MRNA transcription vector as well as construction method and application thereof

By using 5'UTR and 3'UTR of mRNA fragments of chicken hemoglobin subunit β, the problem of insufficient expression of target genes in the prior art was solved, and efficient expression of mRNA vaccines was achieved.

CN120249294AActive Publication Date: 2025-07-04SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510404686.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-01
Publication Date
2025-07-04
Estimated Expiration
2045-04-01

AI Technical Summary

Technical Problem

In the prior art, human alpha globin is used in the 5'UTR and 3'UTR sequences of mRNA vaccines, which is difficult to further increase the expression of the target gene.

Method used

The mRNA transcription vector, including plasmids and template backbone, was constructed using 5'UTR and 3'UTR of the mRNA fragment of chicken hemoglobin subunit β, and optimized the expression effect of mRNA.

Benefits of technology

It significantly improves the protein expression ability of mRNA and improves the expression of vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249294A_ABST
    Figure CN120249294A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and discloses an mRNA transcription vector which comprises a plasmid and a template skeleton connected to the plasmid, 5 '-UTR of the template skeleton is 3'-UTR, the 5 '-UTR is taken from a fragment of mRNA of a chicken hemoglobin subunit beta, the sequence of the 5'-UTR is shown as SEQ ID NO: 1, and the 3 '-UTR is taken from a fragment of mRNA of the chicken hemoglobin subunit beta, and the sequence of the 3'-UTR is shown as SEQ ID NO: 2; according to the application, the expression quantity of a target gene is improved by using 5 '-UTR and 3'-UT R of a plurality of mRNA fragments taken from a chicken hemoglobin subunit beta, so that the expression quantity after subsequent vaccine use is improved, and in addition, the invention also discloses a construction method and application of the mRNA transcription vector.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an mRNA transcription vector, a construction method thereof, and an application thereof. Background Art

[0002] The field of mRNA vaccines is developing rapidly. At present, mRNA vaccines have achieved certain research results in infectious diseases such as influenza virus, Ebola virus, and SARS-CoV-2. The mechanism of action of mRNA vaccines is to directly deliver mRNA into cells, enabling the host to express the target protein in vivo through its own cells. The process is similar to the virus protein expression process, and can simultaneously activate the cellular immune and humoral immune systems of the body. Compared with traditional inactivated vaccines, mRNA vaccines can be developed and produced faster, and mRNA vaccines also show excellent safety. Since mRNA is a non-infectious and non-integrating platform, there is no potential risk of infection or insertional mutagenesis.

[0003] The preparation of RNA vaccines requires the prior construction of a template for an in vitro transcription (IVT) system. The expression effect of mRNA in cells is related to various factors. Among them, the regulatory sequences 5'UTR and 3'UTR on the mRNA sequence will affect the half-life and expression level of mRNA. Therefore, 5'UTR and 3'UTR are crucial for the expression effect of mRNA. At present, human α-globin or β-globin is mainly selected for 5'UTR and 3'UTR of mRNA.

[0004] Chinese Patent Application No. 202310793276.9 discloses a 5'-UTR for regulating high expression of mRNA and its application. This solution modifies the 5'-UTR sequence of the HBA1 gene encoding human α-globin, and two 5'-UTRs with excellent effects are screened.

[0005] This solution further provides an expression cassette, a recombinant vector, a cell, a recombinant bacterium, a construction method of the vector containing the 5'-UTR, and the uses of the "AGGAAATA" nucleic acid and the 5'-UTR, etc. The two 5'-UTRs provided by this solution have high in vitro transcription efficiency and strong versatility, and can be used for the efficient expression and preparation of target gene mRNA, and are suitable for large-scale industrial in vitro transcription of mRNA and mRNA production.

[0006] Further observing the description part of this solution, it can be seen that: "Select the first 34 nt sequence of the 5'-UTR of the human α-globin HBA1 gene as the basic backbone, add 'AGGAAATA' to its 5' end, combine with adding a Kozak sequence to the 3' end, or further insert 'AGTATT' nucleic acid after 'ACT' at the 5' end of the 34 nt sequence to modify the 5'-UTR sequence of the human α-globin HBA1 gene, and screen to obtain two 5'-UTRs with excellent effects, namely 5'-UTR sequence 2 (AGGAAATAACTCTTCTGGTCCCCACAG ACTCAGAGAGAACCCGCCACCATGG (SEQ ID NO.4)), and 5'-UTR sequence 3 (AGGAAATAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAAC CCGCCACCATGG (SEQ ID NO.5));". It can be seen that the 5'-UTR obtained by modifying the 5'-UTR sequence of human α-globin and through screening in this solution improves the expression level of the target gene, and thus an expression cassette capable of improving the expression level of the target gene is obtained.

