Application of miR-151-5p as target spot in preparation of product for regulating and controlling follicular development

Abstract

The invention provides application of miR-151-5p as a target spot in preparation of a product for regulating follicle development, and belongs to the technical field of molecular biology. The invention provides an application of miR-151-5p in preparation of a reagent for regulating a follicle development process, and the miR-151-5p can inhibit cell proliferation, prevent a cell cycle, inhibit expression of goat ovarian granular cell proliferation related genes, inhibit ovarian granular cell proliferation related genes, inhibit ovarian granular cell proliferation related genes and inhibit ovarian granular cell proliferation related genes. But can promote secretion of goat ovarian granular cell steroid hormones, expression of related genes secreted by the steroid hormones, expression of key proteins secreted by the ovarian granular cell steroid hormones, and the like. According to the invention, a target gene PGAM1 of the miR-151-5p is also screened, and the miR-151-5p inhibits the target gene PGAM1 from playing a role in a mode of degrading mRNA (messenger ribonucleic acid). Therefore, the development process of the follicles can be regulated and controlled by regulating and controlling the miR-151-5p and / or the PGAM1.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology, and particularly relates to the application of miR-151-5p as a target in the preparation of products for regulating follicular development. Background Art

[0002] The ovary is an important organ that determines the fertility of female animals, and one of its main functions is follicular development and ovulation. Follicles are the basic structural and functional units of the ovary, and their main function is ovulation and hormone secretion. During follicular development, granulosa cells change from flat to cuboidal and then differentiate, and these series of changes all play important roles in the growth and development of oocytes, the initiation of primordial follicle growth, the regulation of growing follicle development, and follicular atresia. In addition, granulosa cell apoptosis is also an important mechanism for initiating follicular atresia. Excessive apoptosis of granulosa cells in follicles will induce follicular atresia, reduce the estrus frequency of female animals, and thus affect the productivity of female animals.

[0003] As an important component of follicles, granulosa cells are the main sites of estrogen synthesis. During follicular development, they gradually proliferate from a single-layer flat shape to a multi-layer columnar shape, and produce cytokines, growth factors, estrogen, etc. related to follicular development, promoting follicular maturation. It is currently believed that the processes of follicle recruitment, selection, and ovulation are essentially the proliferation and differentiation of granulosa cells, while the apoptosis of granulosa cells represents follicular atresia and regression.

[0004] miR-151-5p is a microRNA, and its expression levels are different in different tumors. In tumors such as pituitary adenoma, acute myeloid leukemia, endometrial cancer, lung cancer, Barrett's esophagus carcinogenesis, colorectal cancer, myelodysplastic syndrome, hepatocellular carcinoma, and breast cancer, its expression is mostly up-regulated, playing an oncogene role; while in malignant pleural mesothelioma, central nervous system lymphoma, chronic myeloid leukemia, and acute lymphoblastic leukemia, it shows a tumor suppressor effect; and the miR-151-5p also has disease diagnosis and prognosis value. In head and neck squamous cell carcinoma, the expression level of miR-151-5p is significantly correlated with the metastatic behavior and prognosis of tumors, and can be used as a biomarker to judge whether head and neck squamous cell carcinoma metastasizes and evaluate the prognosis. At the same time, there are also studies found that miR-151-5p is also related to memory formation and vascular endothelial cell function, but the relationship between miR-151-5p and follicular development has not been studied. Summary of the Invention

[0005] The present invention provides the application of miR-151-5p as a target in the preparation of products for regulating follicular development, and the miR-151-5p can play a role during follicular development.

[0006] The present invention provides the use of miR-151-5p in the preparation of a reagent for regulating the process of follicular development.

[0007] In a preferred embodiment of the present invention, the regulation includes regulating at least one of the following: (1) regulating the proliferation of ovarian granulosa cells; (2) regulating the number of follicles; (3) regulating the cell cycle of ovarian granulosa cells; (4) regulating the secretion of steroid hormones by ovarian granulosa cells.

[0008] In a preferred embodiment of the present invention, regulating the cell cycle of ovarian granulosa cells includes regulating the process of ovarian granulosa cells from the G1 phase to the S phase.

[0009] In a preferred embodiment of the present invention, regulating the secretion of steroid hormones by ovarian granulosa cells includes: regulating the secretion of estrogen and / or progesterone, regulating the expression of genes related to steroid hormone secretion, and regulating the secretion of proteins related to steroid hormone secretion.

[0010] In a preferred embodiment of the present invention, the target genes of miR-151-5p include PGAM1 .

[0011] The present invention also provides the use of a reagent for promoting the expression of miR-151-5p in the preparation of any one of the following products: a product for inhibiting the proliferation of ovarian granulosa cells, a product for reducing the number of follicles, a product for blocking the cell cycle of ovarian granulosa cells, and a product for promoting the secretion of steroid hormones by ovarian granulosa cells.

[0012] In a preferred embodiment of the present invention, the reagent for promoting the expression of miR-151-5p includes at least one of the following: an agonist of miR-151-5p, a mimic of miR-151-5p, an overexpression vector containing the base sequence of miR-151-5p, an overexpression vector containing the base sequence of the mimic of miR-151-5p, a composition containing miR-151-5p, a composition containing the agonist of miR-151-5p, and a composition containing the mimic of miR-151-5p.

[0013] The present invention also provides the use of a reagent for inhibiting the expression of miR-151-5p in the preparation of any one of the following products: a product for promoting the proliferation of ovarian granulosa cells, a product for increasing the number of follicles, and a product for inhibiting the secretion of steroid hormones by ovarian granulosa cells.

[0014] In a preferred embodiment of the present invention, the reagent for inhibiting the expression of miR-151-5p includes at least one of the following: an inhibitor of miR-151-5p and an antagonist of miR-151-5p.

[0015] The present invention also provides a reagent for promoting follicular development, including a reagent for inhibiting the expression of miR-151-5p and / or a reagent for promoting PGAM1 expression.

[0016] Beneficial effects: The present invention provides the application of miR-151-5p in the preparation of a reagent for regulating the process of follicular development. The miR-151-5p is differentially expressed in large and small follicles and is significantly up-regulated in large follicles, indicating that the miR-151-5p may play a role in the process of follicular development. In one embodiment of the present invention, using goat ovarian granulosa cells as the host, by transfecting miR-151-5p mimics and inhibitors, it is found that after overexpressing miR-151-5p, the cell proliferation activity is significantly reduced, and after interfering with miR-151-5p, the cell proliferation activity is significantly reduced, indicating that miR-151-5p can inhibit cell proliferation. Specifically, miR-151-5p can block the process of cells from the G1 phase to the S phase.

[0017] The miR-151-5p of the present invention can also inhibit the expression of genes related to the proliferation of goat ovarian granulosa cells, and at the same time inhibit the expression of key proteins during the proliferation of ovarian granulosa cells. However, miR-151-5p can promote the secretion of steroid hormones by goat ovarian granulosa cells, promote the expression of genes related to steroid hormone secretion, and promote the expression of key proteins for steroid hormone secretion by ovarian granulosa cells, etc.

