Typical neonicotinoid insecticide dinotefuran and nitenpyram aptamers
The aptamers that specifically identify ninicotine and nitridinyl are screened through graphene oxide-SELEX technology, which solves the problem of single and low sensitivity of neonicotinoid insecticide detection methods, and achieves efficient and low-cost rapid detection.
Patent Information
- Application Number
- CN202510462287.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-07-04
AI Technical Summary
The existing neonicotinoid pesticide detection methods are single and have low sensitivity, which cannot meet the current testing needs. Moreover, the water-soluble and enetinide are high and difficult to degrade, resulting in environmental pollution and health risks.
Graphene oxide (GO)-SELEX technology was used to screen for aptamer and enedimethylamide. Through screening, the aptamer aptamer sequences were obtained as CGCAAGTGTTGGCCGC-AGGTCGACGCATGCGCCG and the aptamer aptamer sequences were TAGGGAATTCGTCGACGGATCCGCTGGTGTACGACGTCCCTA, and a rapid detection method was constructed.
It realizes efficient and specific identification of nitrofurosine and nitrosine, improves detection sensitivity and diversity, and reduces detection costs.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to aptamers of two neonicotinoid insecticides, dinotefuran and nitenpyram, and belongs to the field of molecular biology. Technical Background
[0002] Neonicotinoid insecticides are a major discovery in the field of agrochemistry in recent decades and play an important role in pest control and crop protection. Due to their unique mechanism of action (binding to nicotinic acetylcholine receptors in pests), which is completely different from that of traditional insecticides, neonicotinoid insecticides have been used as substitutes for highly toxic pesticides such as organochlorines, organophosphates, and pyrethroids.
[0003] With the increasing use of neonicotinoid insecticides and the in-depth study of their toxicology, the harm of such insecticides to the ecosystem has gradually emerged. Colony Collapse Disorder is a typical example. More and more evidence shows that the number of global pollinators is decreasing, which has raised concerns about biodiversity conservation. Neonicotinoid insecticides have been identified or suspected as the key factor leading to this decrease. Scientific research shows that neonicotinoid insecticides may have a significant negative impact on the brain development of mammals, including humans, by interfering with the normal function of the central nervous system, triggering a series of neurological diseases, including Parkinson's disease, Alzheimer's disease, depression, and schizophrenia.
[0004] So far, a variety of neonicotinoid insecticides with different functions have been developed. Among them, dinotefuran and nitenpyram are two representative neonicotinoid insecticides. Compared with traditional neonicotinoid insecticides such as acetamiprid and imidacloprid, dinotefuran and nitenpyram have higher insecticidal efficiency. However, it is undeniable that the overuse of dinotefuran and nitenpyram is still a concern. First of all, the water solubility of dinotefuran and nitenpyram is several orders of magnitude higher than that of traditional neonicotinoid insecticides, and they are not easily degraded quickly. Under the conditions of 298 K and a pH value of 7.0, the hydrolysis half-life of dinotefuran and nitenpyram even exceeds one year.
[0005] In recent years, attempts have been made to utilize the unique chemical properties of dinotefuran and nitenpyram to construct detection methods for them. For example, the nitro and imino groups in dinotefuran are electron-withdrawing groups. Dinotefuran will be protonated in an acidic medium, thus carrying a positive charge. Therefore, dinotefuran can induce the aggregation of most metal nanocluster fluorescent molecules, and then construct a fluorescence sensor based on the quenching principle. In addition, polarographic analysis shows that for most neonicotinoid insecticides containing nitro groups, measurable electrochemical signals can be directly generated based on the irreversible reduction of electroactive nitro groups to the corresponding hydroxylamines or amines. However, the development of such sensors is restricted by the inherent characteristics of neonicotinoid insecticides, resulting in a single detection mode and low sensitivity, which cannot meet the current detection requirements.
[0006] Aptamers are single-stranded DNA / RNA that can recognize targets through hydrogen bonding, π-π stacking, van der Waals forces, electrostatic interactions, hydrophobic interactions, etc. In recent years, globally, the types of aptamers that can recognize proteins, small molecules, pathogens, and ions have increased rapidly. This not only expands the range of detectable targets, but also the aptamers have characteristics such as being easy to modify, having programmable structures, being stable in nature, and having low synthesis costs, which also provides the possibility for the development of new sensors. Therefore, screening aptamers that can specifically recognize dinotefuran and nitenpyram can promote the innovative transformation of the detection mode from traditional to new. Summary of the Invention
[0007] To solve the problem that the detection methods of some neonicotinoid insecticides are limited due to the lack of recognition elements, taking dinotefuran and nitenpyram as screening targets, this invention uses graphene oxide (GO)-SELEX to screen aptamers of typical neonicotinoid insecticides, in order to obtain two aptamers that specifically recognize dinotefuran and nitenpyram respectively, and provide selectable biorecognition elements for the construction of rapid detection methods for dinotefuran and nitenpyram.