[0007] The problem to be solved by this solution: How to provide an mRNA transcription vector different from the prior art and capable of improving the expression level of the target gene. Summary of the Invention

[0008] The object of the present application is to provide an mRNA transcription vector, which improves the expression level of the target gene by using the 5'-UTR and 3'-UTR of multiple fragments of mRNA taken from chicken hemoglobin subunit β, and thus improves the ability of the mRNA to express proteins during the preparation of vaccines.

[0009] To achieve the above object, the present application discloses an mRNA transcription vector, including a plasmid and a template backbone connected to the plasmid;

[0010] And the 5'-UTR of the template backbone is taken from a fragment of mRNA of chicken hemoglobin subunit β, and the sequence is as shown in SEQ ID NO: 1;

[0011] The 3'-UTR of the template backbone is taken from a fragment of mRNA of chicken hemoglobin subunit β, and the sequence is as shown in SEQ ID NO: 2

[0012] The insertion position of the externally provided foreign gene to be loaded is between the 5'-UTR and the 3'-UTR.

[0013] Preferably, the template backbone further includes a T7 promoter, a foreign gene to be loaded, and a PolyA tail;

[0014] The T7 promoter, 5'-UTR, 3'-UTR, and PolyA tail are connected in sequence.

[0015] Preferably, the sequence of the T7 promoter is as shown in SEQ ID NO: 3;

[0016] The sequence of the template backbone is as shown in SEQ ID NO: 4.

[0017] Preferably, the plasmid is at least one of pUC57, pUC19, pMD18-T, and pBR322.

[0018] Preferably, the foreign gene to be loaded is selected from any one of EGFP, HA, E2, and HN.

[0019] In addition, the present application also discloses a construction method for constructing the above mRNA transcription vector, including the following steps:

[0020] Step 1: Connect the T7 promoter, 5'-UTR, 3'-UTR, and PolyA tail in sequence to obtain a template backbone;

[0021] Step 2: Connect the template backbone to a plasmid to obtain an mRNA transcription vector.

[0022] In addition, the present application also discloses the use of the above-mentioned mRNA transcription vector for preparing an mRNA vaccine.

[0023] The beneficial effects of the present application are:

[0024] The present application provides an mRNA transcription vector. By using the 5'-UTR and 3'-UTR of multiple fragments of mRNA from chicken hemoglobin subunit β, the present application improves the expression level of the target gene, enhances the ability of mRNA to express proteins, and further increases the expression level after subsequent vaccine use. Brief Description of the Drawings

[0025] Figure 1 It is a schematic diagram of the overall structure of the template backbone;

[0026] Figure 2 It is a schematic diagram of the construction method and structure of pUC57-cmRNA;

[0027] Figure 3 It is a schematic diagram of the construction method and structure of pUC57-cmRNA-EGFP;

[0028] Figure 4 It is a comparison chart of the translation intensity of EGFP protein after transfection of 293T cells and DF1 cells;

[0029] Figure 5 Results of quantitatively measuring fluorescence intensity using a microplate reader in 293T cells;

[0030] Figure 6 Results of quantitatively measuring fluorescence intensity using a microplate reader in DF1 cells. Detailed implementation manners

[0031] Next, the present invention will be clearly and completely described in conjunction with the embodiments of the present invention. In the description of the present invention, it should be noted that for those conditions not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through commercial purchase.

[0032] Example 1

[0033] 1.1 Preparation of the template backbone

[0034] It specifically includes a T7 promoter, 5'-UTR, 3'-UTR, and PolyA tail. The overall structure of the template backbone is as Figure 1 shown; this template backbone was synthesized by Suzhou Hongxun Biotechnology Co., Ltd.;

[0035] The sequence of the T7 promoter is as shown in SEQ ID NO: 3:

[0036] SEQ ID NO: 3: TAATACGACTCACTATAAG;

[0037] Among them, the 5'-UTR is a fragment of the mRNA of chicken hemoglobin subunit β (provided by Suzhou Hongxun Biotechnology Co., Ltd.). More specifically, its sequence is as shown in SEQ ID NO: 1:

[0038] SEQ ID NO: 1: GCTCAGACCTCCTCCGTACCGACAGCCACACGCTACC CTCCAACCGCCGCC;