[0018] The present invention has also screened the target gene of the miR-151-5p PGAM1 , and there is a binding site between the 3' UTR region of the PGAM1 and the miR-151-5p. At the same time, the miR-151-5p inhibits the target gene PGAM1 by degrading mRNA to exert its function. The target gene PGAM1 of the present invention can promote the proliferation of goat ovarian granulosa cells. At the same time, interfering with PGAM1 can inhibit the cell cycle process of ovarian granulosa cells from the G1 phase to the S phase, inhibit the expression of key genes for cell proliferation, and promote the secretion of steroid hormones by goat ovarian granulosa cells. At the same time, the present invention also finds that the miR-151-5p regulates the function of granulosa cells by regulating the phosphorylation state of AKT, while PGAM1 regulates the function of ovarian granulosa cells through the PI3K / AKT signaling pathway. Therefore, the development process of follicles can be regulated by regulating the miR-151-5p and / or PGAM1 . BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1It is the figure of the relative expression level of miR-151-5p in large and small follicles and the verification result of the transfection efficiency of miR-151-5p in goat ovarian granulosa cells; in the figure, A: the relative expression level of miR-151-5p in large and small follicles; B: the relative expression level of miR-151-5p in goat ovarian granulosa cells after transfection with miR-151-5p mimics; C: the relative expression level of miR-151-5p in goat ovarian granulosa cells after transfection with miR-151-5p inhibitor; Figure 2 It is the figure of the effect of miR-151-5p on the viability of goat ovarian granulosa cells; in the figure, A: the effect of overexpressing miR-151-5p on cell proliferation viability detected by CCK-8; B: the effect of interfering with miR-151-5p on cell proliferation viability detected by CCK-8; Figure 3 It is the figure of the effect of miR-151-5p on the proliferation of goat ovarian granulosa cells detected by EdU; Figure 4 It is the figure of miR-151-5p inhibiting the cell cycle progression of goat ovarian granulosa cells; in the figure, A: the effect of miR-151-5p mimics on the cell cycle progression of goat ovarian granulosa cells detected by flow cytometry; B: the effect of miR-151-5p inhibitor on the cell cycle progression of goat ovarian granulosa cells detected by flow cytometry; Figure 5 It is the figure of the effect of miR-151-5p on the genes related to the proliferation of ovarian granulosa cells; in the figure, A: the statistical results of the quantification of the marker genes related to proliferation after overexpressing miR-151-5p; B: the statistical results of the quantification of the marker genes related to proliferation after interfering with miR-151-5p; Figure 6 It is the figure of the effect of miR-151-5p on the expression of proteins related to the proliferation of ovarian granulosa cells. In the figure, A: the western blot results of the proteins related to cell proliferation after overexpressing miR-151-5p; B: the visual analysis of the western blot results of the proteins related to cell proliferation after overexpressing miR-151-5p; C: the western blot results of the proteins related to cell proliferation after interfering with miR-151-5p; D: the visual analysis of the western blot results of the proteins related to cell proliferation after interfering with miR-151-5p; Figure 7 It is the figure of the effect of miR-151-5p on the steroid hormone secretion of ovarian granulosa cells. In the figure, A: the effect of miR-151-5p on estrogen secretion of ovarian granulosa cells; B: the effect of miR-151-5p on progesterone secretion of ovarian granulosa cells; Figure 8Results of the effect of miR-151-5p on the expression of genes related to steroid hormone secretion in ovarian granulosa cells; Figure 9 Results of the effect of miR-151-5p on the expression of proteins related to steroid hormone secretion in ovarian granulosa cells. In the figure, A: Western blot results of proteins related to cell steroid hormone secretion after overexpression of miR-151-5p; B: Visual analysis of Western blot results of proteins related to cell steroid hormone secretion after overexpression of miR-151-5p; C: Western blot results of proteins related to cell steroid hormone secretion after interfering with miR-151-5p; D: Visual analysis of Western blot results of proteins related to cell steroid hormone secretion after interfering with miR-151-5p; Figure 10 Results of transcriptome differential gene analysis of miR-151-5p. In the figure, A: Volcano plot of differentially expressed genes; B: Heat map of clustering analysis of differentially expressed genes; Figure 11 Circular diagram of differential gene enrichment analysis. In the figure, A: Circular diagram of GO enrichment analysis; B: Circular diagram of KEGG enrichment analysis; Figure 12 Results of RT-qPCR verification of differentially expressed genes; Figure 13 Results of dual-luciferase analysis of the targeting relationship between miR-151-5p and PGAM1 ; Figure 14 Results of the effect on PGAM1 expression after interfering with miR-151-5p; Figure 15 Results of the change in PGAM1 mRNA expression level under the action of siRNA; Figure 16 Results of CCK-8 detection of the effect of interfering with PGAM1 on cell proliferation viability; Figure 17 Results of EdU detection of the effect of PGAM1 on the proliferation of goat ovarian granulosa cells; Figure 18 Results of PGAM1 promoting the cell cycle progression of goat ovarian granulosa cells; Figure 19 Results of PGAM1 on the genes related to the proliferation of ovarian granulosa cells; Figure 20 Results of PGAM1 on the expression of proteins related to the proliferation of ovarian granulosa cells and the verification of the interference effect. In the figure, A: Western blot results of proteins related to cell proliferation after interfering with PGAM1 ; B: After interfering withPGAM1 Subsequent visualization analysis of the immunoblotting results of proteins related to cell proliferation; Figure 21 For interference PGAM1 Effect on the steroid hormone secretion of ovarian granulosa cells. In the figure, A: Interference PGAM1 Effect on the estrogen secretion of ovarian granulosa cells; B: Interference PGAM1 Effect on the progesterone secretion of ovarian granulosa cells; Figure 22 For PGAM1 Figure of the effect on the expression of genes related to steroid hormone secretion in ovarian granulosa cells; Figure 23 For PGAM1 Figure of the effect on the expression of proteins related to steroid hormone secretion in ovarian granulosa cells. In the figure, A: Immunoblotting results of proteins related to steroid hormone secretion in cells after overexpression of miR-151-5p; B: Visualization analysis of the immunoblotting results of proteins related to steroid hormone secretion in cells after overexpression of miR-151-5p; C: Immunoblotting results of proteins related to the PI3K / AKT signaling pathway in cells after interference with miR-151-5p; D: Visualization analysis of the immunoblotting results of proteins related to the PI3K / AKT signaling pathway in cells after interference with miR-151-5p; PGAM1 Subsequent immunoblotting results of proteins related to steroid hormone secretion in cells; B: Interference PGAM1 Subsequent visualization analysis of the immunoblotting results of proteins related to steroid hormone secretion in cells; Figure 24 Figure of the effect of miR-151-5p on the protein expression of the PI3K / AKT signaling pathway in goat ovarian granulosa cells. In the figure, A: Immunoblotting results of proteins related to the PI3K / AKT signaling pathway after overexpression of miR-151-5p; B: Visualization analysis of the immunoblotting results of proteins related to the PI3K / AKT signaling pathway after overexpression of miR-151-5p; C: Immunoblotting results of proteins related to the PI3K / AKT signaling pathway after interference with miR-151-5p; D: Visualization analysis of the immunoblotting results of proteins related to the PI3K / AKT signaling pathway after interference with miR-151-5p; Figure 25 For PGAM1 Figure of the effect on the protein expression of the PI3K / AKT signaling pathway in goat ovarian granulosa cells. In the figure, A: Interference PGAM1 Subsequent immunoblotting results of proteins related to the PI3K / AKT signaling pathway; B: Interference PGAM1 Subsequent visualization analysis of the immunoblotting results of proteins related to the PI3K / AKT signaling pathway; Figure 26 Figure of the effect of miR-151-5p on mouse ovarian development. In the figure, A: HE-stained sections of mouse ovaries after injection of miR-151-5p antagonist into the ovaries; B: Count of follicles at all levels in mouse ovaries after injection of miR-151-5p antagonist; C: HE-stained sections of mouse ovaries after injection of miR-151-5p agonist into the ovaries; D: Count of follicles at all levels in mouse ovaries after injection of miR-151-5p agonist. Specific implementation manners

[0020] The present invention provides the application of miR-151-5p in the preparation of a reagent for regulating the process of follicular development.

