Preparation method of influenza D virus M1 protein polyclonal antibody

Abstract

The invention discloses a preparation method of a D-type influenza virus M1 protein polyclonal antibody. The method comprises the following steps: firstly, screening antigen epitopes through bioinformatics, constructing a recombinant prokaryotic expression vector pET28a-M1 by utilizing a seamless cloning technology, efficiently expressing M1 protein in escherichia coli, and remarkably improving the yield of inclusion body protein by optimizing induction temperature, IPTG concentration and induction time; and purifying by adopting affinity chromatography to obtain high-purity recombinant protein, emulsifying the high-purity recombinant protein and a Freund's adjuvant, immunizing a Japanese white rabbit, immunizing for three times, and collecting high-titer serum. The method breaks through detection limitation caused by antigen tag concealment in a eukaryotic expression system, the obtained polyclonal antibody is high in specificity, the M1 protein expressed in the eukaryotic mode can be accurately recognized, and a key tool is provided for virus-like particle identification of the influenza D virus, vaccine research and development and a diagnosis technology. Compared with a traditional method, the scheme is simple and convenient to operate, low in cost and high in antibody titer, and has remarkable application value.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for preparing a polyclonal antibody against the M1 protein of Influenza D Virus (IDV). Background Art

[0002] In biological and medical research, polyclonal antibodies are widely used because of their relatively simple preparation, low cost, and ability to recognize multiple antigenic epitopes.

[0003] As an important component of Influenza D Virus (IDV), the M1 protein plays a key role in virus replication and pathogenic mechanisms. Therefore, preparing polyclonal antibodies against the M1 protein is of great significance for in-depth study of the biological characteristics of IDV, development of diagnostic reagents, and vaccines.

[0004] However, traditional methods for preparing polyclonal antibodies often have problems such as low antigen purity and poor antibody specificity, which affect the quality and application effect of the antibodies. Especially for the preparation of polyclonal antibodies against the M1 protein, due to the complexity of IDV and the particularity of the M1 protein, a more efficient and reliable antibody preparation method is needed.

[0005] The present invention aims to provide a novel method for preparing polyclonal antibodies against the M1 protein of Influenza D Virus. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for preparing a polyclonal antibody against the M1 protein of Influenza D Virus to solve the problems raised in the above background art.

[0007] To achieve the above purpose, the present invention provides the following technical solutions:

[0008] 1. A method for preparing a polyclonal antibody against the M1 protein of Influenza D Virus, comprising the following steps:

[0009] 1.1 Construction of pET28a-M1 plasmid

[0010] 1.1.1 Primer design: Screening antigenic epitopes through bioinformatics analysis according to the nucleic acid sequence of GenBank Influenza D virus M1 (NC_036620.1), and designing primers containing BamHI and XhoI restriction enzyme sites in combination with the sequence of the expression vector pET28a vector;

[0011] 1.1.2 Amplification of target gene: Using the cDNA of D / swine / Oklahoma / 1334 / 2011 stored in the laboratory as a template, the uniseamless-pET28a-M1 fragment was amplified using specific primers pET28a+M1-F and pET28a+M1-R for prokaryotic expression of M1 protein;

[0012] 1.1.3 Plasmid construction: The target gene uniseamless-pET28a-M1 and the expression vector pET28a were digested with double enzymes respectively. After purifying the digested products, they were ligated using seamless cloning technology to construct the recombinant plasmid pET28a-M1. The reaction products were transformed into E.coli DH5ɑ competent cells, and positive clones were screened and plasmid extraction and sequencing verification were carried out;

[0013] 1.2 Expression and purification of M1 protein

[0014] 1.2.1 Small-scale induction expression: The pET28a-M1 plasmid was transformed into Transetta(DE3) competent cells, and the expression conditions were optimized from the induction temperature, IPTG concentration, and induction time. The products were identified by SDS-PAGE;