[0008] To achieve the above object, the technical solutions adopted in this invention include the following steps.
[0009] (1) Obtain dinotefuran aptamer and nitenpyram aptamer through screening. The dinotefuran aptamer sequence is CGCAAGTGTTGGCCGC-AGGTCGACGCATGCGCCG, and the nitenpyram aptamer sequence is TAGGGAATTCGTCGACGGATCCGCTGGTGTACGACGTCCCTA.
[0010] (2) Aptamer sequence analysis.
[0011] (3) Analysis of the interaction between the aptamer and the target.
[0012] Preferably, the random library used in step (1) for aptamer screening is a 79-nt single-stranded oligonucleotide synthesized by a biological company, including upstream and downstream primers and 35 random oligonucleotides in the middle.
[0013] Preferably, in step (1) for positive selection of aptamers, dinotefuran and nitenpyram are used as targets respectively. After the initial library is heat-denatured, it is mixed and incubated with the targets, graphene oxide is added, and then centrifuged for separation and purification, followed by PCR amplification, verification by gel electrophoresis, and preparation of single-stranded DNA. Then comes the next round of screening. As the screening progresses, ssDNAs with high affinity for the targets are continuously enriched.
[0014] Preferably, in step (1) for negative selection of aptamers, thiamethoxam (THX), clothianidin (CLO), imidacloprid (IMI), acetamiprid (ACE), and dinotefuran derivatives (UF) are used as negative selection targets. First, they are mixed and incubated with the ssDNA library, and graphene oxide is added to adsorb the single-stranded oligonucleotides that have not bound to the negative selection targets. After centrifugation for separation, the positive selection targets are then added to desorb the single-stranded oligonucleotides from the surface of graphene oxide, so as to improve the specificity of the selected aptamers.
[0015] Preferably, in the first round of step (1) screening, 1 μL of the initial library (100 μM) is added. After incubation with the targets, a graphene oxide solution (2 mg / mL) with a mass 300 times that of the oligonucleotides is added to adsorb the ssDNA sequences that have not bound to the targets. After mixing for 2 h, the graphene oxide is removed by centrifugation.
[0016] Preferably, the position of the bands of the PCR amplification products in step (1) is judged by 3% gel electrophoresis.
[0017] Preferably, for the preparation of single-stranded nucleotides in step (1), streptavidin-modified magnetic beads are mixed and incubated with the PCR products, and the DNA double strands are dissociated by NaOH solution. Since the downstream primer of the PCR is labeled with biotin, the antisense strand remains on the magnetic beads, and the eluate is collected as the secondary library for the next round.
[0018] Preferably, in step (2), the secondary structure of the aptamers is analyzed by DNAMAN software. Considering factors such as the homology of the primary structure, the similarity of the secondary structure, and the free energy, candidate sequences are obtained. The fluorescence changes at different ssDNA concentrations are tested by fluorescence analysis, and nonlinear fitting is performed with software to determine the dissociation constant of the screened sequences.
[0019] Preferably, in step (2) to obtain aptamers with high affinity, the aptamer sequences are trimmed and optimized based on the secondary structure analysis, removing the stems or loops in the secondary structure to obtain truncated aptamer sequences with higher affinity.
[0020] Preferably, in step (3), molecular docking simulation is used to study the interaction between the aptamer and the target, analyze the possible intermolecular forces during their binding, and determine whether the aptamer can form a binding pocket with the target. Description of the Drawings
[0021] Figure 1 Schematic diagram of aptamer screening, where GO is graphene oxide, DNF is dinotefuran, and NIT is nitenpyram.
[0022] Figure 2 Recovery rate during aptamer screening process.
[0023] Figure 3 Analysis of the affinity of dinotefuran aptamer.
[0024] Figure 4 Analysis of the affinity of nitenpyram aptamer.
[0025] Figure 5 Molecular docking results of aptamer sequences.
[0026] Figure 6 Aptamer shearing optimization process.
[0027] Figure 7 Analysis of the affinity of the truncated aptamer. Detailed Description of the Invention
[0028] The present invention will be further described in detail below with reference to the drawings and embodiments, but the embodiments do not limit the present invention in any form.
[0029] Example 1: Steps for screening aptamers of dinotefuran and nitenpyram.