[0021] The base sequence of miR-151-5p described in the present invention is shown as SEQ ID No.1: 5'-UCGAGGAGCUCACAGUCUAGU-3'.

[0022] The present invention confirms that the use of the said miR-151-5p can regulate the process of follicular development, specifically including any one of the following: (1) regulating the proliferation of ovarian granulosa cells; (2) regulating the number of follicles; (3) regulating the cell cycle of ovarian granulosa cells; (4) regulating the secretion of steroid hormones by ovarian granulosa cells.

[0023] In an embodiment of the present invention, taking goat ovarian granulosa cells as an example, overexpression of the said miR-151-5p can inhibit the proliferation of ovarian granulosa cells, and after inhibiting the expression of the said miR-151-5p, the proliferation of ovarian granulosa cells is promoted.

[0024] In an embodiment of the present invention, taking goat ovarian granulosa cells as an example, after inhibiting the expression of the said miR-151-5p, the number of follicles can be increased, and after overexpressing the said miR-151-5p, the number of follicles can be reduced, and ovarian development is abnormal.

[0025] In an embodiment of the present invention, the effect of the said miR-151-5p on the cell cycle of goat ovarian granulosa cells was verified by flow cytometry. The results showed that after overexpressing the said miR-151-5p, the proportion of G1-phase cells increased significantly, the proportion of S-phase cells decreased significantly, and the proportion of G2-phase cells did not change significantly. After inhibiting the said miR-151-5p, the proportion of G1-phase cells decreased significantly, the proportion of S-phase cells increased significantly, and the proportion of G2-phase cells did not change significantly, proving that the said miR-151-5p can regulate the cell cycle of ovarian granulosa cells.

[0026] In an embodiment of the present invention, a comparative experiment of overexpressing and interfering with the expression of the said miR-151-5p was also used to verify the effect of the said miR-151-5p on the genes related to the proliferation of goat ovarian granulosa cells. The results showed that after overexpressing the said miR-151-5p, PCNA 、 CDK4 and CCND1 the mRNA expression levels were significantly reduced, P53 the mRNA expression level of PCNA 、 CDK6 and CCND1The mRNA expression level of P53 was significantly decreased, indicating that miR-151-5p could inhibit cell proliferation. Meanwhile, Western Blot detection found that the miR-151-5p could inhibit the expression of key proteins during the proliferation of ovarian granulosa cells.

[0027] In one embodiment of the present invention, ELISA experiments confirmed that the miR-151-5p could promote the secretion of steroid hormones by goat ovarian granulosa cells, and the steroid hormones included estrogen and / or progesterone. Meanwhile, it promoted the expression of genes related to the secretion of steroid hormones by ovarian granulosa cells and the expression of key proteins for the secretion of steroid hormones by ovarian granulosa cells.

[0028] In one embodiment of the present invention, the target gene of the miR-151-5p was also screened PGAM1 , and the binding site was located in the 3' UTR region of PGAM1 , and the miR-151-5p inhibited PGAM1 by degrading mRNA to exert its function.

[0029] The present invention also provides the application of a reagent for promoting the expression of miR-151-5p in the preparation of any one of the following products: a product for inhibiting the proliferation of ovarian granulosa cells, a product for reducing the number of follicles, a product for arresting the cell cycle of ovarian granulosa cells, and a product for promoting the secretion of steroid hormones by ovarian granulosa cells.

[0030] In a preferred embodiment of the present invention, the reagent for promoting the expression of miR-151-5p includes at least one of the following: an agonist of the miR-151-5p, a mimic of the miR-151-5p, an overexpression vector containing the base sequence of the miR-151-5p, an overexpression vector containing the base sequence of the mimic of the miR-151-5p, a composition containing the miR-151-5p, a composition containing the agonist of the miR-151-5p, and a composition containing the mimic of the miR-151-5p. In one embodiment of the present invention, for the base sequence of the mimic of the miR-151-5p, the nucleotide sequence of the forward strand is as shown in SEQ ID No.2: 5'-UCGAGGAGCUCACAGUCUAGU-3', and the nucleotide sequence of the reverse strand is as shown in SEQ ID No.3: 5'-UAGACUGUGAGCUCCUCGAUU-3'.

[0031] The present invention also provides the application of a reagent for inhibiting the expression of miR-151-5p in the preparation of any one of the following products: a product for promoting the proliferation of ovarian granulosa cells, a product for increasing the number of follicles, and a product for inhibiting the secretion of steroid hormones by ovarian granulosa cells.

[0032] In a preferred embodiment of the present invention, the reagent for inhibiting miR-151-5p expression comprises at least one of the following: an inhibitor of miR-151-5p and an antagonist of miR-151-5p. The nucleotide sequence of the inhibitor designed in one embodiment of the present invention is shown in SEQ ID No.4: 5'-ACUAGACUGUGAGCUCCUCGA-3'.

[0033] The present invention also provides a reagent for promoting follicular development, comprising a reagent for inhibiting miR-151-5p expression and / or a reagent for promoting PGAM1 expression.

[0034] As described in the present invention PGAM1 can promote cell proliferation and regulate the cell cycle of ovarian granulosa cells. For example, after interfering with the PGAM1 the proportion of G1-phase cells increases significantly, the proportion of S-phase cells decreases significantly, and the proportion of G2-phase cells shows no significant change.

[0035] In one embodiment of the present invention, three si-PGAM1s were designed to interfere with the PGAM1 expression. The nucleotide sequence of the forward strand of si-PGAM1-1 is shown in SEQ ID No.5: 5'-CCUACAAGCUGGUGCUGAUTT-3', and the nucleotide sequence of the reverse strand is shown in SEQ ID No.6: 5'-AUCAGCACCAGCUUGUAGGTT-3'; the nucleotide sequence of the forward strand of si-PGAM1-2 is shown in SEQ ID No.7: 5'-GCUUCACCUCAGUGCAGAATT-3', and the nucleotide sequence of the reverse strand is shown in SEQ ID No.8: 5'-UUCUGCACUGAGGUGAAGCTT-3'; the nucleotide sequence of the forward strand of si-PGAM1-3 is shown in SEQ ID No.9: 5'-GGUACGCAGACCUCACUGATT-3', and the nucleotide sequence of the reverse strand is shown in SEQ ID No.10: 5'-UCAGUGAGGUCUGCGUACCTT-3'.

[0036] To further illustrate the present invention, the application of miR-151-5p as a target in the preparation of products for regulating follicular development provided by the present invention will be described in detail below with reference to examples, but they should not be construed as limiting the protection scope of the present invention.

[0037] Room temperature referred to in the present invention means 25°C.

[0038] In the present invention, unless otherwise specified, the materials and methods used can be routinely obtained in the art: 1. Isolation and culture of goat ovarian granulosa cells For female goats from Leizhou goats, 15 goats with similar body weights, good health, and parity of 2 or more were selected. All the Leizhou goats whose ovaries were collected were subjected to estrus synchronization treatment. After slaughter, the ovarian tissues were quickly separated, then the ovarian tissues were soaked in 75% alcohol for 10 s, and then soaked in physiological saline containing 2% double antibiotics for 10 s. After the soaking, the ovarian tissues were stored in physiological saline containing 2% double antibiotic solution at 37°C and transported back to the laboratory as soon as possible for the isolation of ovarian granulosa cells.