[0015] 1.2.2 Large-scale induction expression: The optimal expression conditions were selected for large-scale induction, the bacteria were collected and lysed to obtain the lysate containing the target protein;

[0016] 1.2.3 Purification: The M1 protein was purified by affinity chromatography. Through the steps of filtration sterilization, nickel column equilibration, nickel column binding to the protein, and protein elution, high-purity M1 protein was obtained;

[0017] 1.3 Preparation and identification of polyclonal antibody

[0018] 1.3.1 Immunization of animals: The purified pET28a-M1 protein emulsified with Freund's adjuvant was used as an antigen to immunize 2-month-old Japanese white rabbits. Complete Freund's adjuvant was used for the first immunization, and Freund's incomplete adjuvant was used for two booster immunizations at intervals of 2 weeks and 4 weeks respectively;

[0019] 1.3.2 Collection of serum: Serum was collected 7 days after the last immunization to obtain the polyclonal antibody against M1 protein and stored at -80℃;

[0020] 1.3.3 Detection of antibody titer: The antibody titer was determined by indirect ELISA detection method;

[0021] 1.3.4 Identification of antibody specificity: The antibody specificity was determined by Westernblot identification.

[0022] 1.3.5 Indirect immunofluorescence assay: Identification that the prepared polyclonal antibody against DM1 can specifically bind to the eukaryotic expressed protein

[0023] 2. The primer sequences for PCR amplification described in step 1.1.1 are as follows:

[0024] pET28a+M1-F: AATGGGTCGCGGATCCATGGCACAAGAACAACTACTTGCT;

[0025] pET28a+M1-R: GGTGGTGGTGCTCGAGCTTCCAGTCTCTTTTTAGGGCAAGAT.

[0026] 3. According to the preparation method described in claim 1, characterized in that the specific method for amplifying the M1 target gene in step 1.1.2 is: according to a 25 μL PCR reaction system containing 1.5 μL cDNA template, 1 μL forward primer pET28a+M1-F, 1 μL reverse primer pET28a+M1-R, 12.5 μL 2×HIFI Mix and 9 μL ddH2O, perform a thermal cycling program including the following steps for target gene amplification: pre-denaturation at 95 °C for 5 minutes; 30 cycles of amplification steps, each cycle including denaturation at 95 °C for 30 seconds, annealing at 62 °C for 30 seconds, extension at 72 °C for 1 minute; final extension at 72 °C for 5 minutes; after the amplification product is separated by agarose gel electrophoresis, it is purified by gel recovery technology to obtain the uniseamless-pET28a-M1 fragment.

[0027] Compared with the prior art, the beneficial effects of the present invention are:

[0028] The present invention provides an efficient method for extracting and purifying M1 protein from Influenza D virus (IDV).

[0029] By constructing the uniseamless-pET28a-M1 recombinant plasmid and achieving efficient expression and purification in Escherichia coli, highly pure M1 protein is obtained, which serves as an ideal antigen for preparing polyclonal antibodies. The optimized antibody preparation process: using the purified M1 protein as an antigen, polyclonal antibodies are prepared by immunizing Japanese white rabbits. The process is simple, controllable, and has a high antibody yield. This method effectively solves problems such as low antigen purity and poor antibody specificity in the traditional antibody preparation process.

[0030] Meanwhile, through detection, the prepared polyclonal antibodies have a high titer, showing good antibody activity. At the same time, the identification results show that the antibodies have a high specific binding ability to M1 protein and a low cross-reaction with other related proteins, ensuring the quality and usability of the antibodies.

