Streptomyces flagstone and application thereof in resisting ralstonia solanacearum
Streptomyces slate Zst-LLL-767 solves the environmental pollution and drug resistance problems of chemical pesticides to prevent and treat diseases by antagonizing the bacterium and promoting plant growth, and provides safe and effective biological control channels.
Patent Information
- Application Number
- CN202510415263.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-07-04
AI Technical Summary
The existing chemical pesticide prevention and control of green wilt has problems with environmental pollution and pathogenic resistance, and a safe and effective biological control method is needed.
Streptomyces chromophyces Zst-LLL-767 is used to fight against the cyperus, and is prepared into liquid bacteria agents, which are used in tomatoes and tobacco. They can prevent and treat cyperus through antagonism and promote plant growth.
Streptomyces slate Zst-LLL-767 significantly inhibits the growth of cyperidus and prevents the development of diseases. At the same time, it is environmentally friendly and does not easily develop drug resistance, promotes plant growth, and supports sustainable agricultural development.
Smart Images

Figure CN120249115A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological control, and provides a Streptomyces lapidosus and its application in resisting Ralstonia solanacearum. Background Art
[0002] Plant diseases have always been one of the key factors threatening crop yields and quality in the field of modern agricultural production. Among them, Ralstonia solanacearum has brought serious disasters to the normal growth of many plants and is a highly harmful pathogenic bacterium. Common crops such as tomatoes and tobacco can be infected by Ralstonia solanacearum, resulting in bacterial wilt. Once a plant is infected with bacterial wilt, the vascular system inside the plant will be damaged, and the transportation channels of water and nutrients will be blocked. As a result, the plant will show symptoms such as leaf wilting and withering, ultimately leading to a significant reduction in crop yields. In severe cases, the crop may even fail, causing huge economic losses to agricultural practitioners.
[0003] For a long time, the main means of controlling bacterial wilt has been the use of chemical pesticides. Chemical pesticides did play a positive role in controlling bacterial wilt to a certain extent in the initial stage of application. By directly acting on pathogenic bacteria and inhibiting their growth and reproduction, the probability of disease occurrence was reduced. However, with the extensive and long-term use of chemical pesticides, many negative problems have become increasingly prominent. On the one hand, a large amount of chemical pesticides are sprayed into the farmland environment and are difficult to completely degrade in a short time. They will remain in the soil, water bodies, and on the surfaces of crops, etc., thus causing serious environmental pollution. These residual pesticide components enter natural water bodies during processes such as rainwashing and irrigation, which will affect the living environment of aquatic organisms and disrupt the ecological balance; pesticides remaining in the soil may also change the physical and chemical properties of the soil and affect the survival and activities of beneficial microorganisms in the soil. On the other hand, during the long-term exposure to chemical pesticides, pathogenic bacteria such as Ralstonia solanacearum will gradually undergo adaptive changes, that is, the so-called drug resistance. Once pathogenic bacteria develop drug resistance, the original effective dose of chemical pesticides can no longer play a good inhibitory role on them, which forces people to increase the amount of pesticides used, thus falling into a vicious cycle and further increasing the risks of environmental pollution and excessive pesticide residues in agricultural products.
[0004] In such a severe situation, it is of crucial practical significance to find a safe and effective biological control method that can not only effectively control bacterial wilt but also be environmentally friendly and cause no excessive negative effects. Biological control methods usually utilize beneficial microorganisms existing in nature or their metabolites, etc., to inhibit the growth of pathogenic bacteria and the spread of diseases in an eco-friendly manner, so as to achieve the purpose of protecting the healthy growth of plants. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to provide a Streptomyces ardesiacus and its application in resisting Ralstonia solanacearum, aiming to solve the problem of biological control of Ralstonia solanacearum.
[0006] To achieve the above object, the present invention provides the following technical solutions:
[0007] 1. A strain of Streptomyces ardesiacus Zst-LLL-767, with the Latin name Streptomyces ardesiacus, was deposited at the Guangdong Microbial Culture Collection Center on October 14, 2024. Address: 5th Floor, Experimental Building, No. 100 Compound, Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province. The deposit number is GDMCC NO.65262.
