ShRNA for interfering FIBCD1 expression, recombinant plasmid, vector and application

Abstract

The invention discloses shRNA for interfering FIBCD1 expression, a recombinant plasmid, a vector and application, and belongs to the technical field of biomedical engineering. The shRNA is shRNA (short hairpin ribonucleic acid) 1 or shRNA 2; a DNA (deoxyribonucleic acid) sequence corresponding to the shRNA1 is as shown in SEQ ID NO. 1-2; a DNA (Deoxyribonucleic Acid) sequence corresponding to the shRNA2 is as shown in SEQ ID NO. 3-4. Researches find that FIBCD1 is highly expressed in an amygdala nucleus region, plays a key role in occurrence and development of PTSD, and is an adverse factor. ShRNA1 and shRNA2 are designed, adeno-associated virus is adopted as a carrier, and the fact that SPSamp can be reversed can be found by knocking out FIBCD1 in an amygdaloid nucleus region; the traditional Chinese medicine composition can be used for treating PTSD-like symptoms caused by S, and has a very good anti-PTSD effect.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedical engineering, and particularly relates to an shRNA, a recombinant plasmid, a vector for interfering with the expression of FIBCD1 and their applications. Background Art

[0002] Disclosing the information of this background art section is only intended to enhance the understanding of the overall background of the present invention, and is not necessarily to be regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] Post-traumatic stress disorder (PTSD) is an adverse psychological reaction to trauma exposure and is considered a typical disorder related to trauma exposure. The scope of trauma exposure covers inevitable social factors such as violence and conflict, natural disasters, etc. Currently, PTSD has become a major challenge in the field of public health. Drug treatment is a common means for treating PTSD, and common drugs such as paroxetine and sertraline have been approved by the FDA for the intervention of PTSD. These drugs all relieve depressive symptoms by increasing the level of serotonin, but long-term use will produce serious side effects such as suicidal tendencies, vomiting or insomnia. Therefore, developing drugs without side effects is of great significance for the treatment of PTSD.

[0004] With the in-depth research of genetic engineering, scientists have shown great interest in developing drugs using genetic engineering. Scientists directly operate on the target gene to produce drugs for specific diseases or pathological processes. This highly targeted production method not only improves the efficacy of drugs, but also reduces unnecessary side effects. The obtained genetic engineering drugs usually have higher safety and stability. Short hairpin RNA (shRNA) can be transcribed and produced in cells to bind to the target, thereby regulating the expression of the target gene. Most of the genetic engineering drugs in the prior art achieve the regulation of the target gene through shRNA, thereby achieving the therapeutic effect. However, there is no relevant report on the shRNA with the therapeutic effect on PTSD. Summary of the Invention

[0005] In order to solve the deficiencies of the prior art, the inventors have provided an shRNA, a recombinant plasmid, a vector for interfering with the expression of FIBCD1 and their applications through long-term technical and practical explorations.

[0006] Fibrinogen C Domain Containing 1 (FIBCD1) has been identified as a mammalian chitin-binding receptor involved in immune responses. FIBCD1 is highly expressed in the human respiratory tract, gastrointestinal tract, testis, placenta, and brain. Studies have shown that FIBCD1 is associated with cancer, and its overexpression is related to poor prognosis in gastric cancer and hepatocellular carcinoma, and it can affect brain neurodevelopment. However, the role of FIBCD1 in PTSD has not been reported. In this invention, the currently recognized in-vivo PTSD model in animals: SPS&S was used to detect the expression level of FIBCD1 in brain regions highly related to PTSD (hippocampus, amygdala, prefrontal cortex) in SPS&S mice. It was found that the expression of FIBCD1 increased in the amygdala region of PTSD mice, indicating that FIBCD1 may be closely related to PTSD. Immunofluorescence, Western blot and other techniques were used to explore the mechanism of action of FIBCD1 in the amygdala of PTSD mice. This invention found that FIBCD1 is highly expressed in the amygdala region and plays a key role in the occurrence and development of PTSD, which is an adverse factor; inhibiting its protein and function as a target can play a good role in anti-PTSD, and it has great potential in the treatment of PTSD, drug screening, etc.

[0007] For this, the inventor designed a series of shRNAs that interfere with the expression of FIBCD1, used AAV adeno-associated virus as a vector to knockdown FIBCD1 in the amygdala brain region, and screened its effect through Western blot experiments. Western blot experiments verified that shRNA1 and shRNA2 have the effect of interfering with the expression of FIBCD1. Subsequently, the shRNA1 sequence with the best effect was selected for subsequent experiments. Anxiety-like behaviors and fear memories of mice were detected in the open field experiment, elevated plus maze experiment, and conditioned fear memory experiment. It was found that knocking out FIBCD1 in the amygdala region with shRNA1 could reverse the PTSD-like symptoms caused by SPS&S and achieve the treatment of PTSD. Based on the above research results, this invention was completed.

[0008] To achieve the above object, the technical solution of this invention is as follows: In the first aspect of this invention, there is provided a shRNA that interferes with the expression of FIBCD1, and the shRNA is shRNA1 or shRNA2; The DNA sequence corresponding to shRNA1 is shown in SEQ ID NO.5-6; The DNA sequence corresponding to shRNA2 is shown in SEQ ID NO 8-9.

[0009] In some embodiments of the present invention, the Gene ID of FIBCD1 is 84929.