[0031] Meanwhile, the present invention has broad application prospects. The method for preparing M1 polyclonal antibody of the present invention not only provides a powerful tool for the in-depth study of IDV, but also may play an important role in the development of IDV diagnostic reagents and vaccines. In addition, this method also has potential generality and can be applied to the preparation of polyclonal antibodies against other viruses or proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Results of pET28a-M1 gene amplification in the examples of the present invention

[0033] Figure 2 Results of bacterial liquid PCR identification in the examples of the present invention

[0034] Figure 3 Optimization of induction temperature conditions in the examples of the present invention

[0035] Figure 4 Optimization of IPTG induction conditions in the examples of the present invention

[0036] Figure 5 Optimization of induction time conditions in the examples of the present invention

[0037] Figure 6 Identification of M1 protein purification by SDS-PAGE in the examples of the present invention

[0038] Figure 7 Identification of purified M1 protein by Western blot in the examples of the present invention

[0039] Figure 8 Identification of M1 polyclonal antibody by Western blot in the examples of the present invention

[0040] Figure 9 Indirect immunofluorescence identification of M1 polyclonal antibody in the examples of the present invention DETAILED DESCRIPTION OF THE EMBODIMENTS

[0041] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0042] Example 1:

[0043] (1) Construction of pET28a-M1 plasmid

[0044] 1. Primer design: Epitopes were screened through bioinformatics analysis based on the nucleic acid sequence of GenBank Influenza D virus M1 (NC_036620.1), and primers containing BamHI and XhoI restriction sites were designed in combination with the sequence of the expression vector pET28a. The detailed primer sequences are shown in Table 1 and were sent to Jilin Kumei Biotechnology Co., Ltd. for synthesis.

[0045] Table 1 M1 primer sequences

[0046]

[0047] 2. Amplification of the target gene: Using the cDNA of D / swine / Oklahoma / 1334 / 2011 stored in the laboratory as a template, specific primers pET28a + M1-F and pET28a + M1-R were used to amplify the uniseamless-pET28a-M1 fragment for prokaryotic expression of the M1 protein according to the reaction system in Table 2 and the reaction program in Table 3.

[0048] Table 2 PCR reaction system

[0049]

[0050] Table 3 PCR reaction program

[0051]

[0052] The amplified product was separated and verified by agarose gel electrophoresis, and the uniseamless-pET28a-M1 fragment was recovered and purified by gel extraction. The purified sample was entrusted to Jilin Kumei Biotechnology to complete the bidirectional sequencing analysis.

[0053] 3. Double digestion of the target fragment and the expression vector

[0054] The pET28a(+) empty vector was double digested with the restriction endonucleases BamHI and XhoI in a water bath at 37 °C for 30 min to obtain a linearized vector. The digestion system is shown in Table 4:

[0055] Table 4 Double digestion reaction system table

[0056]

[0057] 4. Ligation of the target fragment and the expression vector

[0058] The digested products were separated by agarose gel electrophoresis, and the target fragment was recovered using a kit. The pET28a(+) linearized vector and the uniseamless-pET28a-M1 fragment were cloned seamlessly using Assembly Mix. The seamless cloning reaction system is shown in Table 5

[0059] Table 5 Seamless Cloning Reaction System

[0060]

[0061] 5. Recombinant Vector Transformation

[0062] Place it in a PCR instrument and react at 50 °C for 15 minutes, then place it on ice for a few seconds and wait for transformation. Transform the reaction product into E. coli DH5ɑ competent cells. The specific operation is as follows:

[0063] (1) Add the reaction product to 50 μL of competent cells and then let it stand in an ice - water mixture for 30 min.

[0064] (2) Put it in a 42 °C water bath for heat shock for 1 min, then quickly take it out and ice - bath for 3 min.

[0065] (3) Add 0.5 ml of non - resistant LB in a laminar flow hood and shake it on a shaker at 37 °C for 1 h.

[0066] Take 200 μL and spread it evenly on an LB plate with kanamycin resistance. Incubate it upright in a 37 °C incubator for 1 h first and then invert it for overnight incubation.