[0008] Preferably, the 16S rDNA sequence of Streptomyces ardesiacus Zst-LLL-767 is as shown in SEQ ID NO.1.
[0009] 2. The application of the above-mentioned strain of Streptomyces ardesiacus Zst-LLL-767 in resisting Ralstonia solanacearum.
[0010] 3. The application of the above-mentioned strain of Streptomyces ardesiacus Zst-LLL-767 in the preparation of a bactericide against Ralstonia solanacearum.
[0011] Preferably, the bactericide is a liquid bactericide, and the concentration of Streptomyces ardesiacus Zst-LLL-767 is 10 9 ~10 10 CFU / mL.
[0012] More preferably, the concentration of Streptomyces ardesiacus Zst-LLL-767 is 5×10 9 CFU / mL.
[0013] More preferably, the inoculation amount of the liquid bactericide is 10 7 ~10 8 CFU / ml.
[0014] 4. A bactericide against Ralstonia solanacearum, the active ingredient of which is the above-mentioned strain of Streptomyces ardesiacus Zst-LLL-767.
[0015] Preferably, the bactericide is a liquid bactericide, and the concentration of Streptomyces ardesiacus Zst-LLL-767 is 10 9 ~10 10 CFU / mL.
[0016] More preferably, the concentration of Streptomyces ardesiacus Zst-LLL-767 is 5×10 9 CFU / mL.
[0017] More preferably, the inoculation amount of the liquid bactericide is 107 ~10 8 CFU / ml。
[0018] 5. Application of the Streptomyces ardesiacus Zst-LLL-767 in promoting plant growth.
[0019] Preferably, the plant is tomato or tobacco.
[0020] 6. A bacterial agent for promoting plant growth, the active ingredient of which is the Streptomyces ardesiacus Zst-LLL-767.
[0021] Preferably, the bacterial agent is a liquid bacterial agent, and the concentration of Streptomyces ardesiacus Zst-LLL-767 is 10 9 ~10 10 CFU / mL.
[0022] More preferably, the concentration of Streptomyces ardesiacus Zst-LLL-767 is 5×10 9 CFU / mL.
[0023] More preferably, the inoculation amount of the liquid bacterial agent is 10 7 ~10 8 CFU / ml.
[0024] The beneficial effects of the present invention are as follows:
[0025] The present invention discloses a Streptomyces ardesiacus Zst-LLL-767 and its application in resisting Ralstonia solanacearum. The Latin name of this strain is Streptomyces ardesiacus, which was deposited in the Guangdong Provincial Microbial Culture Collection Center on October 14, 2024. The deposit date is October 14, 2024, and the deposit number is GDMCC NO.65262. Streptomyces ardesiacus Zst-LLL-767 has a significant antagonistic effect against Ralstonia solanacearum, can effectively control bacterial wilt; has a significant growth-promoting effect on tomatoes and tobacco, and can promote plant growth. Streptomyces ardesiacus Zst-LLL-767 is a biological control resource, which is safe, environmentally friendly, not easy to produce drug resistance, and friendly to the environment, providing technical support for the sustainable development of agriculture.
[0026] Through a large number of experimental studies, it is found that Streptomyces ardesiacus Zst-LLL-767 exhibits very prominent biocontrol characteristics. Under laboratory conditions, through the antibacterial experiment, it can be clearly seen that this strain can significantly inhibit the growth of Ralstonia solanacearum in tomatoes. The diameter of the antibacterial circle against the pathogen of tomato bacterial wilt can reach 19.7 mm, and the ratio of the antibacterial diameter circle is 3.94. This fully shows that it has a strong antagonistic effect against the pathogen. Moreover, more importantly, it can prevent the colonization of the pathogen of bacterial wilt in the tomato stem, cutting off the way for the further development of the disease from the root.