[0039] After bringing them back to the laboratory, first disinfect the ovarian surface with 75% alcohol, then put the goat ovaries into DMEM / F12 medium containing 2% double antibiotics. Use a 1 mL sterile syringe to puncture the follicles, and then use 0.5 mL of the medium to blow the follicular cavity to release the ovarian granulosa cells into the cell culture medium. Filter the larger tissue blocks with a 70 μm cell sieve. After filtration, transfer the cell culture medium to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 10 min. Then resuspend the goat ovarian granulosa cells with 10 mL of complete medium (90% DMEM / F12 + 10% FBS + 2% double antibiotics), and then place them in a 10 cm culture dish and culture in an incubator at 37°C and 5% CO2 for 24 h. After 24 h, discard the non-adherent cells and replace them with fresh complete medium. After that, change the cell culture medium every 48 h. When the cells grow to about 80%, perform cell passage and cell cryopreservation.

[0040] 2. Cell transfection When the cell density reaches 50% - 60%, use the Invitrogen™ Lipofectamine 3000 transfection kit for transfection.

[0041] 3. Detection of cell viability and proliferation Use CCK-8 to detect cell viability. The test steps are as follows: Inoculate well-grown goat ovarian granulosa cells into a 96-well plate, add 100 μL of cell suspension to each well, and repeat the verification test 3 times. Add PBS around the cell suspension wells to prevent evaporation of the solution in the wells to be tested. Then culture the cells in an incubator at 37°C and 5% CO2 for 2 - 4 h. After the cells adhere, perform subsequent treatments. The cell proliferation viability is evaluated by CCK-8 reagent. After adding 10 μL of CCK-8 reagent to each well, continue to incubate in the incubator for 2 h. At different time points of the experiment (24 h, 48 h, 72 h), use an enzyme-linked immunosorbent assay (ELISA) reader to measure the absorbance at 450 nm to evaluate the cell proliferation viability.

[0042] Cell proliferation was detected using an EdU reagent. The EdU detection kit used was the Ribobio Cell-Light EdU Apollo 567 In Vitro Kit. After adding 100 μL of 50 μM EdU to each well, the cells were incubated in an incubator for 2 h, then washed twice with PBS, fixed with 4% paraformaldehyde for 30 min, and then 50 μL of 2 mg / mL glycine was added to neutralize the remaining aldehyde groups. After that, 100 μL of 0.5% Triton X-100 PBS was added to permeabilize the cell membrane. Then 100 μL of Apollo solution was added, and the cells were left in the dark at room temperature for 30 min. Subsequently, the cells were washed with PBS, and stained with Hoechst 33342 dye in the dark at room temperature for 30 min to stain the cell nuclei. After the incubation was completed, fluorescence was observed using a fluorescence microscope, and the number of cell nuclei and EdU-stained cells was analyzed using ImageJ software. Calculation formula: Cell proliferation rate (%) = Number of EdU-stained cells / Hoechst 33342 × 100%.

[0043] 4. Flow cytometry Goat ovarian granulosa cells were seeded in 6-well plates. After 48 h of transfection, about 5×10 5 cells were collected by trypsin digestion and the cells were washed with PBS. The cells were resuspended in 0.3 mL of PBS, then 1.2 mL of -20°C absolute ethanol was added, and the cells were fixed overnight in a -20°C refrigerator. Then the cells were washed with PBS and left to stand at room temperature for 15 min. Then 100 μL of RNase A Reagent was added and incubated in a 37°C water bath for 30 min. 400 mL of PI Reagent (50 μL / mL) was added, and the cells were incubated in the dark at 2 - 8°C for 30 min, and then the red fluorescence at an excitation wavelength of 488 nm was recorded by flow cytometry.

[0044] 5. Enzyme-linked immunosorbent assay (ELISA) Goat ovarian granulosa cells were seeded in 6-well plates. After 48 h of transfection, the cell supernatant was collected, and the secretion levels of estradiol (E2) and progesterone (P4) were detected using an ELISA kit. According to the kit instructions, the absorbance of 50 μL of cell supernatant at 450 nm was measured using an enzyme-labeled instrument, and then a standard curve was analyzed by linear regression, and the corresponding sample concentration was calculated. The average coefficient of variation between batches was less than 15%, and the sensitivity of the kit was 1 pmol / mL.

[0045] 6. Total RNA extraction, reverse transcription, and fluorescence quantitative PCR Total RNA was extracted and purified according to the instructions of Invitrogen Trizol reagent. The concentration and purity of the extracted RNA were detected using a ultra-micro spectrophotometer. The ratio of 260 nm to 280 nm for all samples was greater than 1.8 and less than 2.0. miRNA was reverse-transcribed using the miRNA cDNA First Strand Synthesis Premix (stem-loop method) from Aikerui Company, and the reverse transcription primers were designed using miRNA Desigen V1.10 software. The reverse transcription of mRNA was performed using the PrimeScript TM RT reagent Kit from Takara Company. Using the reverse transcription product (cDNA) as a template, fluorescence quantitative PCR was carried out. The relative expression levels of genes were calculated by the 2 -ΔΔCt method. U6 was used as an internal reference for miRNA quantification, and GAPDH was used as an internal reference for mRNA quantification. The P value was calculated by t-test. P < 0.05 and P < 0.01 indicated significant differences. Primers were designed using NCBI, and all primers were synthesized by Sangon Biotech Co., Ltd.

[0046] 20 μL reaction system: 10 μL of 2×ChamQ SYBR qPCR Master Mix, 0.4 μL of upstream primer F (10 μM), 0.4 μL of downstream primer R (10 μM), 1 μL of cDNA, 8.2 μL of ddH2O.

[0047] The reaction program was: pre-denaturation at 95°C for 30 s; cycling reaction at 95°C for 10 s, 60°C for 30 s, for 40 cycles; melting curve at 95°C for 15 s, 60°C for 60 s, 95°C for 15 s.

[0048] The primer sequences are as follows: PCNA-F (SEQ ID No.11): GAACCTCACCAGCATGTCCA; PCNA-R (SEQ ID No.12): TGCCAAGGTGTCCGCATTAT; CCND1-F (SEQ ID No.13): CACCTGTATGTTCGTGGCCT; CCND1-R (SEQ ID No.14): TGAACTTCACGTCTGTGGCA; CDK4-F (SEQ ID No.15): GAGCATCCCAATGTTGTCAGG; CDK4-R (SEQ ID No.16): ACTGGCGCATCAGATCCTTT; CDK6-F (SEQ ID No.17): GACCAGCAGTATGAGTGCGT; CDK6-R (SEQ ID No.18): CACGTCAAACAACCTGACCAC; P53-F (SEQ ID No.19): GGTCTCCGGGGTCATCTAGC; P53-R (SEQ ID No.20): GGAGAGCTCGGAGGACAGAAG; STAR-F (SEQ ID No.21): CATTGACCTCAAGGGATGGCT; STAR-R (SEQ ID No.22): CAACACCTGGCTTCAAGAGC; CYP11A1-F (SEQ ID No.23): GCTGCGGAAGGAGGTTCTGAATG; CYP11A1-R (SEQ ID No.24): GCACCAGTGTCTTGGCAGGAATC; 3β-HSD-F (SEQ ID No.25): TCTGCCTGTTGGTGGAGGAGAAG; 3β-HSD-R (SEQ ID No.26): GATGACAGAAGCGGTGTGGATGAC; GAPDH-F (SEQ ID No.27): GTTTGTGATGGGCGTGAACC; GAPDH-R (SEQ ID No.28): GCGTGGACAGTGGTCATAAGT; U6-F (SEQ ID No.29): GTGCTCGCTTCGGCAGCACAT; U6-R (SEQ ID No.30): ATCCAGTGCAGGGTCCGAGG; miR-151-5p-F (SEQ ID No.31): CGCGTCGAGGAGCTCACAG; miR-151-5p-R (SEQ ID No.32): AGTGCAGGGTCCGAGGTATT; PLAC8-F (SEQ ID No.33): ACCTCAAAACTCCAACTGGCA; PLAC8-R (SEQ ID No.34): AAATGTGCCGCAGAGACAGAC; SERPINH1-F (SEQ ID No.35): CATGTTCTTCAAGCCGCACTG; SERPINH1-R (SEQ ID No.36): CATGGTGACACCCACGGTAT; LAP3-F (SEQ ID No.37): CAGACGTCTTCATCAGACCCA; LAP3-R (SEQ ID No.38): TCCCAACAAACACCAACGGA; PPIB-F (SEQ ID No.39): GATGGCACTGGAGGTAAGAGC; PPIB-R (SEQ ID No.40): ATGAAGAACTGGGAGCCGTT; IQGAP1-F (SEQ ID No.41): AACAGAGTCCCGAGCATAGC; IQGAP1-R (SEQ ID No.42): TGCTCAGCTGTTTCCACACT; LMNB1-F (SEQ ID No.43): GAATCCGAGGCCAGCAGTAG; LMNB1-R (SEQ ID No.44): TCCCATTGGTTGGTCCTGTTC; SULF1-F (SEQ ID No.45): ACCTGCAGCTGATGGAACTC; SULF1-R (SEQ ID No.46): TCCCATAACTGTCCTCTGTGC; ASPM-F (SEQ ID No.47): AAATCGAAGCTCGGCGGTTA; ASPM-R (SEQ ID No.48): TTCTGCCGTTCTCCCACATC.