[0067] 6. Screening of Positive Clonal Colonies

[0068] The next day, observe the colony growth. In a laminar flow hood, pick a single colony with a sterile pipette tip and transfer it to a liquid LB medium with Kna resistance, and culture it on a shaker at 37 °C for 4 h. Use the T7 universal primer and specific primers

[0069] pET28a + M1 - F / R for colony PCR identification. The reaction system and reaction program are shown in Table 6 and Table 7:

[0070] Table 6 Colony PCR Reaction System

[0071]

[0072] Table 7 Colony PCR Reaction Program

[0073]

[0074]

[0075] 7. Plasmid Extraction and Sequencing

[0076] Extract the plasmid from the positive bacterial solution and send it to Jilin Kumei Biotechnology Co., Ltd. for sequencing. The plasmid with correct sequencing is named pET28a - M1.

[0077] (2) Expression and Purification of M1 Protein

[0078] 1. Small-scale induced expression: Transform the pET28a-M1 plasmid into Transetta(DE3) competent cells, optimize the expression conditions from the aspects of induction temperature, IPTG concentration, and induction time respectively, and identify the product by SDS-PAGE.

[0079] (1) Induction temperature: Add an inducer with a final concentration of 0.1 mM IPTG to the bacterial solution, then culture at 16 °C, 28 °C, and 37 °C respectively at 180 rpm for 8 h, followed by ultrasonic disruption. Perform SDS-PAGE identification on the supernatant and precipitate suspension.

[0080] (2) IPTG concentration: Add inducers with final concentrations of 0.05 mM, 0.1 mM, 0.3 mM, 0.5 mM, 0.7 mM, and 1.0 mM IPTG to the bacterial solution respectively. Culture pET28a-M1 at 37 °C and 180 rpm for 8 h, then disrupt it ultrasonically with 6M urea Binding Buffer. Perform SDS-PAGE identification on the supernatant after disruption.

[0081] (3) Induction time: Add an inducer with a final concentration of 0.05 mM IPTG to the pET28a-M1 bacterial solution and induce at 37 °C for 2 h, 4 h, 6 h, 8 h, 10 h, and 12 h respectively. Disrupt the bacteria ultrasonically with 6M urea Binding Buffer. Perform SDS-PAGE identification on the supernatant after disruption.

[0082] 2. Large-scale induced expression: Select the optimal expression conditions for large-scale induction. Centrifuge the bacterial solution at 8000 g for 10 min, discard the supernatant, collect the bacteria, resuspend and wash the bacteria with PBS, then centrifuge at 8000 g for 10 min and discard the supernatant, and wash the bacteria twice. Add 6M urea Binding Buffer, disrupt ultrasonically under ice bath conditions, with a power of 200 w, a pulse of 5 s and an interval of 5 s, for a total of 30 min. Centrifuge the ultrasonic lysate at 8000 g for 30 min, and collect the supernatant for subsequent purification.

[0083] 3. Purification: Purify the M1 protein by affinity chromatography.

[0084] (1) Filter sterilization: Filter the sample, buffer, eluent, and double-distilled water with a 0.22 μm filter respectively.

[0085] (2) Nickel column equilibration: Equilibrate the nickel column with Binding Buffer for 5 column volumes.

[0086] (3) Binding of nickel column and protein: Load the sample and the equilibrated Ni-NTA Resin packing material into the column, and bind them on a shaker at 50 rpm in a chromatography cabinet at 4 °C for 2 h.

[0087] (4) Elution of the protein: Let the supernatant in the column flow out, and use Binding Buffer with a low imidazole concentration of 5 column volumes to elute the miscellaneous proteins, and then use Elution Buffer with a high imidazole concentration of 3 column volumes to elute the target protein. Mark the liquids flowing out successively as: the sample loading solution, the rinsing solution, and the elution solution.

[0088] 4. Identification: Prepare protein samples from the purified sample and the uninduced sample respectively, and conduct identification through SDS-PAGE and Western blot.

[0089] (1) The specific operation of SDS-PAGE is as follows:

[0090] Sample treatment: Take 40 μL of the sample to be tested and mix it with 5× protein loading buffer at a volume ratio of 4:1, boil in a boiling water bath for 10 minutes to fully denature the protein, then centrifuge at 8000×g for 5 minutes, and take the supernatant for standby.