[0010] In a second aspect of the present invention, there is provided a recombinant plasmid which contains the above-mentioned shRNA interfering with the expression of FIBCD1.

[0011] In a third aspect of the present invention, there is provided a vector which contains the above-mentioned shRNA interfering with the expression of FIBCD1 or the above-mentioned recombinant plasmid.

[0012] In some embodiments of the present invention, the vector is obtained by effectively ligating the above-mentioned shRNA to an adeno-associated virus vector.

[0013] In some embodiments of the present invention, the adeno-associated virus (AAV) vector is pHBAAV-U6-MCS-CMV-EGFP.

[0014] In a fourth aspect of the present invention, there is provided the use of the above-mentioned shRNA, the above-mentioned recombinant plasmid or the above-mentioned vector in the preparation of a product for treating post-traumatic stress disorder.

[0015] In some embodiments of the present invention, the product is a drug.

[0016] In some embodiments of the present invention, the dosage form of the drug includes one of liquid dosage forms and solid dosage forms.

[0017] In some embodiments of the present invention, the liquid dosage form includes any one of injections, solutions, suspensions, emulsions and aerosols, and the solid dosage form includes any one of tablets, capsules and powders.

[0018] The beneficial effects of the present invention are as follows: The present invention finds through research that FIBCD1 is highly expressed in the amygdala region and plays a key role in the occurrence and development of PTSD, which is an adverse factor; FIBCD1 can be used as a therapeutic target for PTSD, and reducing its expression can resist the occurrence and progression of PTSD. In view of this, the present invention designs a series of shRNAs interfering with the expression of FIBCD1. The present invention uses an adeno-associated virus containing shRNA1 or shRNA2 to knockout FIBCD1 in the amygdala region and finds that it can reverse the PTSD-like symptoms caused by SPS&S, play a good anti-PTSD role, and achieve the treatment of PTSD. The shRNAs interfering with the expression of FIBCD1 provided by the present invention have great potential in the treatment of PTSD, drug screening and other aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings of the specification, which form a part of the present invention, are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0020] Figure 1 Sequencing results of m-FIBCD1 shRNA1 (A), m-FIBCD1 shRNA2 (B), and m-FIBCD1 shRNA3 (C) in Example 1 of the present invention; Figure 2 Standard curve in Example 1 of the present invention; Figure 3 Schematic diagram of the SPS&S animal model construction procedure in Example 1 of the present invention; Figure 4 Western blot detection of the expression of FIBCD1 in the amygdala (A), hippocampus (B), and prefrontal cortex (C) in Example 1 of the present invention, ***P < 0.001; Figure 5 Schematic diagram of the behavioral time in Example 1 of the present invention, stereotaxic injection of AAV-shRNA adenovirus into the amygdala, and detection of the knockdown effect, ***P < 0.001; wherein, A is the flow chart for detecting the anxiety-like behavior of mice, B is the schematic diagram of the injection site of the adenovirus, and the circled part in the figure is the amygdala site, and the high fluorescence intensity at this position indicates that the virus has been injected into the amygdala site, C is the Western blot detection of the interference efficiency of shRNA1, D is the Western blot detection of the interference efficiency of shRNA2, and E is the Western blot detection of the interference efficiency of shRNA3; Figure 6 Open field test and elevated plus maze test in Example 1 of the present invention for detecting the anxiety-like behavior of mice; *P < 0.05, #P < 0.05, ****P < 0.0001, #P < 0.0001; wherein, A is the result of the exploration time of the central area in the open field test, B is the result of the number of times entering the central area in the open field test, C is the result of the total movement distance in the open field test, D is the result of the proportion of time entering the open arms in the elevated plus maze test, and E is the result of the number of times entering the open arms in the elevated plus maze test; Figure 7 Contextual fear test and conditioned fear test in Example 1 of the present invention for detecting the fear memory of mice; #P < 0.05, **P < 0.01, ***P < 0.001; wherein, A is the flow chart of the fear memory test, B is the result of the contextual fear test, and C is the result of the conditioned fear test; Figure 8This was to detect the generalization of fear memory in mice in Example 1 of the present invention by fear generalization experiment; * SPS&S+NCVS AAV-shNC, # SPS&S+AAV-shRNA1 VS SPS&S+AAV-shNC; #P<0.05, ***P<0.001, ****P<0.0001; wherein, A is the flow chart of the fear generalization experiment, B is the proportion of freezing time at each frequency in the fear generalization experiment, and C is the result of the fear generalization experiment; Figure 9 This was to detect the expression of TLR2-NFkB and inflammatory factors in the amygdala of mice by WB in Example 1 of the present invention; *P<0.05, #P<0.05, **P<0.01, ##P<0.01; wherein, A is the expression of TLR2 protein, B is the result of NFkB protein expression, C is the result of IL-6 protein expression, and D is the result of IL-1β protein expression; Figure 10 This was to detect the expression of IL-6 in the amygdala by immunofluorescence in Example 1 of the present invention; ***P<0.001, ##P<0.01; wherein, A is the immunofluorescence staining of IL-6 in the amygdala tissue, and B is the statistics of the immunofluorescence intensity of IL-6; Figure 11 This was to detect the expression of c-Fos in the amygdala by immunofluorescence in Example 1 of the present invention; ****P<0.0001, ##P<0.01; wherein, A is the immunofluorescence staining of NeuN and c-Fos, and B is the statistics of the co-stained immunofluorescence intensity of c-Fos and NeuN; Figure 12 This is the schematic diagram of the mechanism of action of the present invention. PTSD increases the expression of FIBCD1 on microglia in the amygdala brain region of mice, and promotes the secretion of inflammatory factors through the TLR2-NFkB signaling pathway. The increase in IL-6 secretion leads to the activation of amygdala neurons, resulting in abnormal fear memory; Figure 13 This is the plasmid map of the recombinant plasmid used in Example 1 of the present invention. Detailed implementation mode

[0021] The present invention discloses shRNA, recombinant plasmid, vector and application for interfering with the expression of FIBCD1. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve. It should be particularly pointed out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0022] Term explanation: EPM: Elevated Plus Maze test.