[0027] It is worth mentioning that this strain was isolated from tomato endophytes, which means it has a natural affinity with the tomato plants themselves. This affinity enables it to have a strong colonization ability in tomato plants, better play its role inside the plants, and continuously inhibit the growth of pathogenic bacteria. At the same time, from the perspective of practical application, the cultivation method of this strain is relatively simple and does not require complex equipment and harsh cultivation conditions. This characteristic creates favorable conditions for its large-scale production and actual field application, making it have broad application value for the biological control of bacterial wilt and promising to become one of the effective ways to solve the problem of bacterial wilt control.
[0028] Other advantages, objectives, and features of the present invention will be described to some extent in the subsequent specification, and to some extent, will be obvious to those skilled in the art based on the study of the following text, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be achieved and obtained through the following specification. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] In order to make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be described in preferred detail below in conjunction with the drawings, where:
[0030] Figure 1 It is a plate diagram of Streptomyces lapidosus Zst-LLL-767 on ISP4 medium.
[0031] Figure 2 It is the morphology of Streptomyces lapidosus Zst-LLL-767 under the microscope.
[0032] Figure 3 It is the 16S rDNA phylogenetic tree of Streptomyces lapidosus Zst-LLL-767.
[0033] Figure 4 It is a plate confrontation experiment diagram of Streptomyces lapidosus Zst-LLL-767 against Ralstonia solanacearum.
[0034] Figure 5 It is the effect diagram of different Streptomyces strains antagonizing Ralstonia solanacearum in pot experiments. From left to right, they are: Zst-LLL-767, Zst-531, Zst-424, CK.
[0035] Figure 6 It is the disease-curing curve of Streptomyces lapidosus Zst-LLL-767 antagonizing Ralstonia solanacearum.
[0036] Figure 7 It is the diagram of Streptomyces lapidosus Zst-LLL-767 promoting the growth of tomato plants in pot experiments. Among them, the left is the experimental group and the right is the control group.
[0037] Figure 8 This is a diagram showing the promotion of tobacco seedling growth by Streptomyces ardesiacus Zst-LLL-767. Among them, the left is the control group and the right is the experimental group.
[0038] Preservation Information
[0039] Taxonomic Naming: Streptomyces ardesiacus
[0040] Latin Scientific Name: Streptomyces ardesiacus
[0041] Preservation Number: GDMCC NO.65262
[0042] Name of the Preservation Institution: Guangdong Microbial Culture Collection Center (GDMCC)
[0043] Address of the Preservation Institution: 5th Floor, Experimental Building, No. 100 Compound, Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province
[0044] Preservation Date: October 14, 2024 Specific Embodiments
[0045] The present invention will be further described below in conjunction with specific embodiments.
[0046] Example 1. Isolation of Streptomyces ardesiacus Zst-LLL-767
[0047] The endophytic environment of resistant tomato varieties was screened by high-throughput using the high-throughput sorting system for endophytes developed by the team of Teacher Bai Yang from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. First, the tomato stems were cut into pieces and ground, soaked and washed with PBS buffer, and then the ground tissue was diluted. The optimal dilution gradient was selected (1 / 54000 was determined as the optimal dilution gradient in the preliminary experiment, and 1 / 6000, 1 / 18000, 1 / 54000, 1 / 162000, and 1 / 486000 were selected for subsequent experiments), and the diluted bacterial solution was inoculated into 10% (v / v) TSB liquid medium (Qingdao Haibo Biotech) for 2 weeks of culture. After the culture was completed, the optimal dilution gradient was determined again (the optimal dilution gradient was finally determined to be 1 / 162000), and high-throughput sequencing was performed on the microorganisms (i.e., turbid wells) in the 96-well plates corresponding to this gradient and the next gradient (1 / 486000). At the same time, the microorganisms in the 96-well plates corresponding to the gradient 1 / 54000 were stored with glycerol for subsequent single-strain purification of microorganisms. The strain Zst-LLL-767 with significant antagonistic effect against Ralstonia solanacearum was screened out through the plate antagonism experiment. This Streptomyces lividans presents a lichen-like shape on the ISP4 medium (Qingdao Haibo Biotech) plate. Initially, the surface is smooth, and then a layer of short mycelium develops, showing a granular velvet-like appearance, with aerial mycelium, light grayish brown. It can grow on media such as Gao's No. 1 and ISP4, and the culture temperature is 28°C. It can cover the medium after streak culture for 5-7 days. Under the microscope, the hyphae are abundantly branched, the mycelium has no septum and does not break; the spores are oval, and the spore chains are tight( Figure 1 , Figure 2 ).