[0091] Gel preparation: Use the Yaenzyme protein gel preparation kit to prepare a 10% SDS-PAGE separation gel, and let it stand for polymerization for 30 minutes.

[0092] Sample loading and electrophoresis: Accurately load 10 μL of the treated sample into each well, initially set the constant voltage electrophoresis at 80V, and adjust it to 120V constant voltage after the bromophenol blue indicator migrates to the interface of the separation gel, and continue electrophoresis until the indicator reaches the bottom of the gel.

[0093] Staining and decolorization: After electrophoresis, immerse the separation gel in Coomassie Brilliant Blue staining solution and shake for staining for 2 hours, transfer it to the decolorizing solution (10% acetic acid + 20% methanol) and shake for decolorization for 8 - 12 hours until the background is transparent, and finally use the gel imaging system to collect and analyze.

[0094] (2) The specific operation of Western blot is as follows:

[0095] Membrane transfer operation: After completing gel preparation and electrophoresis according to the SDS-PAGE standard procedure, accurately cut out the gel area containing the target protein and the protein Marker; Immerse the gel block, filter paper, and PVDF membrane activated with methanol for 30 seconds in the transfer buffer for equilibration for 10 minutes; Stack the transfer sandwich in the order of "filter paper - PVDF membrane - gel - filter paper", completely remove the air bubbles, and transfer the membrane at a constant voltage of 20V for 30 minutes.

[0096] Blocking and antibody incubation: After membrane transfer, immerse the PVDF membrane in 5% skim milk powder (dissolved in PBST) and block at room temperature for 1 hour; Transfer the membrane to the diluted primary antibody solution (diluted 1:2000 in 5% skim milk powder), and incubate with shaking at 4°C for 12 - 16 hours; Wash with PBST with shaking at room temperature (5 minutes × 3 times) to remove the unbound antibody.

[0097] Secondary antibody reaction and development: Immerse the membrane in the HRP-labeled secondary antibody solution (diluted 1:5000 in 5% skim milk powder), incubate with shaking at room temperature for 40 minutes; after washing three times with PBST, mix the ECL chemiluminescent solution A / B in a 1:1 ratio and evenly cover the surface of the membrane; expose in a darkroom for 30 seconds - 5 minutes using a chemiluminescent imager to capture specific signals.

[0098] (III) Preparation and identification of polyclonal antibodies

[0099] 1. Animal immunization protocol

[0100] (1) Antigen preparation: Emulsify the purified pET28a-M1 protein with Freund's adjuvant at a volume ratio of 1:1 and vortex to form a stable emulsion.

[0101] (2) Immunization procedure: Inject the antigen containing complete Freund's adjuvant (dose 500 μg / animal) subcutaneously at multiple points on the back of 2-month-old Japanese white rabbits; at 2-week and 4-week intervals, inject the same amount of antigen containing incomplete Freund's adjuvant.

[0102] 2. Serum collection and preservation

[0103] On the 7th day after the last immunization, collect blood from the marginal ear vein, let it stand at 4°C for 2 hours, then centrifuge at 3000×g for 15 minutes, separate the serum, aliquot and store it at -80°C for long-term preservation.

[0104] 3. Antibody titer detection (indirect ELISA)

[0105] (1) Antigen coating: Dilute the M1 protein with CBS buffer to 1 μg / mL, coat a 96-well ELISA plate with 100 μL / well, and incubate at 4°C for 12 - 16 hours.

[0106] (2) Blocking and washing: Discard the coating solution, wash 3 times with 200 μL / well of PBST (0.05% Tween-20), block with 100 μL / well of 5% skim milk powder, and incubate at 37°C for 1 hour.

[0107] (3) Serum incubation: Dilute the serum in a 2-fold gradient (800 - 1,638,400-fold), add 100 μL / well, incubate at 37°C for 1 hour, and wash 3 times with PBST.