[0023] OFT: Open Field test.

[0024] Contextual fear text: Contextual fear test.

[0025] Conditioned fear text: Conditioned fear test.

[0026] CTL group: Blank control group, i.e., control.

[0027] As described above, there is no relevant report on the shRNA with the therapeutic effect on PTSD. In view of this, in a typical embodiment of the present invention, a shRNA interfering with the expression of FIBCD1 is provided, and the shRNA is shRNA1 or shRNA2; The DNA sequence corresponding to the shRNA1 is shown in SEQ ID NO.5-6; The DNA sequence corresponding to the shRNA2 is shown in SEQ ID NO 8-9.

[0028] Among them, the full name of the FIBCD1 is Fibrinogen C Domain Containing 1 Homo sapiens (human), Gene ID: 84929. It has been identified as a mammalian chitin-binding receptor and is involved in the immune response.

[0029] The present invention uses the currently recognized animal model of PTSD in vivo: SPS&S, and detects the expression level of FIBCD1 in the brain regions highly related to PTSD (hippocampus, amygdala, prefrontal cortex) of SPS&S mice. Subsequently, the anxiety-like behaviors and fear memories of mice are detected in the open field test, elevated plus maze test, and conditioned fear memory test. Immunofluorescence, Western blot and other techniques are used to explore the mechanism of action of FIBCD1 in the amygdala of PTSD mice. The inventors found that reducing the expression of FIBCD1 in the amygdala brain region can improve the PTSD-like symptoms induced by SPS&S, and FIBCD1 can be a good target for anti-PTSD drugs. In this regard, 3 shRNA sequences were designed to knockdown FIBCD1 in the amygdala brain region, and their effects were screened by Western blot experiments. Finally, it was determined that shRNA1 and shRNA2 have the effect of inhibiting the expression of FIBCD1.

[0030] In the second typical embodiment of the present invention, a recombinant plasmid is provided, and the recombinant plasmid contains the above-mentioned shRNA interfering with the expression of FIBCD1.

[0031] The third exemplary embodiment of the present invention provides a vector, which contains the above-mentioned shRNA interfering with FIBCD1 expression or the above-mentioned recombinant plasmid.

[0032] In some embodiments of this embodiment, the vector is obtained by effectively connecting the above-mentioned shRNA to an adeno-associated virus vector.

[0033] In some embodiments of this embodiment, the adeno-associated virus vector is pHBAAV-U6-MCS-CMV-EGFP.

[0034] The fourth exemplary embodiment of the present invention provides the use of the above-mentioned shRNA, the above-mentioned vector or the above-mentioned host in the preparation of products for treating post-traumatic stress disorder.

[0035] In some embodiments of this embodiment, the product is a drug.

[0036] According to the present invention, when the product is a drug, the drug further includes at least one pharmaceutically inactive ingredient. The pharmaceutically inactive ingredient can be a carrier, excipient, diluent, etc. commonly used in pharmacy. Moreover, according to the usual method, it can be made into dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, sprays, etc., for oral administration, external use, suppositories, and sterile injection solutions for use. The pharmaceutically commonly used carriers, excipients, diluents and other non-drug active ingredients are well-known in the art, and those of ordinary skill in the art can determine that they meet clinical standards. In some embodiments of this embodiment, the carriers, excipients and diluents include but are not limited to lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, arabic gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl paraben, propyl paraben, talc, magnesium stearate, and mineral oil, etc. In some embodiments of this embodiment, the drug of the present invention can be administered into the body by known means. For example, it can be delivered systemically via intravenous injection or locally injected into the tissue of interest. Optionally, it can be administered via intravenous, transdermal, intranasal, mucosal or other delivery methods. Such administration can be carried out via a single dose or multiple doses. Those skilled in the art can understand that the actual dose to be administered in the present invention can vary to a large extent depending on various factors, such as target cells, biological types or their tissues, the general condition of the subject to be treated, the route of administration, the mode of administration, and so on. In some embodiments of this embodiment, the subjects to which the drug is administered can be humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, chimpanzees, etc.

[0037] In some embodiments of this embodiment, the dosage form of the drug includes one of liquid dosage forms and solid dosage forms.

[0038] In some embodiments of this embodiment, the liquid dosage form includes, but is not limited to, one of injections, solutions, suspensions, emulsions, and aerosols, and the solid dosage form includes, but is not limited to, one of tablets, capsules, and powders.

[0039] In some embodiments of this embodiment, the drug is an experimental reagent for basic research. For example, the experimental reagent can be used for the construction of cell and animal models related to post-traumatic stress disorder.

[0040] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0041] The reagents and equipment used in the present invention can be purchased from the market. Example 1 (1) Construction of SPS&S animal model Bind C57 mice for 2 h, force them to swim for 20 min, rest for 15 min, anesthetize them with ether until unconscious, and after an interval of 30 minutes, give unavoidable electric shocks (1 mA, 5 s).