[0039] Among them, the 3'-UTR consists of two identical 3'-UTRs of the mRNA of chicken hemoglobin subunit β (provided by Suzhou Hongxun Biotechnology Co., Ltd.). The sequence connecting the two 3'-UTRs is CCTCGAG, which contains an XhoI restriction site. More specifically, its sequence is as shown in SEQ ID NO: 2:

[0040] SEQ ID NO: 2: GCACCAGCACCAAAGATCACGGAGCACCTACAACCA TTGCATGCACCTGCAGAAATGCTCCGGAGCTGACAGCTTGTGACAAATAAA GTTCATTCAGTGACACTCA;

[0041] Among them, the sequence connecting the 5'-UTR and 3'-UTR is GGGATCCCGGG, which contains a BamHI and a SmaI restriction site;

[0042] The sequence connecting the 3'-UTR and polyA is GAAGATCTTC, which contains a GblII selected polyA tail sequence with a total length of 100 bp, divided into two segments by NsiI. The specific sequence of polyA is shown in SEQ ID NO: 5:

[0043] SEQ ID NO: 5: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ATGCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAA;

[0044] An MluI restriction site is added after polyA, and the overall structure of the template backbone is as Figure 1 shown, and the sequence of the template backbone is shown in SEQ ID NO: 4:

[0045] SEQ ID NO: 4: GAATTCGCC TAATACGACTCACTATAAG GG GCTCAG ACCTCCTCCGTACCGACAG CCACACGCTACCCTCCAACCGCCGCC GGGATCCCGGG GCACCAGCACCAAAGATCACGGAGCACCTACAACCATTG CATGCACCTGCAGAAATGCTCCGGAGCTGACAGCTTGTGACAAATAAAGTTCATTCAGTGACACTCA CCTCGAG GC ACCAGCACCAAAGATCACGGAGCACCTACAACCATTGCATGCACCTGCAGAAATGCTCCGGAGCTGACAGCTTGTG ACAAATAAAGTTCATTCAGTGACACTCA GAAGATCTTC AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGC ATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CGCGTGAAGCTTG;

[0046] It should be noted that the underlined parts in the sequence of the template backbone (SEQ ID NO: 4) are the T7 promoter, 5'-UTR, 3'-UTR, 3'-UTR, and PolyA tail in sequence;

[0047] The remaining bases are for connection purposes.

[0048] Example 2

[0049] Preparation of mRNA Transcription Vector

[0050] This embodiment provides an mRNA transcription vector, which is prepared by the following method:

[0051] Step 1: The fragment in Example 1 and the pUC57-AMP-GG-nolacz plasmid provided by Suzhou Hongxun Biotechnology Co., Ltd. were double-digested respectively, and EcoRI (Code No.: 1040A) and HindIII (Code No.: 1060A) from Takara Company were used for enzyme digestion and the digestion products were recovered.

[0052] Step 2: Use Takara's T4 ligase (Code No.: 2011A) to ligate the double-digested fragment to the digested pUC57-AMP-GG-nolacz.

[0053] Step 3: Transform the ligated plasmid into Stbl3 competent cells, identify the strain, and obtain the recombinant plasmid. The recombinant plasmid is named pUC57-cmRNA. The construction method and structure are as follows Figure 2 The nucleotide sequence is shown in SEQ ID NO: 6:

[0054]

[0055] Example 3

[0056] This example provides an mRNA encoding EGFP protein and expresses it in vitro. This mRNA is prepared by the following method:

[0057] Step 1: Amplification of the EGFP gene. Use the pSBT-mRNA-EGFP-120 plasmid provided by Suzhou Huaxun Biotechnology Co., Ltd. as a template to amplify the EGFP gene and recover it.

[0058] Step 2: Digest the EGFP in Step 1 with BamHI endonuclease, and at the same time digest pUC57-cmRNA.

[0059] Step 3: Use T4 ligase to ligate EGFP to pUC57-cmRNA. The new plasmid is named pUC57-cmRNA-EGFP. The plasmid construction method and structure are as Figure 3 shown.

[0060] Step 4: Transform the ligated plasmid into Stbl3 competent cells, identify the strain, and obtain the plasmid template.

[0061] Step 5: Linearize the plasmid with MluI endonuclease.

[0062] Step 6: Use the EasyCap T7 Co-transcription Kit with CAG Trimer (Cat.No.: DD4203-00) to transcribe pUC57-cmRNA-EGFP to obtain mRNA, named cmRNA-EGFP.

[0063] Step 7: Use the Lipofectamine 2000 transfection reagent from Thermo Fisher Scientific for transfection. Transfect 4 μg of mRNA into each well of a six-well plate, and transfect 293T cells and DF-1 cells respectively.