[0108] (4) Secondary antibody reaction: Dilute the goat anti-rabbit HRP secondary antibody (1:5000) with 5% skim milk powder, add 100 μL / well, incubate at 37°C in the dark for 1 hour, and wash 3 times with PBST.

[0109] (5) Color development and detection: Add 100 μL / well of TMB substrate, develop color in the dark for 15 minutes, terminate with 50 μL / well of 2M sulfuric acid, measure the OD450 value with an ELISA reader, and determine the titer with a P / N value ≥ 2.1.

[0110] 4. Verification of Antibody Specificity (Western blot)

[0111] (1) Sample treatment: Take the eukaryotic-expressed M1 protein sample and separate it according to the optimized SDS-PAGE procedure;

[0112] (2) Membrane transfer and blocking: After transferring to the PVDF membrane, block it with 5% skim milk powder for 1 hour;

[0113] (3) Antibody incubation:

[0114] Primary antibody: Dilute the M1 polyclonal antibody at 1:2000 and incubate it with shaking at 4°C for 12 hours;

[0115] Secondary antibody: Incubate the goat anti-rabbit HRP (1:5000) at room temperature for 40 minutes;

[0116] Signal detection: Develop with ECL chemiluminescent solution and capture the specific band with an imager.

[0117] 5. Rescue the recombinant baculovirus expressing the M1 protein of influenza D virus using the insect baculovirus expression system, infect sf9 cells, and perform IFA identification using the prepared M1 protein polyclonal antibody as the primary antibody. The steps are as follows:

[0118] (1) Cell infection and culture: Take Sf9 cells in the logarithmic growth phase and inoculate them in a 24-well plate. When the cell density reaches 70%, add the recombinant baculovirus rBV-M1 to the experimental group and do not add virus to the control group. Incubate them in a 27°C incubator for 48 hours synchronously;

[0119] (2) Cell fixation: Discard the culture medium, add 200 μL of 4% paraformaldehyde solution to each well, and fix it at room temperature for 10 minutes;

[0120] (3) Washing treatment: After aspirating the fixing solution, add 200 μL of PBST buffer (containing 0.1% Tween-20, pH 7.4) to each well, wash it with shaking for 5 minutes, and repeat 3 times;

[0121] (4) Cell membrane permeabilization: Add 200 μL of 0.4% Triton X-100 permeabilization solution to each well and treat it at room temperature for 10 minutes;

[0122] (5) Repeat the PBST washing process in step (3);

[0123] (6) Block non-specific binding sites: Add 5% skim milk powder blocking solution to each well and incubate it at 37°C for 1 hour;

[0124] (7) Repeat the PBST washing process in step (3);

[0125] (8) Primary antibody incubation: Dilute the M1 polyclonal antibody at a ratio of 1:500 in PBS buffer, add 500 μL of the diluted solution to each well, and incubate at 4 °C for 16 hours;

[0126] (9) Repeat the PBST washing procedure in step (3) to remove unbound primary antibody;

[0127] (10) Secondary antibody labeling: Dilute the FITC-labeled secondary antibody at a ratio of 1:1000 in PBS buffer, add 200 μL of the diluted solution to each well, and incubate at room temperature in the dark for 1 hour;

[0128] (11) Repeat the PBST washing procedure in step (3) to remove unbound secondary antibody;

[0129] (12) Nuclear staining: Add 200 μL of DAPI staining solution to each well and stain at room temperature for 10 minutes in the dark;

[0130] (13) Final washing: Add 200 μL of PBST buffer to each well, wash by shaking 3 times, 5 minutes each time;

[0131] (14) Fluorescence detection: Place the 24-well plate under an inverted fluorescence microscope and observe the protein expression and nuclear localization of the experimental group and the control group through the FITC channel (excitation wavelength 490 nm / emission wavelength 525 nm) and the DAPI channel (excitation wavelength 358 nm / emission wavelength 461 nm) respectively.