[0042] (2) Detection of FIBCD1 expression in the amygdala, hippocampus, and prefrontal cortex by Western blot Anesthetize the mice with isoflurane vapor, decapitate them, quickly remove the brain tissue on an ice box and isolate the hippocampus, prefrontal cortex, and amygdala, store them in 1.5 mL cryotubes, quickly freeze them with liquid nitrogen and transfer them to a -80°C refrigerator for storage. Mix the protein / phosphatase inhibitor with RIPA high-efficiency lysis buffer at a ratio of 1:100, and add the mixture to an EP tube at a ratio of 10 μL of the mixture per 1 mg of tissue. Add 2 grinding beads to each EP tube, and use a high-throughput tissue grinder (the inner tank of the grinder is pre-cooled in a -20°C refrigerator) to grind at 60 Hz for 2 times, 2 min each time. After grinding, let the sample stand on ice for 20 min, and centrifuge it using a refrigerated high-speed centrifuge: 4°C, 12,000 rpm, 20 min. Determine the protein concentration using the BCA method. Heat the sample with adjusted concentration in a metal bath for 5 min for denaturation.

[0043] Prepare 10% separating gel and 5% stacking gel for protein electrophoresis. Add 5 μL of appropriate marker and 20 μL of protein sample, perform electrotransfer, incubate with primary antibodies FIBCD1 and β-actin after blocking, and incubate overnight at 4°C. Incubate with goat anti-rabbit secondary antibody, develop the image, analyze the image with software, obtain data and process it.

[0044] The results of WB ( Figure 4 ) showed that the expression of FIBCD1 in the amygdala of mice in the SPS&S group was significantly higher than that in the CTL group, while there was no change in the expression in the hippocampus and prefrontal cortex.

[0045] (3) Stereotaxic injection of AAV-shRNA adenovirus-associated virus into the amygdala Construction of AAV-shRNA adenovirus-associated virus: 1. Design interference targets and primer synthesis according to the FIBCD1 gene sequence: 1.1 The siRNA sequence and shRNA sequence of the control virus vector are as follows: siRNA sequence: TTCTCCGAACGTGTCACGTAA (SEQ ID NO.1) shRNA sequence: Sense strand (Top strand): GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC (SEQID NO.2) Antisense strand (Bottom strand): AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG (SEQID NO.3) 1.2 The siRNA sequence and shRNA sequence of the target gene: siRNA1 sequence: TCACCGGTGTGGTTCTCTTCCTGAA (SEQ ID NO.4) shRNA1 sequence: Sense strand (Top strand): AATTCGTCACCGGTGTGGTTCTCTTCCTGAACTCGAGTTCAGGAAGAGAACCACACCGGTGATTTTTTG (SEQ ID NO.5) Antisense strand (Bottom strand): GATCCAAAAAATCACCGGTGTGGTTCTCTTCCTGAACTCGAGTTCAGGAAGAGAACCACACCGGTGACG (SEQ ID NO.6) siRNA2 sequence: CGGGATGGCAGTATTCACTCAAGTT (SEQ ID NO.7) shRNA2 sequence: Sense strand (Top strand): AATTCGCGGGATGGCAGTATTCACTCAAGTTCTCGAGAACTTGAGTGAATACTGCCATCCCGTTTTTTG (SEQ ID NO.8) Antisense strand (Bottom strand): GATCCAAAAAACGGGATGGCAGTATTCACTCAAGTTCTCGAGAACTTGAGTGAATACTGCCATCCCGCG (SEQ ID NO.9) siRNA3 sequence: CAGCAGGATGATGGTGTCTACTCTA (SEQ ID NO.10) shRNA3 sequence: Sense strand (Top strand): AATTCGCAGCAGGATGATGGTGTCTACTCTACTCGAGTAGAGTAGACACCATCATCCTGCTGTTTTTTG (SEQ ID NO.11) Antisense strand (Bottom strand): GATCCAAAAAACAGCAGGATGATGGTGTCTACTCTACTCGAGTAGAGTAGACACCATCATCCTGCTGCG (SEQ ID NO.12) The primers anneal to form a double-stranded fragment with sticky ends.

[0046] 1.3 Vector digestion: Add each reagent in the order shown in the following table successively, gently pipette and mix well, and place it in a 37°C water bath for reaction for 1 - 2 h; after the digestion is completed, perform agarose gel electrophoresis and recover the target fragment; The vector used in the present invention is the vector numbered AAV021 from Hanheng Biotechnology (Shanghai) Co., Ltd., and the plasmid map is as Figure 13 shown, and the original order is pHBAAV-U6-MCS-CMV-EGFP.

[0047] The vector digestion system is shown in Table 1.

[0048] Table 1 Vector digestion system

[0049] Note: The restriction sites of restriction endonuclease 1 and restriction endonuclease 2 are EcoRI and BamHI respectively.

[0050] 1.4 Ligation of the interference fragment (siRNA) to the vector: The ligation reaction system (20 μL) is shown in Table 2.

[0051] Table 2 Ligation reaction system

[0052] Note: The annealing product is the double-stranded fragment with sticky ends formed by annealing of the siRNA in 1.1 or 1.2.

[0053] The above ligation solution is ligated at 22°C for 1 - 2 h, or ligated overnight at 16°C.