[0049] 7. Western blot Protein extraction and denaturation: After washing the cell samples with PBS, 200 μL of RIPA protein lysate was added. After thorough mixing, the samples were lysed on ice for 10 min. The lysate products were collected and centrifuged at 13,000 rpm for 15 min at 4°C. The supernatant was taken and 4× protein loading buffer was added. Then the samples were placed on a metal bath at 100°C for 10 min for denaturation. The denatured protein samples were stored at -80°C for later use.

[0050] Electrophoresis: Assemble the electrophoresis rack, add electrophoresis buffer, and add 5 - 10 μL of protein sample and Maker to each well for electrophoresis. The electrophoresis conditions were 120 V for 45 min. Stop electrophoresis when the bromophenol blue ran to 0.5 cm from the bottom of the gel.

[0051] Transfer and blocking: Soak the transfer cassette in the transfer buffer in advance, and then place it in the order of positive electrode - cellulose pad - filter paper - PVDF membrane - gel - filter paper - cellulose pad - negative electrode. The PVDF membrane needs to be activated with ethanol. The transfer conditions were 0.4 A for 70 min. After transfer, take out the PVDF membrane and place it in 5% non-fat milk powder or 5% BSA solution, and block it on a shaker at room temperature for 60 min.

[0052] Antibody incubation: Pour out the blocking solution and wash 3 times with TBST, 5 min each time. Then add the diluted primary antibody and incubate overnight at 4°C. The next day, recover the primary antibody, wash the membrane 5 times with TBST, 5 min each time, then add the diluted secondary antibody and incubate at room temperature for 60 min, and wash the membrane 5 times with TBST, 5 min each time.

[0053] Chemiluminescence detection and gel image analysis: Use ELC luminescent solution for treatment, then place the PVDF membrane into a chemiluminescent imager for chemiluminescent exposure and imaging, and finally use ImageJ software to analyze the gray value of protein bands.

[0054] 8. Plasmid construction and miRNA and siRNA design and synthesis Primers were designed according to the CDS region of the goat PGAM1 gene provided on NCBI, with homologous arms and restriction enzyme sites added to the upstream and downstream respectively. Using reverse transcribed cDNA as a template, amplification was carried out by PCR. The product was subjected to gel extraction. The extracted product and the linearized lentiviral vector (pCDH) were subjected to homologous recombination by the homologous recombination method. The ligation product was transformed by DH5α and spread on an LB plate containing Amp. The next day, monoclonal colonies were picked for expansion, followed by colony PCR, and then sent to Sangon Biotech Co., Ltd. for sequencing. After the sequencing was correct, expansion and shaking of bacteria were carried out to extract plasmids. Approximately 200 bp of the sequence before and after the PGAM1 3'UTR (wild-type fragment and mutant fragment) was cloned into the pmirGLO-Report vector by the homologous recombination method to construct the pmirGLO-PGAM1-WT and pmirGLO-PGAM1-MUT vectors. siRNA-PGAM1, miR-151-5p mimics, inhibitors, agomir-miR-151-5p, and antagomir-miR-151-5p and their corresponding negative controls were all designed and synthesized by Shanghai GenePharma Co., Ltd.

[0055] 9. Dual-Luciferase Assay HEK293T cells were cultured using DMEM and 10% FBS for verifying miRNA targets. The cells were seeded in 24-well plates and co-transfected with 200 ng of pmirGLO- PGAM1 -WT and pmirGLO- PGAM1 -MUT as well as 100 μM of miR-151-5p mimics or mimics NC using Lipofectamine 3000. After 48 h of transfection, the cells were harvested, and the dual-luciferase fluorescence activity was detected using the DualLuciferase Reporter Assay Kit from Nanjing Novoprotein Science & Technology Co., Ltd. Prediction of the binding site was performed using the online software RNAhybrid.

[0056] 10. Transcriptome Sequencing and Analysis The miR-151-5p mimics and mimics NC were transfected into goat ovarian granulosa cells respectively. After 48 h, the cells were harvested to extract RNA. The total amount and integrity of RNA were detected by Agilent 2100 Bioanalyzer. The samples that met the sequencing requirements were sent to Personalbio and subjected to paired-end sequencing using the Illumina sequencing platform. The samples were sequenced on the machine to obtain image files and generate the original FASTQ data. Then, the Reads with an average quality score lower than Q20 were removed. The filtered Reads were aligned to the goat reference genome (Genome: Capra_hircus.ARS1.dna.toplevel.fa) using HISAT2 software. The expression levels of transcripts in each sample were counted, and the mRNA was normalized to FPKM. The Deseq2 was used for differential expression analysis of genes, and the screening conditions were |log2FoldChange| > 1 for the fold change in expression and P-value < 0.05 for significance. The top GO was used for gene ontology enrichment analysis, and the significantly enriched GO terms were determined by the hypergeometric distribution method (the standard for significant enrichment was P < 0.05). The KEGG pathway enrichment analysis was performed using the Cluster Profiler software (the standard for significant enrichment was P < 0.05). According to the results of GO and KEGG enrichment analysis and biological significance, target genes were selected for subsequent research.

[0057] Forward strand of mimics NC (SEQ ID No.49): 5' -UUGUACUACACAAAAGUACUG-3'; Reverse strand of mimics NC (SEQ ID No.50): 5' -GUACUUUUGUGUAGUACAAUU-3'.

[0058] 11. Animal experiments Six 7-week-old SPF C57BL / 6J mice weighing 22 ± 2 g were selected. After one week of adaptive feeding of the experimental animals, they were randomly divided into four groups. After the mice were anesthetized with avertin, the skin and muscle on the back of the mice were incised, and the bilateral ovaries were carefully pulled out. Intracapsular injection of the ovaries was performed under a microscope. The negative control was injected into the left ovary of the mice, and agomir-miR-151-5p (the sequence was the same as SEQ ID No.2 and SEQ ID No.3) or antagomir-miR-151-5p (the sequence was the same as SEQ ID No.4) was injected into the right ovary of the mice. 2 μL of agomir-miR-151-5p or antagomir-miR-151-5p with a concentration of 80×10 -12M (160 pmol). After injection, the mice in each treatment group were housed individually in cages. On the ninth day after injection, the ovaries of the mice were collected aseptically and fixed in 4% paraformaldehyde, and then the mouse ovaries were sent to Wuhan Sevier Biotechnology Co., Ltd. for HE staining.