Claims

1. A method for preparing a polyclonal antibody against the M1 protein of influenza D virus, characterized by comprising the following steps: 1.1 Construction of pET28a-M1 plasmid 1.1.1 Primer design: According to the nucleic acid sequence of GenBank Influenza D virus M1 (NC_036620.1), antigenic epitopes were screened by bioinformatics analysis, and primers containing BamHI and XhoI restriction enzyme sites were designed in combination with the sequence of the expression vector pET28a. 1.1.2 Amplification of the target gene: Using the cDNA of D / swine / Oklahoma / 1334 / 2011 stored in the laboratory as a template, the uniseamless-pET28a-M1 fragment was amplified using specific primers pET28a+M1-F and pET28a+M1-R for prokaryotic expression of the M1 protein. 1.1.3 Plasmid construction: The target gene uniseamless-pET28a-M1 and the expression vector pET28a were respectively double-digested, and after purifying the digested products, they were ligated using seamless cloning technology to construct the recombinant plasmid pET28a-M1. The reaction product was transformed into E.coli DH5ɑ competent cells, and positive clones were screened and plasmid extraction and sequencing verification were carried out. 1.2 Expression and purification of M1 protein 1.2.1 Small-scale induction expression: The pET28a-M1 plasmid was transformed into Transetta(DE3) competent cells, and the expression conditions were optimized from the induction temperature, IPTG concentration, and induction time. The product was identified by SDS-PAGE. 1.2.2 Large-scale induction expression: The optimal expression conditions were selected for large-scale induction, the bacteria were collected and lysed to obtain a lysate containing the target protein. 1.2.3 Purification: The M1 protein was purified by affinity chromatography. Through the steps of filtration sterilization, nickel column equilibration, nickel column binding to the protein, and protein elution, high-purity M1 protein was obtained. 1.3 Preparation and identification of polyclonal antibody 1.3.1 Immunizing animals: The purified pET28a-M1 protein emulsified with Freund's adjuvant was used as an antigen to immunize 2-month-old Japanese white rabbits. Complete Freund's adjuvant was used for the first immunization, and Freund's incomplete adjuvant was used for two booster immunizations at intervals of 2 weeks and 4 weeks respectively. 1.3.2 Collecting serum: Serum was collected 7 days after the last immunization to obtain a polyclonal antibody against the M1 protein, which was stored at -80°C. 1.3.3 Antibody titer detection: The antibody titer was determined by the indirect ELISA detection method; 1.3.4 Antibody specificity identification: The antibody specificity was determined by Western blot identification; 1.3.5 Indirect immunofluorescence detection: It was identified that the prepared DM1 polyclonal antibody could specifically bind to the eukaryotic expression protein.

2. According to the preparation method of the polyclonal antibody against D-type influenza virus M1 protein described in claim 1, characterized in that, The PCR amplification primer sequences described in step 1.1.1 are as follows: pET28a+M1-F: AATGGGTCGCGGATCCATGGCACAAGAACAACTACTTGCT; pET28a+M1-R: GGTGGTGGTGCTCGAGCTTCCAGTCTCTTTTTAGGGCAAGAT.

3. According to the preparation method of the polyclonal antibody against influenza D virus M1 protein described in claim 1, wherein, The specific method for amplifying the M1 target gene described in step 1.1.2 is as follows: According to the 25 μL PCR reaction system containing 1.5 μL cDNA template, 1 μL forward primer pET28a+M1-F, 1 μL reverse primer pET28a+M1-R, 12.5 μL 2×HIFI Mix and 9 μL ddH2O, perform the thermal cycling program including the following steps for target gene amplification: pre-denaturation at 95°C for 5 minutes; 30 cycles of amplification steps, each cycle including denaturation at 95°C for 30 seconds, annealing at 62°C for 30 seconds, extension at 72°C for 1 minute; final extension at 72°C for 5 minutes; after the amplification product was separated by agarose gel electrophoresis, the uniseamless-pET28a-M1 fragment was purified by gel recovery technology.

Images