[0048] Example 2. Identification method of Streptomyces lividans Zst-LLL-767
[0049] The 16S rDNA gene of the strain was amplified by PCR and sent to Chongqing Qingke Biotechnology Co., Ltd. for sequencing analysis. The primers used to amplify the 16S rDNA gene are as follows:
[0050] The upstream primer sequence is: 5'AGAGTTTGATCCTGGCTCAG3'.
[0051] The downstream primer sequence is: 5'GGTTACCTTGTTACGACTT3'.
[0052] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 4 min, denaturation at 95°C for 40 s, annealing at 55°C for 50 s, extension at 72°C for 1 min, 32 cycles of reaction, and extension at 72°C for 10 min. By using the BLAST function of NCBI for sequence alignment in the GeneBank database, it was found that the strain screened in the present invention had the highest homology with Streptomyces ardesiacus, which was 99.60%. Thus, this strain was determined to be Streptomyces ardesiacus, named Streptomyces ardesiacus Zst-LLL-767( Figure 3 ).
[0053] Example 3. Preparation of the liquid bacterial agent of Streptomyces ardesiacus Zst-LLL-767
[0054] The preserved strain of Streptomyces ardesiacus Zst-LLL-767 was activated on the Gao's No. 1 medium, and its antagonistic performance against Ralstonia solanacearum was determined; the activated Streptomyces ardesiacus Zst-LLL-767 was inoculated into a triangular flask containing a seed medium (the seed medium was preferably Gao's No. 1 medium, composed of the following components according to the mass-volume ratio (g / L): soluble starch 20, KNO3 1, NaCl 0.5, K2HPO4·3H2O 0.5, MgSO4·7H2O 0.5, FeSO4·7H2O 0.01, water 1000 ml, pH 7.4 - 7.6, and sterilized by high-pressure moist heat at 121°C, cooled to 30°C for standby). The culture conditions were controlled as follows: sterile air was introduced at a ventilation ratio of 1:0.6 (V / V·m), the stirring speed was controlled at 120 revolutions per minute, the culture temperature was 30 - 32°C, the culture time was 36 hours, and it was cultured with shaking until the logarithmic phase to obtain the bacterial strain; the obtained bacterial strain was inoculated into a seed tank containing the seed medium at an inoculation amount of 8% (v / v), cultured until the logarithmic growth phase to obtain the seed liquid of Streptomyces ardesiacus Zst-LLL-767; the obtained seed liquid of Streptomyces ardesiacus Zst-LLL-767 was inoculated into a production tank containing a fermentation medium (the fermentation medium was preferably ISP4 medium, composed of the following components according to the mass-volume ratio (g / L): soluble starch 10, K2HPO4·3H2O 1, MgSO4·7H2O 1, NaCl 1, (NH4)2SO4 2, CaCO3 2, FeSO4·7H2O 0.01, MnCl2·4H2O 0.01, ZnSO4·7H2O 0.01, and the pH of the fermentation medium was preferably 7.2 - 7.4) for fermentation culture. The culture conditions were the same as those for preparing the seed liquid of Streptomyces ardesiacus Zst-LLL-767. The concentration of Streptomyces ardesiacus Zst-LLL-767 in the fermentation broth was detected to be 5×10 9When it reaches CFU / ml, a Zst-LLL-767 liquid bactericide that can inhibit Ralstonia solanacearum is formed immediately after leaving the tank.
[0055] Experimental Example 1. Antagonistic effect of Streptomyces lapidosus Zst-LLL-767 against Ralstonia solanacearum
[0056] Experiments have proved that the Streptomyces lapidosus Zst-LLL-767 has a significant antagonistic effect against Ralstonia solanacearum. Its antagonistic effect can be demonstrated by methods such as the plate confrontation experiment and the inhibition zone experiment.
