:

20.

3. The preparation method according to claim 1, wherein In step S1, the pressure homogenization includes pre-dispersion and homogenization. The pressure homogenization is to pre-disperse once first, and then homogenize 1 - 8 times.

4. The preparation method according to claim 3, characterized in that, In step S1, the pressure of the pre-dispersion is 600 bar - 800 bar, and the pressure of the homogenization is 800 bar - 5000 bar.

5. The preparation method according to claim 1, wherein, In step S2, the concentration is vacuum concentration. The conditions for vacuum concentration are to concentrate to a relative density of 1.01 - 1.10, the vacuum degree range for vacuum concentration is -0.05 Mpa to -0.09 Mpa, and the temperature is 60°C - 80°C.

6. The preparation method according to claim 1, characterized in that, In step S3, 2 - 5 times the volume of 95% ethanol is added to the concentrated solution, stirred evenly and then left to stand for 12 h, and then centrifuged after standing.

7. The preparation method according to claim 1, characterized in that, In step S4, the supernatant is concentrated to a relative density of 1.01 - 1.10, and a small molecule peptide compound is obtained after spray drying.

8. A small molecule peptide, characterized in that, The small molecule peptide is prepared by the preparation method according to any one of claims 1 - 7.

9. Use of the small molecule peptide according to claim 8 in the preparation of a product for relieving inflammation or enhancing immunity.

10. A product containing the small molecule peptide described in claim 8, characterized in that, The product includes food, health products or drugs.

Images