[0054] 1.5 Transformation 1) After taking out the DH5α competent cells from the -80°C refrigerator, immediately place them on ice to melt. The operation during the sub-packaging of the competent cells should be gentle to reduce mechanical damage to them; 2) After the competent cells are melted, sub-package them in a volume of 50 μL per tube (for plasmid transformation, 20 μL is sufficient). After sub-packaging, add the ligation product in an amount not exceeding 1 / 10 of the volume of the competent cells (currently add 5 μL of the ligation product), and place it on ice for 20 - 30 min; 3) Heat shock at 42°C for 90 s. Immediately after heat shock, insert it into ice for incubation for 2 - 3 min; in the laminar flow hood, add 500 μL of LB medium without kanamycin, and gently invert it up and down 3 - 5 times; 4) Incubate with shaking at 37°C and 230 rpm for 45 - 60 min; 5) Spread the bacterial solution on the solid plate with the corresponding resistance, spread it evenly, and then place the plate upside down in a 37°C incubator for 12 - 16 h; 1.6 Identification by bacterial liquid PCR The bacterial liquid PCR identification system is shown in Table 3.

[0055] Table 3 Bacterial liquid PCR identification system

[0056] Note: The sequences of primer 1 and primer 2 in Table 3 are as follows: Primer 1: GGACTATCATATGCTTACCG (SEQ ID NO.13) Primer 2: GTCCCTATTGGCGTTACTATG (SEQ ID NO.14) The identification procedure of colony PCR is shown in Table 4.

[0057] Table 4 Identification procedure of colony PCR

[0058] 1.7 Sequencing Alignment and analysis of sequencing results The sequencing results of m-FIBCD1 shRNA1 are as shown Figure 1 in (A) below, the sequencing results of m-FIBCD1 shRNA2 are as shown Figure 1 in (B) below, and the sequencing results of m-FIBCD1 shRNA3 are as shown Figure 1 in (C) below. The sequencing results indicate that the sequencing results are consistent with the target sequence, and the target plasmid is successfully constructed. The obtained plasmid is named pAAV-RC plasmid.

[0059] After successful sequencing, colony amplification is carried out, and then plasmid extraction and purification are performed. The protocol for plasmid extraction follows the instructions of the extraction kit. After the extracted plasmid is verified to be qualified, it is used for cell transfection.

[0060] 2. Adeno-associated virus packaging Day 1: Passage AAV-293 cells into 100 mm dishes for transfection. After the operation, place them in an incubator at 37 °C, 5% CO2, and 95% relative humidity.

[0061] Day 3: Transfection Cell observation: Confirm that the cell density reaches a confluence rate of approximately 80 - 90% before transfection can be carried out.

[0062] Liposome transfection: Opti MEM needs to be preheated in a 37 °C water bath, and Lipofiter TM transfection reagent needs to be restored to room temperature before use and shaken well before use.

[0063] The components of the transfection complex required for transfecting a 100 mm dish are shown in Table 5.

[0064] Table 5 Components of the transfection complex

[0065] Note: Lipofiter TM transfection reagent is a product of Hanheng Biotechnology. For the usage instructions, refer to the Lipofiter TM instruction manual.

[0066] Both the pHelper plasmid and the shuttle plasmid are auxiliary plasmids required for the preparation of adeno-associated virus. They are commercial plasmids and can be directly purchased.

[0067] Medium change: Replace the fresh complete medium containing 10% fetal bovine serum (FBS) 6 h after transfection.

[0068] Cell collection: 72 h after transfection, gently scrape the cells containing AAV particles with a cell scraper, collect them in a 15 mL centrifuge tube, centrifuge at 150×g for 3 min to collect the cells, remove the culture supernatant, wash once with PBS, and finally resuspend the cells in 300 μL PBS.

[0069] Cell lysis: Prepare a 37°C constant temperature water bath and liquid nitrogen. Freeze-thaw the centrifuge tube containing the cells three times repeatedly in liquid nitrogen and the 37°C water bath. Centrifuge at 4°C, 2000×g for 5 min to remove cell debris, and collect the lysate supernatant containing AAV particles.

[0070] 3. Purification of adeno-associated virus Treatment with universal nuclease: Add 0.1 μL of Benonase enzyme to every 1 mL of the crude virus extract, incubate in a 37°C water bath for 1 h to remove the cell genome and residual plasmid DNA in the virus solution. Centrifuge at 600×g, 4°C for 10 min, and take the supernatant.

[0071] Column purification (purify according to the Biomiga adeno-associated virus purification kit V1469-01).

[0072] Add the 4 mL AAV virus sample liquid obtained by column purification to an ultrafiltration tube, centrifuge at 1400×g for 30 min to obtain approximately 1 mL of AAV. Collect the finally purified virus and store it at -80°C.

[0073] 4. Quality detection of adeno-associated virus The key points for the quality control of adeno-associated virus include sterility detection, mycoplasma detection, and virus titer detection. 4.1 Sterility detection Detection method: Take 10 μL of the virus and add it to Hela cells in a 96-well plate for verification. After culturing for 24 h, examine under a microscope: QC standard: The medium should be clear and transparent, there should be no obvious particles in the cell gaps, and there should be no contamination by any bacteria or fungi.

[0074] 4.2 Mycoplasma detection Detection method: Take 10 μL of the virus, incubate in a 96°C water bath for 15 min, and then prepare a PCR reaction system in a laminar flow hood. After PCR reaction, perform electrophoresis to determine whether there is mycoplasma contamination.