[0057] Inhibition zone experiment: The Ralstonia solanacearum OE1-1 (TAKEMURA C, SENUMA W, HAYASHI K, etc. PhcQ mainly contributes to the regulation of quorum sensing-dependent genes, in which PhcR is partially involved, in Ralstonia pseudosolanacearum strain OE1-1 [J / OL]. Molecular Plant Pathology, 2021, 22(12): 1538-1552.) cultured overnight with B culture medium (10 g of peptone, 1 g of yeast powder, 1 g of acid-hydrolyzed casein, 1000 ml of water) was spread on the BG plate (the components of the culture medium are as follows: based on the B culture medium, add 15 g / L of agar and 20 ml / L of sterilized 25% glucose solution). Then, the bacterial solution of Streptomyces lapidosus Zst-LLL-767 cultured overnight with IPS4 was dropped on the filter paper and placed on the coated BG plate. After culturing at 28 °C for 3 days, an obvious transparent circle could be seen around the filter paper, indicating that under the culture conditions on the plate, Streptomyces lapidosus Zst-LLL-767 can effectively inhibit the growth of Ralstonia solanacearum OE1-1 ( Figure 4 ).
[0058] This Streptomyces lapidosus is used for the first time in antagonizing Ralstonia solanacearum in tomatoes, and no related or similar applications have been found before. Compared with different actinomycetes isolated from this laboratory that have antagonistic effects against Ralstonia solanacearum, Streptomyces lapidosus Zst-LLL-767 shows a stronger antagonistic effect (Table 1).
[0059] Ratio of inhibition zone diameter to filter paper diameter = diameter of inhibition zone / diameter of filter paper; the larger the ratio, the better the inhibitory effect.
[0060] Table 1 Ratio of inhibition zones of different actinomycetes against Ralstonia solanacearum
[0061]
[0062] Pot experiment of antagonism: The bacterial agents of Ralstonia solanacearum OE1-1 and Streptomyces lapidosporochromogenes were inoculated into 4-week-old tomato seedlings respectively. The control group was Ralstonia solanacearum OE1-1, and the experimental group was Ralstonia solanacearum OE1-1 + Streptomyces lapidosporochromogenes Zst-LLL-767. The treatment methods were root irrigation and root wounding. The results showed that the tomatoes inoculated with Streptomyces lapidosporochromogenes did not develop the disease or the onset of the disease was delayed ( Figure 6 ), while the tomatoes inoculated with Ralstonia solanacearum OE1-1 died of the disease 4 days after inoculation ( Figure 5 ). Streptomyces lapidosporochromogenes produced substances in the soil that inhibited the growth of Ralstonia solanacearum.
[0063] At the same time, compared with different endophytes isolated from our laboratory that have antagonistic effects on Ralstonia solanacearum and the reported Streptomyces, Streptomyces lapidosporochromogenes Zst-LLL-767 showed a stronger antagonistic effect (Table 2, Figure 5 ). The disease condition was graded according to the following criteria: 0: asymptomatic; 1: ≤25% of the leaves wilted; 2: 25-50% of the leaves wilted; 3: 50-75% of the leaves wilted; 4: 75-100% of the leaves wilted. The control effect was calculated by the following formula:
[0064] Disease index (%) = [Σ (disease grade × number of diseased plants)] / (highest disease grade × total number of plants) × 100%;
[0065] Control effect (%) = (control disease index - treatment group disease index) / control disease index × 100%;
[0066] Table 2 Pot experiment results of different actinomycetes on inhibiting Ralstonia solanacearum
[0067]
[0068] In Table 2, the sources of some strains are as follows:
[0069] Streptomyces rapamycinicus Sa-21: Liao Xinlin, Guo Xin, Yang Jixue, et al. Screening of actinomycetes antagonistic to Ralstonia solanacearum and their disease prevention effects [J]. Scientia Agricultura Sinica, 2024, 57(7): 1319-1334.