[0030] The aptamer screening process of graphene oxide - systematic evolution of ligands by exponential enrichment (GO - SELEX) is as Figure 1 shown, including two steps: forward screening and reverse screening. First, a random single - stranded DNA library containing 79 nucleotides is constructed. 10 µL of the initial ssDNA library with a concentration of 100 µM is dissolved in 190 µL of binding buffer (BB), heat - denatured at 95°C for 10 minutes, ice - bathed in cold water at 4°C for 10 minutes, and then equilibrated at room temperature for 10 minutes. The ssDNA in the initial library denatures and folds to form a complex three - dimensional spatial structure to increase the binding affinity between the ssDNA and the target. It should be noted that before each subsequent round of screening, the screening library needs to be denatured.
[0031] 5 µL of the target with a concentration of 100 µM is added to the solution, and the solution is shaken and incubated for 1 hour to allow the target to fully bind to the potential aptamers. To increase the screening pressure, as the number of screening rounds increases, the concentration of the added target will gradually decrease.
[0032] After incubating the screening library with the target, graphene oxide (GO) solution (concentration 2 mg / mL) with a mass 300 times that of the ssDNA was added to the solution, and it was gently shaken for 2 hours. Unbound ssDNA would be adsorbed by the graphene oxide, and then the graphene oxide adsorbed with non-specific ssDNA was separated by centrifugation.
[0033] Purify the supernatant. Perform polymerase chain reaction (PCR) amplification to prepare double-stranded DNA, increase the number of nucleic acids in the system that have the ability to bind to the target, and analyze the results of the agarose gel electrophoresis experiment through a gel imaging system to determine whether the PCR products are normal.
[0034] Prepare ssDNA using streptavidin-modified magnetic beads. Add 20 µL of the PCR product and 80 µL of binding and washing (B&W) buffer to the washed magnetic beads, mix well and shake for 1.5 hours. After the biotin-labeled dsDNA binds fully to the magnetic beads, the magnetic beads are washed four times using the principle of magnetic separation to remove unbound dsDNA. Then add 50 µL of 0.1 M sodium hydroxide solution and elute at 37 °C for 30 minutes. Take the supernatant after magnetic separation and save it as the library pool for the next round of screening.
[0035] To improve the specificity of the aptamer for the target, non-targets with a structure similar to the target were introduced for counter-selection. During the counter-selection process, first the denatured library was incubated with the non-target, and then separation was carried out by adding graphene oxide solution. Then, the target was added to induce the competitive desorption of high-affinity aptamers from the surface of the graphene oxide. The remaining steps were the same as those in the forward selection.
[0036] In the whole screening process, the recovery rate of each round was calculated by G t / G0×100%, where G0 is the amount of nucleic acid input into the screening system at the start of each round of screening, and G t is the amount of nucleic acid obtained after ssDNA purification. The measurement of the recovery rate was mainly used to monitor the progress of GO-SELEX, and the screening was stopped when the numerical change of the recovery rate tended to be stable.
[0037] As Figure 2 shown, as the screening process proceeded, the recovery rate continuously increased, indicating that the number of ssDNA in the input library that binds to the target was continuously increasing. During the counter-selection process, the ssDNA sequences that bind to the counter-selection target were removed, corresponding to a decrease in the recovery rate. After 12 rounds and 14 rounds of aptamer screening for dinotefuran and nitenpyram respectively, the recovery rate tended to be stable, indicating that the aptamers with affinity for the target had been fully enriched and the screening process was completed.
[0038] Example 2: Sequence analysis of dinotefuran and nitenpyram aptamers.
[0039] After the screening was completed, the ssDNA-rich library was sent to a biological company for sequencing. The DNAMAN 8 software was used to perform sequence homology alignment on the sequencing results. And these sequences were divided into several major families according to homology. The "UNAFold" website (http: / / www.unafold.org / ) was used to predict the secondary structure and Gibbs free energy (ΔG) of the sequences. Based on sequence homology, structural similarity, stability, and enrichment level, representative sequences were selected as candidate sequences for affinity analysis.
[0040] The high-throughput sequencing results showed that a total of 20 different ssDNA sequences that could specifically recognize dinotefuran and 23 different ssDNA sequences that could specifically recognize nitenpyram were obtained. Using a homology threshold of greater than 94% as the standard, the 20 ssDNA sequences screened for dinotefuran aptamers were divided into 4 families, while the 23 ssDNA sequences screened for nitenpyram aptamers were divided into 6 families. A comprehensive analysis was performed on the occurrence frequency of each ssDNA in each family and the entropy value that determines its structural stability. 4 ssDNA sequences were selected as candidate sequences for dinotefuran aptamers, and 6 ssDNA sequences were selected as candidate sequences for nitenpyram aptamers.
[0041] Example 3: Interaction and affinity analysis between aptamers and targets.