[0075] QC standard: There should be no obvious bands in the PCR gel image.

[0076] 4.3 Titer Detection Digest the AAV virus sample with DNase I and proteinase K.

[0077] The DNase I enzyme reaction system is shown in Table 6.

[0078] Table 6 DNase I Enzyme Reaction System

[0079] Incubate in a water bath at 37 °C for about 1 h, then treat at 100 °C for 10 min. Then add 2 μL of proteinase K, incubate in a water bath at 55 °C for 1 h, then treat at 100 °C for 10 min, and centrifuge. After the treatment is completed, dilute 10-fold for use.

[0080] Dilute the standard quality plasmid and set the copy gradient of the standard to 10 5 、10 6 、10 7 、10 8 、10 9 、10 10 。

[0081] Configure the QPCR reaction system, design 3 replicates for each sample and standard, and the QPCR system is shown in Table 7.

[0082] Table 7 QPCR System

[0083] Perform QPCR reaction, and the program is shown in Table 8.

[0084] Table 8 QPCR Reaction Program

[0085] 4.4 Data Analysis Original experimental data. The Ct value data measured by the Roche LC96 real-time fluorescence quantitative PCR instrument is shown in Table 9.

[0086] Table 9 Statistical Table of Ct Value Data

[0087] Standard curve making. Take the average Ct value of each group of AAV standards as the ordinate Y, and the logarithm of the corresponding copy number as the abscissa X to make a standard curve ( Figure 2 ), and obtain the function formula and R square value of the standard curve.

[0088] Calculation of the titer of the sample to be tested. Calculate the average Ct value of the AAV sample to be tested, calculate the copy number X of the AAV template added, and then convert it into titer. The conversion formula is: AAV virus titer = 10 x × 400000 (dilution factor) vg / mL. The titers of the obtained samples are shown in Table 10.

[0089] Table 10 Sample titers

[0090] The adeno-associated virus containing shRNA1 is named AAV-shRNA1, the adeno-associated virus containing shRNA2 is named AAV-shRNA2, the adeno-associated virus containing shRNA3 is named AAV-shRNA3, and the control virus vector is named AAV-shNC.

[0091] The AAV adeno-associated virus is loaded with shRNA1, shRNA2 or shRNA3, and shRNA is used to knockdown FIBCD1 in the amygdala brain region.

[0092] Intracerebral stereotaxic injection of AAV-shRNA adeno-associated virus After SPS&S animal model mice were induced with isoflurane anesthesia, their heads were fixed in a stereotaxic apparatus, and the anesthetic state was maintained by adjusting the isoflurane concentration of 0.5% - 1.5%. Subsequently, the hair on the mouse's head was removed, the skin on the skull surface was incised, and the mucosal tissue on the skull surface was removed to expose the cranial suture. Under a stereomicroscope, the height of the anterior and posterior fontanelles was measured to keep the skull surface of the mouse horizontal. Using the amygdala localization coordinates on the mouse brain atlas, AAV-shRNA adeno-associated virus was injected at the coordinates. The injection speed was controlled at 20 - 40 nL / min. To ensure sufficient absorption of the virus, after the injection, the injection needle remained in place for 10 minutes for virus absorption, and triple antibiotics were applied after suturing the wound. Western blot experiments were started 3 - 4 weeks later to detect the virus effect.

[0093] As Figure 5 shown in Figure (B) of Figure 5 Figures (C) and (D) of Figure 5 show that both shRNA1 and shRNA2 have an interfering effect on FIBCD1, and the interfering effect of shRNA1 on FIBCD1 is the best. Therefore, AAV-shRNA1 was used for subsequent experiments.

[0094] (4) Open field test and elevated plus maze test Open field test: The open field test was conducted in an independent and quiet room. An open field box with rough and non-reflective inner walls (40 cm in length, width, and height) was used for the experiment, and a camera fixed directly above the open field was used for recording. At the start of the experiment, the mouse was placed in the center of the open field and recording began. The mouse freely explored the open field for 5 minutes. Using behavioral analysis software (Shanghai Xinruan Information Technology Co., Ltd.), the central area and the peripheral area were set, and the software analyzed and recorded the mouse's movement path in the open field, the number of times it entered the central area, the time it stayed in the central area, and the total distance traveled. After each trial, to avoid odor interference with subsequent experiments, the open field box was cleaned with 75% ethanol and feces and urine were removed.

[0095] Elevated plus maze test: The elevated plus maze test was conducted in an independent and quiet room. The elevated plus maze device consisted of two open arms (35 cm in length, 5 cm in width, 15 cm in height), two closed arms (35 cm in length, 5 cm in width, 15 cm in height), and a central platform (5 cm in length, 5 cm in width). A camera fixed directly above the EPM was used for recording. To prevent interference from the external environment on the mouse, a single-color, patternless light-shielding curtain was fixed around the EPM. At the start of the experiment, the mouse was placed on the central platform with its head facing the closed arm and recording began. The mouse freely explored the EPM for 5 minutes. Using software, the mouse's movement path in the EPM, the number of times it entered the open arms for exploration, and the time it spent exploring in the open arms were analyzed and recorded. After each trial, to avoid odor interference with subsequent experiments, the open field box was cleaned with 75% ethanol and feces and urine were removed.