[0059] 12. Statistical analysis The data analysis of this experiment used GraphPad Prism 8.0.2. The t-test was used for two-group comparisons, and one-way analysis of variance (ANOVA) was used for multi-group comparisons. All data were in the form of mean ± standard deviation (mean ± SD). P < 0.05 (*) and P < 0.01 (**) were considered statistically significant, while P > 0.05 (ns) was not statistically significant.

[0060] Example 1 Verification of miR-151-5p expression in goat large and small follicles and verification of overexpression and interference efficiency The transcriptome sequencing data of large and small follicles showed that miR-151-5p was differentially expressed in large and small follicles. RT-qPCR was used to verify the relative expression levels of miR-151-5p in large and small follicles. The results were as Figure 1 shown. miR-151-5p was significantly upregulated in large follicles (P < 0.01) ( Figure 1 in A), which was consistent with the sequencing results pattern, indicating that it may play a role in follicle development. After transfecting miR-151-5p into granulosa cells, the relative expression level of miR-151-5p was detected. The results showed that compared with the mimicNC transfection group, the expression level of miR-151-5p in the miR-151-5p mimics transfection group was significantly upregulated (P < 0.01) ( Figure 1 in B), and compared with the inhibitor NC transfection group, the expression level of miR-151-5p in the miR-151-5p inhibitor transfection group was significantly downregulated (P < 0.01) ( Figure 1 in C), indicating that both miR-151-5p mimics and miR-151-5p inhibitor achieved the expected effects and subsequent experiments could be carried out.

[0061] Example 2 Effect of miR-151-5p on the proliferation of goat ovarian granulosa cells 2.1 Detection of the effect of miR-151-5p on the proliferation viability of goat ovarian granulosa cells by CCK-8 miR-151-5p mimics and inhibitors were transfected into goat ovarian granulosa cells, and CCK-8 assays were performed at three time points: 24 h, 48 h, and 72 h after transfection. The results were as Figure 2As shown, there was no significant difference in cell proliferation viability between the miR-151-5p overexpression group and the control group at 24 h (P > 0.05), and the difference in cell proliferation viability between the miR-151-5p overexpression group and the control group was significantly reduced at 48 h and 72 h (P < 0.01) ( Figure 2 in A), there was no significant difference in cell proliferation viability between the miR-151-5p interference group and the control group at 24 h (P > 0.05), and the difference in cell proliferation viability between the miR-151-5p interference group and the control group was significantly reduced at 48 h and 72 h (P < 0.01) ( Figure 2 in B). The results indicate that miR-151-5p can inhibit cell proliferation.

[0062] 2.2 Effect of miR-151-5p on the proliferation viability of goat ovarian granulosa cells detected by EdU miR-151-5p mimics and inhibitor were transfected into goat ovarian granulosa cells, and the cell proliferation ratio was calculated at 48 h after transfection. The results are as Figure 3 shown. Compared with the mimics NC transfection group, the cell proliferation ratio in the miR-151-5p mimics group was significantly reduced (P < 0.01). Compared with the inhibitor NC transfection group, the cell proliferation ratio in the miR-151-5p inhibitor group was significantly increased (P < 0.01), which was consistent with the CCK-8 results, indicating that miR-151-5p can inhibit cell proliferation.

[0063] Example 3 Effect of miR-151-5p on the cell cycle of goat ovarian granulosa cells After miR-151-5p mimics and inhibitor were transfected into goat ovarian granulosa cells, cells were harvested after 48 h and detected by flow cytometry. The results are as Figure 4 shown. After overexpressing miR-151-5p, the proportion of G1-phase cells increased significantly (P < 0.01), the proportion of S-phase cells decreased significantly (P < 0.01), and the proportion of G2-phase cells showed no significant change (P > 0.05) ( Figure 4 in A). After inhibiting miR-151-5p, the proportion of G1-phase cells decreased significantly (P < 0.01), the proportion of S-phase cells increased significantly (P < 0.01), and the proportion of G2-phase cells showed no significant change (P > 0.05) ( Figure 4 in B). The results indicate that miR-151-5p can prevent the progression of cells from the G1 phase to the S phase.

[0064] Example 4 Effect of miR-151-5p on proliferation-related genes of goat ovarian granulosa cells After transfection of miR-151-5p mimics in goat ovarian granulosa cells, compared with the mimics NC group, the mRNA expression levels of PCNA , CDK4 and CCND1 were significantly decreased (P < 0.01), the mRNA expression level of P53 was significantly increased (P < 0.01), while there was no significant difference for CDK6 (P > 0.05) ( Figure 5 A).

[0065] After transfection of miR-151-5p inhibitor in goat ovarian granulosa cells, compared with the inhibitor NC group, the mRNA expression levels of PCNA , CDK6 and CCND1 were significantly increased (P < 0.05), the expression level of P53 was significantly decreased (P < 0.05), while there was no significant difference for CDK4 (P > 0.05) ( Figure 5 B), indicating that miR-151-5p can inhibit cell proliferation.

[0066] The changes in the levels of cell proliferation-related proteins were detected by Western Blot after transfection of miR-151-5p mimics and inhibitor in goat ovarian granulosa cells. The results are shown in Figure 6 . Compared with the mimics NC group, the protein expression levels of CCND1, CDK6, RB and p-RB related to proliferation and cell cycle in the miR-151-5p mimics group were significantly decreased (P < 0.01), while there was no significant difference for the PCNA protein expression level (P > 0.05) ( Figure 6 A - B). Compared with the inhibitor NC group, the protein expression levels of PCNA and RB related to cell proliferation genes in the miR-151-5p mimics group were significantly increased (P < 0.05), while there was no significant difference for the p-RB and CCND1 protein expression levels (P > 0.05) ( Figure 6 C - D), indicating that miR-151-5p can inhibit the expression of key proteins during the proliferation of ovarian granulosa cells.

[0067] Example 5 Effects of miRNA-151-5p on steroid hormone secretion of goat ovarian granulosa cells The results of ELISA detection of goat ovarian granulosa cells transfected with miR-151-5p mimics and inhibitor are shown in Figure 7As shown, after overexpressing miR-151-5p, the secretion levels of estrogen (E2) and progesterone (P4) both increased significantly (P < 0.01). After interfering with miR-151-5p, the secretion levels of E2 and P4 decreased significantly again (P < 0.05), indicating that miR-151-5p can promote the secretion of steroid hormones by goat ovarian granulosa cells.

[0068] By RT-qPCR detection, after transfecting miR-151-5p mimics into goat ovarian granulosa cells, compared with the mimics NC transfection group. In the mimics group, the STAR 、 CYP11A1 and HSD3B1 gene expression levels related to steroid hormone secretion all increased significantly (P < 0.01) ( Figure 8 in A), and after interfering with miR-151-5p STAR 、 CYP11A1 and HSD3B1 (P < 0.05) gene expression levels decreased significantly again ( Figure 8 in B). This shows that miR-151-5p can promote the secretion of steroid hormones by goat ovarian granulosa cells.

[0069] By Western Blot detection, the changes in the levels of proteins related to steroid hormone secretion in goat ovarian granulosa cells after transfecting miR-151-5p mimics and inhibitor were detected. Compared with the mimics NC transfection group, the expression levels of the key proteins CYP11A1 and CYP19A1 related to steroid hormone secretion in the mimics group increased significantly (P < 0.05) ( Figure 9 in A - B). Compared with the inhibitor NC transfection group, the protein expression level of CYP11A1 in the inhibitor group decreased significantly (P < 0.05) ( Figure 9 in C - D). This shows that miR-151-5p can promote the expression of key proteins related to steroid hormone secretion in ovarian granulosa cells.