[0042] The affinity of the aptamer was evaluated by fluorescence spectroscopy. For each determination, 360 µL of aptamer solution (with different concentrations) was aliquoted into 2 mL centrifuge tubes. 40 µL of target solution with a concentration of 100 µM was added to the experimental group, while 40 µL of ultrapure water was added to the control group, and the final aptamer concentration range was 30 - 1000 nM. The mixture was vortexed at room temperature for 1 hour. After adding 100 µL of graphene oxide solution, the samples were incubated with shaking for 2 hours, and then centrifuged at 13,600 revolutions per minute for 12 minutes. The fluorescence intensity of the supernatant was measured using a fluorescence spectrophotometer.
[0043] As Figure 3 and Figure 4 shown, the saturation curve of the fluorescence intensity change value (ΔF) versus different concentrations of ssDNA was plotted using Origin software, and the K d value was calculated by non-linear fitting. Among the candidate sequences of dinotefuran aptamers, the K dThe values were 46.99 nM, 49.16 nM, 74.29 nM, and 79.98 nM respectively. In contrast, only 5 out of the 6 candidate sequences of the nitenpyram aptamer showed affinity, with K d values of 36.31 nM, 75.43 nM, 158.75 nM, 118.97 nM, and 65.27 nM respectively. Since the K DNF values of APT1 NIT and APT1 d were the smallest, they were selected as the aptamer sequences for dinotefuran and nitenpyram.
[0044] To analyze the binding mechanism between the aptamer and the target, a three-dimensional recognition model was established using simulation software to explore the specific binding sites and recognition mechanisms. As Figure 5 shown, the molecular docking results indicated that dinotefuran could effectively bind to the active pocket of the aptamer, with a binding energy of -5.9 kcal mol -1 . The three-dimensional interaction analysis showed that dinotefuran formed hydrophobic interactions with DA50, DG51, DG74, and DT73 of the dinotefuran aptamer, and formed hydrogen bonds with DG51 and DT52 of the dinotefuran aptamer, with hydrogen bond distances of 3.23 Å and 3.14 Å respectively. Similarly, nitenpyram could efficiently bind to the active pocket of the nitenpyram aptamer, with a binding energy of -5.7 kcal mol -1 , and nitenpyram formed hydrophobic interactions with DG3, DG4, DG5, DA6, DA7, DC39, DC40, and DT41 of the nitenpyram aptamer, and also formed a hydrogen bond with DT9 of the nitenpyram aptamer, with a hydrogen bond distance of 3.21 Å.
[0045] All the aptamers obtained in the screening contained 79 nucleotides. Their sequences were too long and might contain some non-essential nucleotides that neither interacted with the target molecule nor stabilized the spatial structure of the aptamer, and might also cause steric hindrance, thus affecting the recognition function of the aptamer. Therefore, further truncation optimization of the aptamer was carried out to explore the key functional sequences for the binding of the aptamer to the target, and it was possible to obtain aptamers with higher affinity. The truncation schemes for the two aptamers are as Figure 6 shown.
[0046] The fluorescence detection was used to measure the affinity of 4 truncated sequences. As Figure 7 shown, after truncation, both APT1a DNF and APT1b DNF retained the affinity for dinotefuran. The affinity of APT1a DNF (K d = 48.03 nM) was the same as that of APT1 DNFIt is comparable to (Kd = 46.99 nM). Although the affinity is not significantly improved, the sequence length is reduced by 57%, greatly reducing the synthesis cost. However, compared with APT1 DNF APT1b DNF shows a significant decrease in the affinity for dinotefuran, and the K d value increases by five times, indicating that this truncation scheme overly shortens the sequence length and disrupts the key sites for binding to dinotefuran. On the other hand, APT1a NIT that retains the large stem-loop structure shows a significant increase in the affinity for nitenpyram, and the K d value decreases from 36.31 nM to 25.20 nM. In contrast, APT1b NIT that removes the large stem-loop structure does not show affinity for nitenpyram, and the binding site is completely disrupted. In summary, after the screening process, APT1a DNF and APT1a NIT are selected as the final dinotefuran aptamer and nitenpyram aptamer.
Claims
1. Specific aptamers of typical neonicotinoid insecticides dinotefuran and nitenpyram, characterized in that the dinotefuran aptamer sequence is CGCAAGTGTTGGCCGCAGGTCGACGCATGCGCCG, and the nitenpyram aptamer sequence is TAGGGAATTCGTCGACGGATCCGCTGGTGTACGACGTCCCTA.
2. The two aptamers according to claim 1, characterized in that molecular docking simulation shows that the dinotefuran aptamer and the nitenpyram aptamer specifically bind to dinotefuran and nitenpyram mainly through hydrogen bonds and hydrophobic interactions.