[0096] Figure 6 The open field test and the elevated plus maze test were used to detect the anxiety-like behavior of mice. *P<0.05, #P<0.05, ****P<0.0001, #P<0.0001. Figure 6 In Figures (A), (B), and (C), the results of the open field test for detecting the motor ability and anxiety of mice are shown. Through Figure 6 In Figures (A) and (B), it was found that after SPS&S modeling, the exploration time and number of times in the central area of the open field of mice were significantly reduced, and this was reversed after injection of AAV-shRNA1 adeno-associated virus. Figure 6 Figure (C) shows that injection of adeno-associated virus had no effect on the motor ability of mice. Figure 6 Figures (D) and (E) show that after SPS&S modeling, the time and number of times mice entered the open arms were significantly reduced, and this was also reversed after injection of AAV-shRNA1 adeno-associated virus. In summary, the results of the open field test and the elevated plus maze test show that SPS&S modeling induces anxiety-like behavior in mice, and injection of AAV-shRNA1 adeno-associated virus exhibits anti-anxiety behavior.

[0097] (5)Context fear experiment and conditioned fear experiment The context fear experiment was tested using two different experimental chambers (A and B). Chamber A (30 cm long, 30 cm wide, 30 cm high, Shanghai Xinruan Information Technology Co., Ltd.) was used for environmental cued fear testing. It was composed of four pure-color opaque acrylic plates, and the metal rods at the bottom were connected to an electrostimulator. Chamber B had the same size and material as Chamber A, and the four walls were printed with black and white stripes (to create environmental differences).

[0098] On the 8th day after modeling, the mice were trained: The mice were placed in Chamber A for 180 s to adapt, and then a total of 3 cycles of conditioned stimulus (CS) and unconditioned stimulus (US) were carried out. The conditioned stimulus was a sound stimulus (75 dB, sine wave) lasting 28 s each time, and the unconditioned stimulus was a foot shock (0.8 mA) lasting 2 s each time; 24 hours later, the context fear test was carried out: The mice were placed in Chamber A without any sound or electrical stimulation, and the experimental process was recorded by a camera located at the top of Chamber A, maintaining the environmental settings during the fear training stage, and the mice freely explored for 5 min; The sound-cued fear test was carried out 24 hours later: The mice were placed in Chamber B for 180 s to adapt, and then the same sound stimulus as in the fear memory training stage was given for 3 min, and the experimental process was recorded by a camera located at the top of Chamber A; The behavior analysis software was used to analyze and record the time of immobility (Freezing time) of the mice in the two behavioral test stages.

[0099] The results of the context fear experiment are shown in Figure 7 Figure (B) below, and the results of the conditioned fear experiment are shown in Figure 7 Figure (C) below. From these two figures, it can be seen that the SPS&S group showed fear behaviors related to context and cue presentation. After injecting the AAV-shRNA1 adeno-associated virus, it had an improvement effect on the fear behaviors related to cue presentation, but had no effect on the fear behaviors related to context.

[0100] (6)Detection of fear generalization experiment On the 8th day after modeling, the mice were trained under the same conditions as the fear experiment, and the trained mice were placed in Chamber B; After adapting in Chamber B for 2 min, no electrical stimulation was given, and 3 - 4 pure tone stimuli (GS) with different frequencies and a sound stimulus (CS) (75 dB, lasting 30 s) were given. The sound order was randomly balanced, and each sound was separated by 30 - 90 s. 60 s after the end of the last sound, the mice were taken out of Chamber B and put back into the cage, with a total duration of 570 s. The percentage of immobility time of the mice during the sound presentation and during the sound intervals was recorded.

[0101] From Figure 8As can be seen from Figures (B) and (C), SPS&S induces the generalization of fear memory in mice. After injecting AAV-shRNA1 adeno-associated virus, the fear responses at 9, 4.8, and 2.5 KHz can be improved, but there is no response at 1.3 KHz.

[0102] (7)Detection of the expression of TLR2-NFkB and inflammatory factors Prepare 10% separating gel and 5% stacking gel for protein electrophoresis. Add 5 μL of appropriate marker and 20 μL of protein sample, perform electrotransfer, incubate with primary antibodies TLR2, NF-κB, p-NF-κB, IL-6, IL-1β, GAPDH, and β-actin after blocking, and incubate overnight at 4°C. Incubate with goat anti-rabbit secondary antibody, develop the image, and analyze the image with software to obtain and process the data.

[0103] The results are as Figure 9 shown. The expressions of TLR2 and p-NFkB in the SPS&S group are significantly higher than those in the CTL group. After injecting AAV-shRNA1 adeno-associated virus, the expressions of TLR2 and p-NFkB are significantly downregulated; the expressions of IL-6 and IL-1β increase in SPS&S mice, and the expression levels are significantly lower than those in the SPS&S group after injecting AAV-shRNA1 adeno-associated virus.

[0104] (8)Immunofluorescence detection of the expression of IL-6 in the amygdala Fix the mouse on the operating table of a small animal anesthesia machine, wear a respiratory anesthesia mask, anesthetize the mouse with isoflurane vapor, dissect and expose the mouse's heart, insert a perfusion needle into the left ventricle of the mouse, cut open the auricle above the right atrium, and slowly push the syringe to perfuse the whole body of the mouse with 37°C normal saline until the mouse's liver turns white, about 40 mL in total. Then continue to perfuse with 4% paraformaldehyde, about 30 mL in total until the mouse's limbs are completely stiff, decapitate the mouse, carefully separate the mouse's brain tissue, and fix it in the dark in 4% paraformaldehyde for 24 h. Subsequently, perform OCT embedding / fix the tissue, dehydrate it through a 15%-30% gradient sucrose solution, take samples and embed them in OCT, and section them at a thickness of 20 μm. The section position is: from Bregma -1.23 mm to -2.07 mm.