[0070] Example 6 Transcriptome Sequencing to Analyze the Regulatory Effect of miR-151-5p on Gene Expression in Goat Ovarian Granulosa Cells 6.1 Quality Detection of RNA-Seq Sequencing Data In goat ovarian granulosa cells, miR-151-5p and mimics NC were transfected, and RNA was harvested after 48 h for transcriptome sequencing. Before further analysis, 8 independent cDNA libraries were constructed from the RNA of goat ovarian granulosa cells in the miR-151-5p overexpression group (mimics) and the control group (NC). The overview of the sequencing data is shown in Table 1. A total of 410,409,100 raw sequence reads were generated in the 8 sequencing libraries, and 404,023,542 high-quality reads passed quality control and were available for subsequent analysis. The proportion of bases with a base recognition accuracy of more than 99.9% in each sample accounted for 96.16 - 96.71% of the total. The high-quality reads were aligned with the reference genome, and the alignment rate was above 98.56%. Among them, 3.92 - 4.61% of the high-quality reads were aligned to multiple positions, and 95.39 - 96.08% of the high-quality reads were aligned to a unique position. The above data indicate that the sequencing results are of high quality and fully meet the requirements of subsequent analysis.

[0071] Table 1 Overview of RNA sequencing of goat ovarian granulosa cells

[0072] Note: mimics represents the group overexpressing miR-151-5p, and NC represents the control group; Q30 represents the proportion of bases with a base recognition accuracy of more than 99.9%.

[0073] 6.2 Differential gene expression analysis The research used Deseq2 to perform differential analysis of gene expression. According to |log2 Fold Change| > 1 and P value < 0.05 as the screening criteria, differentially expressed genes (DEGs) between the mimics group and the NC group were screened, with the NC group as the control group. A total of 16,848 mRNAs were identified in the mimics group and the NC group, among which 1,350 were differentially expressed mRNAs, including 907 up-regulated and 443 down-regulated ones ( Figure 10 in A). The top five down-regulated genes were SET , SAE1 , RRM2 , PGAM1 and MCM7. The clustering analysis results showed that the gene expression levels and patterns of the 4 samples in the mimics group were similar, and the expression levels and patterns of the 4 samples in the NC group were similar ( Figure 10 in B).

[0074] 6.3 Functional enrichment analysis of differentially expressed genes GO and KEGG functional enrichment analyses were performed on the differentially expressed genes. GO functional enrichment analysis found that the differentially expressed genes were enriched in 9,078 GO terms. The results are as Figure 11As shown in A, 1,685 GO terms were significantly enriched (P < 0.05), including 1,374 in Biological Process (BP), 101 in Cellular Component (CC), and 210 in Molecular Function (MF). The top four biological processes with the most enriched genes were cellular process, biological regulation, regulation of biological process, and metabolic process. The top two cellular components with the most enriched genes were cellular anatomical entity and protein-containing complex. The top four molecular functions with the most enriched genes were adhesion, catalytic activity, molecular function regulator, and transport activity.

[0075] KEGG enrichment analysis was performed on the differentially expressed genes, and the results are as Figure 11 shown in B. A total of 311 pathways were enriched for the differentially expressed genes, among which 58 significantly enriched KEGG signaling pathways (P < 0.05), including cell cycle, p53 signaling pathway, steroid biosynthesis, MAPK signaling pathway, PI3K-AKT signaling pathway, etc.

[0076] 6.4 Real-time fluorescence quantitative PCR verification To verify the RNA-seq results, RT-qPCR verification analysis was performed on 8 differentially expressed mRNAs. The results are as Figure 12 shown, and the expression level trends of the two are consistent, indicating that the sequencing results are reliable.

[0077] Example 7 Prediction and verification of miR-151-5p target genes Using the RNAhybrid online software to predict the transcriptome data of goat ovarian granulosa cells after overexpressing miR-151-5p, among the top five down-regulated genes, PGAM1 the 3' UTR region has a target binding site with miR-151-5p, and the binding free energy is -23.9 kcal / mol. The present invention constructed dual-luciferase reporter vectors containing wild-type and mutant miR-151-5p response elements, and then co-transfected the wild-type and mutant dual-luciferase reporter vectors containing miR-151-5p response elements with miR-151-5p into 293T cells. The results are as Figure 13 shown. The fluorescence activity of the group containing the wild-type miR-151-5p response element decreased significantly (P < 0.01), while the fluorescence activity of the group with the mutant miR-151-5p response element was not affected (P > 0.05). It indicates that PGAM1 there is a binding site between the 3' UTR region of PGAM1 and miR-151-5p, indicating that

[0078] After overexpressing and interfering with miR-151-5p in goat ovarian granulosa cells, detect by RT-qPCR PGAM1 the expression at the mRNA level. After overexpressing miR-151-5p, PGAM1 the expression of the mRNA level was significantly down-regulated (P < 0.01) ( Figure 14 in A), and after interfering with miR-151-5p PGAM1 the expression of the mRNA level was significantly up-regulated (P < 0.01) ( Figure 14 in B). Combining with the dual-luciferase assay, the results showed that there was a targeting relationship between miR-151-5p and PGAM1.

[0079] Example 8 PGAM1 Verification of siRNA interference efficiency Quantitatively detect the expression level in goat ovarian granulosa cells transfected with interfering RNA by RT-qPCR PGAM1 . The results are as Figure 15 shown. siRNA-1, siRNA-2 and siRNA-3 could all significantly reduce the PGAM1 expression level, and there were extremely significant differences in this effect (P < 0.01). To sum up, the 3 designed siRNAs all achieved the expected interference efficiency. Among them, the interference effect of siRNA-2 was the most obvious. Therefore, siRNA-2 was selected for the subsequent PGAM1 interference experiment.

[0080] Example 9 PGAM1 Effect on the proliferation of goat ovarian granulosa cells 9.1 CCK-8 detection PGAM1 Effect on the proliferation viability of goat ovarian granulosa cells After overexpressing and interfering with PGAM1 in goat ovarian granulosa cells, detect CCK-8 at 24 h, 48 h and 72 h. The results are as Figure 16 shown. Compared with the control group, there were no significant differences in the cell proliferation viability at 24 h after overexpressing and interfering with PGAM1 (P > 0.05). The cell proliferation viability was significantly increased at 48 h and 72 h after overexpressing PGAM1 compared with the control group (P < 0.01). The cell proliferation viability was significantly decreased at 48 h and 72 h after interfering with PGAM1 compared with the control group (P < 0.01), indicating that PGAM1 could promote cell proliferation.

[0081] 9.2 EdU detection PGAM1 Effect on the proliferation viability of goat ovarian granulosa cells Use EdU to detect after overexpressing and interfering with in goat ovarian granulosa cellsPGAM1 The cell proliferation ratio after 48 h. The results are as Figure 17 shown. Compared with the lentiviral plasmid transfection group and the si-NC transfection group, the cell proliferation of the PGAM1 interference group was significantly decreased (P < 0.01). This result was consistent with that of the CCK-8 assay, indicating that PGAM1 it could promote cell proliferation.