[0070] Streptomyces griseorubiginosus FX81 and Streptomyces violaceorubidus FX82: Lai Baochun, Yao Jin'ai, Dai Ruiqing, et al. Study on the combined control of tomato bacterial wilt by two antagonistic actinomycetes [J]. Chinese Journal of Biological Control, 2021, 37(5): 1035-1040.
[0071] Streptomyces gardneri AB-1: Sun Tianyu, Zhu Junyu, Wang Shimei, et al. Isolation, identification and biological characteristics of a Streptomyces strain for biological control of tomato bacterial wilt [J]. Acta Microbiologica Sinica, 2025: 1-14.
[0072] Experimental Example 2. Growth promotion effect of Streptomyces lapidosus Zst-LLL-767 on tomato and tobacco plants
[0073] Growth promotion effect on tomato seedlings: The fermentation inoculum of Streptomyces lapidosus Zst-LLL-767 was inoculated into the root soil of tomato plants. The experimental group was tomato seedlings watered with the fermentation inoculum of Streptomyces lapidosus Zst-LLL-767, and the control group was tomato seedlings watered only with ISP4 culture solution. The watering frequency was 2 days / time for both groups, and the watering amount was 30 ml for both groups. After 20 days, it could be seen that the tomato seedlings in the experimental group grew significantly better than those in the control group ( Figure 7 ).
[0074] Growth promotion effect on tobacco seedlings: The fermentation inoculum of Streptomyces lapidosus Zst-LLL-767 was dropped onto the roots of tobacco seedlings in 1 / 2 MS medium (Qingdao Haibo Biotech). The experimental group was the fermentation inoculum of Streptomyces lapidosus Zst-LLL-767, and the control group was the original ISP4 medium. The dropping amount was 10 μl for both groups. It could be seen that the tobacco seedlings in the experimental group grew significantly better than those in the control group ( Figure 8 ).
[0075] IAA was detected in the fermentation inoculum of Streptomyces lapidosus Zst-LLL-767, and the IAA produced by Streptomyces lapidosus Zst-LLL-767 during plant colonization promoted plant growth.
[0076] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the present technical solution, and they should all be covered by the scope of the claims of the present invention.
Claims
1. A Streptomyces lividans Zst-LLL-767, characterized in that, Its Latin name is Streptomyces ardesiacus, and it was deposited at the Guangdong Microbial Culture Collection Center on October 14, 2024. Address: 5th Floor, Experimental Building, No. 100 Compound, Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province. The deposit number is GDMCC NO. 65262.
2. A Streptomyces lapidosus Zst-LLL-767 according to claim 1, characterized in that, The 16S rDNA sequence of Streptomyces lapidosus Zst-LLL-767 is shown in SEQ ID NO.
1.
3. Use of the strain Streptomyces lapidosus Zst-LLL-767 according to claim 1 in resisting Ralstonia solanacearum.
4. Use of the strain Streptomyces lapidosus Zst-LLL-767 according to claim 1 in preparing a bactericide for resisting Ralstonia solanacearum.
5. The application according to claim 4, characterized in that, The microbial agent is a liquid microbial agent, and the concentration of Streptomyces saxicola Zst-LLL-767 is 10 9 ~10 10 CFU / mL.
6. A bacterial agent against Ralstonia solanacearum, characterized in that, Its active ingredient is the strain Streptomyces lapidosus Zst-LLL-767 according to claim 1.
7. An anti-Ralstonia solanacearum agent according to claim 6, characterized in that, The microbial agent is a liquid microbial agent, and the concentration of Streptomyces lapidosus Zst-LLL-767 is 10 9 - 10 10 CFU / mL.
8. Use of the strain Streptomyces lapidosus Zst-LLL-767 according to claim 1 in promoting plant growth.
9. A microbial agent for promoting plant growth, characterized in that, Its active ingredient is the strain Streptomyces lapidosus Zst-LLL-767 according to claim 1.
10. The microbial agent according to claim 9, characterized in that, The microbial agent is a liquid microbial agent, and the concentration of Streptomyces saxicola Zst-LLL-767 is 10 9 -10 10 CFU / mL.