[0105] Wash the slices 3 times with PBS for 5 min each time. Place the brain tissue slices in an opaque wet box and immerse them completely in the blocking solution (0.5 g BSA + 50 mL 0.3% Trion X-100), and block at room temperature for 1 h. Dilute the IL-6 antibody with the blocking solution according to the ratio provided in the antibody instruction manual, and incubate overnight at 4°C. Wash 3 times with PBS for 5 min each time. Dilute the secondary antibody with PBS and incubate at room temperature for 2 h. Wash 3 times with PBS for 5 min each time. Uniformly drop the mounting medium containing DAPI on each brain tissue slice, and slowly cover the cover glass from one side. Take pictures and save them using a Leica confocal microscope.

[0106] The results are as Figure 10 shown. The expression level of IL-6 in the amygdala of the SPS&S group was significantly higher than that of the CTL group. After injecting the AAV-shRNA1 adenovirus-related virus, the level of IL-6 decreased, which was consistent with the WB results. Injecting the AAV-shRNA1 adenovirus-related virus could significantly reduce the level of inflammatory factors in the amygdala.

[0107] (9)Immunofluorescence detection of c-Fos expression in the amygdala Wash the slices 3 times with PBS for 5 min each time. Place the brain tissue slices in an opaque wet box and immerse them completely in the blocking solution (0.5 g BSA + 50 mL 0.3% Trion X-100), and block at room temperature for 1 h. Dilute the NeuN and c-FOS antibodies with the blocking solution according to the ratio provided in the antibody instruction manual, and incubate overnight at 4°C. Wash 3 times with PBS for 5 min each time. Dilute the cy3 and cy5 fluorescent secondary antibodies with PBS and incubate at room temperature for 2 h. Wash 3 times with PBS for 5 min each time. Uniformly drop the mounting medium containing DAPI on each brain tissue slice, and slowly cover the cover glass from one side. Take pictures and save them using a Leica confocal microscope.

[0108] The results are as Figure 11 shown. The c-Fos expression in the SPS&S group was significantly higher than that of the CTL group, indicating that the neurons in the amygdala were in an activated state; after injecting the AAV-shRNA1 adenovirus-related virus, the c-Fos expression decreased, and the number of active neurons decreased.

[0109] The present invention clarifies the mechanism of action of FIBCD1 on PTSD ( Figure 12 ): PTSD increases the expression of FIBCD1 on microglia in the amygdala brain region of mice, and promotes the secretion of inflammatory factors through the TLR2-NFkB signaling pathway. The increase in IL-6 secretion leads to the activation of amygdala neurons, resulting in abnormal fear memory.

[0110] In summary, the present invention has determined that FIBCD1 is highly expressed in the amygdala region of PTSD mice, suggesting that FIBCD1 is closely related to PTSD. The high expression of FIBCD1 in the amygdala region plays a key role in the occurrence and development of PTSD and is an adverse factor. As a target, inhibiting both its protein and function can play a good role in anti-PTSD and has great potential in the treatment of PTSD, drug screening, etc. In this regard, the present invention has designed a series of shRNAs that interfere with the expression of FIBCD1, and constructed AAV-shRNA adeno-associated virus. After injecting AAV-shRNA adeno-associated virus into the amygdala region of SPS&S mice, it was found that it could reverse the PTSD-like symptoms caused by SPS&S.

[0111] The present invention discovers that the above is only the preferred embodiment of the present invention and is not used to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. An shRNA that interferes with the expression of FIBCD1, characterized in that, The shRNA is shRNA1 or shRNA2; The DNA sequence corresponding to shRNA1 is shown as SEQ ID NO.5-6; The DNA sequence corresponding to shRNA2 is shown as SEQ ID NO 8-9.

2. The shRNA that interferes with the expression of FIBCD1 according to claim 1, characterized in that, The Gene ID of the FIBCD1 is 84929.

3. A recombinant plasmid, characterized in that And, the recombinant plasmid contains the shRNA for interfering with the expression of FIBCD1 as claimed in claim 1 or 2.

4. A carrier, characterized in that, The vector contains the shRNA for interfering with the expression of FIBCD1 as claimed in claim 1 or 2 or the recombinant plasmid as claimed in claim 3.

5. The carrier according to claim 4, wherein The vector is obtained by effectively linking the shRNA as claimed in claim 1 or 2 to an adeno-associated virus vector.

6. The carrier according to claim 4 or 5, characterized in that, The adeno-associated virus vector is pHBAAV-U6-MCS-CMV-EGFP.

7. Use of the shRNA as claimed in claim 1 or 2, the recombinant plasmid as claimed in claim 3, and the vector as claimed in any one of claims 4-6 in the preparation of a product for treating post-traumatic stress disorder.

8. The application according to claim 7, wherein The product is a drug.

9. The application according to claim 8, characterized in that, The dosage form of the drug includes one of liquid dosage forms and solid dosage forms.

10. The application according to claim 9, wherein The liquid dosage form includes any one of injections, solutions, suspensions, emulsions and aerosols, and the solid dosage form includes any one of tablets, capsules and powders.

Images