[0082] Example 10 PGAM1 Effect on the cell cycle of goat ovarian granulosa cells After overexpression and interference in goat ovarian granulosa cells, PGAM1 the cells were harvested after 48 h and the cell cycle was detected by flow cytometry. The results are as Figure 18 shown. Compared with the si-NC transfection group, after interference with PGAM1 , the proportion of G1-phase cells was significantly increased (P < 0.01), the proportion of S-phase cells was significantly decreased (P < 0.01), and the proportion of G2-phase cells showed no significant change (P > 0.05). The results indicated that interference with PGAM1 could inhibit the cell cycle progression from G1 phase to S phase in ovarian granulosa cells.

[0083] Example 11 PGAM1 Effect on genes related to the proliferation of goat ovarian granulosa cells After transfection with si-PGAM1 in goat ovarian granulosa cells, the expression levels were detected by RT-qPCR. The results are as PGAM1 shown. Compared with the si-NC transfection group, after interference with Figure 19 , the mRNA expression levels of PGAM1 , PCNA , CCND1 , CDK4 and CDK6 were significantly decreased (P < 0.01), and the expression level of P53 was significantly increased (P < 0.01). It was indicated that interference with PGAM1 could inhibit the expression of key genes for cell proliferation.

[0084] After transfection with si-PGAM1 in goat ovarian granulosa cells, compared with the si-NC transfection group, the protein expression levels of RB, PCNA and CCND1 were extremely significantly decreased (P < 0.01), and the protein expression level of CDK6 was significantly decreased (P < 0.05). After interference with PGAM1 , the protein expression level of PGAM1 was significantly decreased (P < 0.05). After interference with PGAM1 , the protein expression levels related to cell proliferation were significantly decreased ( Figure 20 A-B in). The results indicated that interference with PGAM1 could inhibit the expression of key proteins during cell proliferation.

[0085] Example 12PGAM1 Effect on steroid hormone secretion of goat ovarian granulosa cells 12.1 ELISA detection PGAM1 Effect on steroid hormone secretion of goat ovarian granulosa cells Estrogen and progesterone levels in the cell supernatant of transfected goat ovarian granulosa cells were detected by ELISA after interference PGAM1 . The results showed that after interference PGAM1 , the secretion levels of estrogen (E2) and progesterone (P4) were both significantly increased (P < 0.01) ( Figure 21 A-B in PGAM1 ), indicating that interference

[0086] 12.2 PGAM1 Effect on genes related to steroid hormone secretion of ovarian granulosa cells The gene expressions related to hormone secretion were detected by RT-qPCR after interference PGAM1 , and the results were as Figure 22 shown STAR , CYP11A1 and 3β-HSD gene expression levels were all significantly increased (P < 0.05).

[0087] By WB detection, after transfection of si-PGAM1 into goat ovarian granulosa cells, the protein expression levels of CYP11A1 and CYP19A1 were significantly up-regulated compared with the si-NC transfection group (P < 0.05) ( Figure 23 A-B in PGAM1 ). The results indicated that interference

[0088] Example 13 miR-151-5p regulates goat ovarian granulosa cells through the PI3K / AKT signaling pathway miR-151-5p mimics and inhibitor and their corresponding control groups were transfected into ovarian granulosa cells. After 48 h, proteins were collected, and then it was explored whether miR-151-5p exerted regulatory effects through PI3K / AKT. The results showed that there was no significant difference in the protein expression levels of PI3K and total AKT between the miR-151-5p mimics transfection group and the mimics NC transfection group (P > 0.05), and the protein expression level of p-AKT was significantly down-regulated (P < 0.01) ( Figure 24In (A-B) of the figure, after transfection with miR-151-5p inhibitor and comparison with the inhibitor NC group, there was no significant difference in the protein expression levels of PI3K and total AKT (P > 0.05), while the protein expression level of p-AKT was significantly up-regulated (P < 0.01). Figure 24 In (C-D) of the figure. These results indicate that miR-151-5p can regulate the function of granulosa cells by modulating the phosphorylation status of AKT.

[0089] Example 14 PGAM1 Regulating goat ovarian granulosa cells through the PI3K / AKT signaling pathway Transfect si-PGAM1 and si-NC into ovarian granulosa cells, collect proteins after 48 h, and then explore PGAM1 whether it exerts a regulatory effect through PI3K / AKT. The results showed that compared with the si-NC transfection group, the protein expression level of PI3K was significantly down-regulated (P < 0.01), there was no significant difference in the protein expression level of total AKT (P > 0.05), and the protein expression level of p-AKT was significantly down-regulated (P < 0.01) in the si-PGAM1 transfection group ( Figure 25 In (A-B) of the figure. The results indicate that PGAM1 it regulates the function of ovarian granulosa cells through the PI3K / AKT signaling pathway.

[0090] Example 15 Effects of miR-151-5p on mouse ovarian development Inject miR-151-5p antagonist, agonist and their corresponding controls into the mouse ovaries. Comparing the gene sequences of miR-151-5p in mice and goats, the results showed that the homology of miR-151-5p sequence between mice and goats was 100%. Make sections of the mouse ovaries after experimental treatment and perform HE staining to observe their morphology and count the follicles at each stage. Compared with the control group, inhibiting the expression of miR-151-5p significantly increased the number of follicles (P < 0.01), and the number of primary follicles, secondary follicles, antral follicles and total follicles all increased (P < 0.05) ( Figure 26 In (A-B) of the figure. After overexpressing miR-151-5p, the number of follicles was significantly reduced (P < 0.05), and the number of early antral follicles and total follicles was significantly reduced (P < 0.05) ( Figure 26 In (C-D) of the figure, showing abnormal ovarian development.

[0091] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of miR-151-5p in the preparation of a reagent for regulating the process of follicular development.

2. The application according to claim 1, wherein The regulation includes regulating at least one of the following: (1) regulating the proliferation of ovarian granulosa cells; (2) regulating the number of follicles; (3) regulating the cell cycle of ovarian granulosa cells; (4) regulating the secretion of steroid hormones by ovarian granulosa cells.

3. The application according to claim 2, wherein The regulation of the cell cycle of ovarian granulosa cells includes regulating the process of ovarian granulosa cells from the G1 phase to the S phase.

4. The application according to claim 2, wherein The regulation of the secretion of steroid hormones by ovarian granulosa cells includes: regulating the secretion of estrogen and / or progesterone, regulating the expression of genes related to steroid hormone secretion, and regulating the secretion of proteins related to steroid hormone secretion.

5. The application according to claim 1, characterized in that The target genes of the miR-151-5p include PGAM1 .

6. Use of a reagent for promoting the expression of miR-151-5p in the preparation of any one of the following products: a product for inhibiting the proliferation of ovarian granulosa cells, a product for reducing the number of follicles, a product for arresting the cell cycle of ovarian granulosa cells, and a product for promoting the secretion of steroid hormones by ovarian granulosa cells.

7. The application according to claim 6, characterized in that, The reagent for promoting the expression of miR-151-5p includes at least one of the following: an agonist of the miR-151-5p, a mimic of the miR-151-5p, an overexpression vector containing the base sequence of the miR-151-5p, an overexpression vector containing the base sequence of the mimic of the miR-151-5p, a composition containing the miR-151-5p, a composition containing the agonist of the miR-151-5p, and a composition containing the mimic of the miR-151-5p.

8. Use of a reagent for inhibiting the expression of miR-151-5p in the preparation of any one of the following products: a product for promoting the proliferation of ovarian granulosa cells, a product for increasing the number of follicles, and a product for inhibiting the secretion of steroid hormones by ovarian granulosa cells.

9. The application according to claim 8, characterized in that The reagent for inhibiting the expression of miR-151-5p includes at least one of the following: an inhibitor of the miR-151-5p and an antagonist of the miR-151-5p.

10. A reagent for promoting follicular development, characterized in that, A reagent that inhibits the expression of miR-151-5p and / or a reagent that promotes PGAM1 expression.

Images