[0064] Step 8: Every 12 hours, use a fluorescence microscope and a microplate reader to detect the fluorescence intensity.

[0065] Comparative Example 1

[0066] This comparative example provides a comparative template backbone (hmRNA-EGFP). The difference between this template backbone and the template backbone prepared in Example 1 is that the 5'-UTR and 3'-UTR are mRNA fragments of human hemoglobin subunit β. More specifically, the 5'-UTR of the mRNA fragment taken from human hemoglobin subunit β is as shown in SEQ ID NO: 7:

[0067] SEQ ID NO: 7: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACC TCAAACAGACACC;

[0068] The 3'-UTR of the mRNA fragment taken from human hemoglobin subunit β is shown in SEQ ID NO: 8;

[0069] SEQ ID NO: 8: GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCC TTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGA GCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC;

[0070] At the same time, the in vitro expression of EGFP was carried out using the template backbone of Comparative Example 1, and the construction method was referred to Example 3.

[0071] Result analysis

[0072] Observation Figures 4 - 6 , first combine Figure 4 , by observing the translation intensity of EGFP protein after transfection, it can be found that in 293T cells, the translation efficiency of EGFP protein in the cmRNA-EGFP group is stronger than that in the hmRNA-EGFP group. In DF1 cells, the translation efficiency of EGFP protein in the cmRNA-EGFP group shows a greater advantage compared with hmRNA-EGFP.

[0073] Secondly combine Figures 5 - 6 , by comparing the fluorescence intensity of EGFP protein in different cells at different times, we found that the fluorescence intensity of both reached the highest at 24 h after transfection, but the fluorescence intensity of cmRNA-EGFP transfected was significantly higher than that of hmRNA-EGFP. Although the fluorescence intensity of all groups decreased after 24 h of transfection, until 48 h, the fluorescence intensity of the cmRNA-EGFP group was still significantly higher than that of the hmRNA-EGFP group.

[0074] This shows that using the 5'-UTR and 3'-UTR sequences in the pUC57-cmRNA plasmid significantly improves the translation efficiency of mRNA compared with using the traditional 5'-UTR and 3'-UTR sequences of human hemoglobin subunit β. The results confirm the superiority of the 5'-UTR and 3'-UTR in the pUC57-cmRNA plasmid.

Claims

1. An mRNA transcription vector, characterized in that, It includes a plasmid and a template backbone connected to the plasmid; and the 5'-UTR of the template backbone is taken from a fragment of the mRNA of chicken hemoglobin subunit β, and the sequence is as shown in SEQ ID NO: 1; the 3'-UTR of the template backbone is taken from a fragment of the mRNA of chicken hemoglobin subunit β, and the sequence is as shown in SEQ ID NO: 2; the insertion position of the external gene to be loaded peripherally is between the 5'-UTR and the 3'-UTR.

2. The mRNA transcription vector according to claim 1, characterized in that, The template backbone further includes a T7 promoter and a PolyA tail; the T7 promoter, 5'-UTR, 3'-UTR, and PolyA tail are connected in sequence.

3. The mRNA transcription vector according to claim 2, characterized in that, The sequence of the T7 promoter is as shown in SEQ ID NO: 3; the sequence of the template backbone is as shown in SEQ ID NO:

4.

4. The mRNA transcription vector according to claim 1, characterized in that, The plasmid is at least one of pUC57, pUC19, pMD18-T, and pBR322.

5. The mRNA transcription vector according to claim 1, wherein The external gene to be loaded is selected from any one of EGFP, HA, E2, and HN.

6. A construction method for constructing the mRNA transcription vector according to any one of claims 2-5, characterized in that, It includes the following steps: Step 1: Connect the T7 promoter, 5'-UTR, 3'-UTR, and PolyA tail in sequence to obtain a template backbone; Step 2: Connect the template backbone to the plasmid to obtain an mRNA transcription vector.

7. Use of the mRNA transcription vector according to any one of claims 1-5 for preparing an mRNA vaccine.

Citation Information

Patent Citations

  • UTR for regulating and controlling mRNA high expression and application thereof

    CN116536318A

  • Plasmid vector for expressing mRNA of cellular immune vaccine as well as construction method and application of plasmid vector

    CN111607613A

  • Universal and efficient mRNA vaccine preparation method and product

    CN116440256A

  • Construction of universal mRNA in-vitro transcription template skeleton containing mRNA in-vitro transcription element

    CN118109494A

  • MRNA for protein expression and templates thereof

    CN118556131A