Method and kit for evaluating stimulation degree of stimulant to eyes
The gene expression of zebrafish juveniles was measured by zebrafish model and qPCR, which solved the problems of strong subjectivity and long cycle in rabbit eye experiments, and achieved rapid and accurate detection of the degree of eye stimulation of cosmetics.
Patent Information
- Application Number
- CN202510228556.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-07-04
AI Technical Summary
The existing rabbit eye experiments have problems such as strong subjectivity, long periods and high false positive rates when evaluating cosmetic irritability, making it difficult to achieve fast, efficient and accurate detection of eye irritants.
Using the zebrafish model, the relative expression of kdrl, flt4 and tnfα genes in zebrafish juveniles was determined by qPCR method, the reaction value integral was calculated, and stimulation grade was performed based on the sum of integrals, and a new evaluation method was designed and a kit was constructed.
It achieves rapid and accurate grading of the stimulation degree of cosmetics, has high throughput screening and short test cycles, and has high credibility in experimental results.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of cosmetics detection. Specifically, it relates to a method and kit for evaluating the irritation degree of irritants to the eyes. Background Art
[0002] When an irritant comes into direct contact with the human body, especially the sensitive area of the eyes, its safety is of crucial importance. Products that are easy to reach the eyes must undergo an acute eye irritation test, which requires enterprises to establish an evaluation method to conduct eye irritation tests on rinsing products to meet regulatory requirements. Through the evaluation method, it can be ensured that the irritant meets safety standards before being marketed, protecting consumers from potential harm.
[0003] The rabbit eye test (Draize Eye Test) is a classic method for evaluating the irritation of irritants, chemical raw materials, etc. However, there are some disadvantages and limitations in practical applications. The scoring of the rabbit eye test depends on the subjective judgment of the observer, which may lead to inconsistent scoring and poor repeatability. At the same time, the cycle of the rabbit eye test is relatively long, not meeting the requirements of modern rapid evaluation. For some products, such as cleaning products and hair dyes, the false positive rate of the rabbit eye test is relatively high, which means that some products may be wrongly rated as irritating products.
[0004] Due to its advantages such as small size, easy breeding, transparent embryos, and easy observation, the zebrafish model is widely used in medical and toxicological research. At the same time, the zebrafish model has characteristics such as high-throughput screening, short test cycle, and high credibility of experimental results. In recent years, it has gradually been used for the efficacy evaluation of irritants, becoming a research hotspot among scholars and an evaluation method recognized by the biotechnology industry.
[0005] Therefore, it is very necessary to design a new method for evaluating the eye irritation degree of irritants using the zebrafish model to achieve faster, more efficient, and accurate detection. Summary of the Invention
[0006] In view of the above problems, the present invention provides a method and kit for evaluating the irritation degree of irritants to the eyes.
[0007] To achieve the above object, the technical solution of the present invention is as follows: A method for evaluating the irritation degree of irritants to the eyes, comprising the following steps:
[0008] (1) Divide the normally hatched zebrafish larvae after fertilization into 2 groups, namely a control group and a sample group. Among them, the control group is the zebrafish larvae without the treatment of the irritant to be evaluated, and the sample group is the treatment group containing the irritant to be evaluated;
[0009] (2)Use qPCR to measure the relative expression levels of the kdrl, flt4, and tnfα genes in zebrafish in the control group and the sample group respectively, and calculate the ratio of the relative expression level of each gene in each sample group to the relative expression level of the corresponding gene in each control group. Determine the response value integral of each gene to the test stimulant according to the ratio;
[0010] (3)Classify the test stimulant according to the sum of the response value integrals of each gene to the test stimulant in step (2). It is divided into two levels: mild stimulation and no stimulation or mild stimulation.
[0011] The present invention is further configured such that the standard for determining the response value integral according to the ratio of the relative expression levels of each gene in the sample group and the control group is as follows:
[0012] For tnfα: When the ratio of the relative expression level of the tnfα gene in the sample group to the relative expression level of the tnfα gene in the control group is less than 2, the integral is recorded as 0; when the ratio ≥ 2 and ≤ 2.7, the integral is recorded as 1; when the ratio > 2.7, the integral is recorded as 2;
[0013] For kdrl: When the ratio of the relative expression level of the kdrl gene in the sample group to the relative expression level of the kdrl gene in the control group is less than 2, the integral is recorded as 0; when the ratio ≥ 2 and ≤ 3.5, the integral is recorded as 1; when the ratio > 3.5, the integral is recorded as 2;
[0014] For flt4: When the ratio of the relative expression level of the flt4 gene in the sample group to the relative expression level of the flt4 gene in the control group is less than 2, the integral is recorded as 0; when the ratio ≥ 2 and ≤ 4, the integral is recorded as 1; when the ratio > 4, the integral is recorded as 2.
[0015] The present invention is further configured such that in step (3), the standard for classifying the test stimulant is: when the sum of the response value integrals of tnfα, kdrl, and flt4 to the test stimulant < 5 points, it is determined as no stimulation or mild stimulation; ≥ 5 points, it is determined as mild stimulation.
[0016] The present invention is further configured such that in step (2), the specific primer sequences for detecting the expression of the kdrl gene are as shown in SEQ ID NO: 1-2:
[0017] Forward: 5’- CGCCAGAGGCCATTTTTGAC-3’;
[0018] Reverse: 3’- TAAGGGGAGGCACCAAGAGA-5’;
[0019] The specific primer sequences for detecting the expression of the flt4 gene are as shown in SEQ ID NO: 3-4:
[0020] Forward: 5’- TCCTGTGGCACATCCTCTTG -3’;
[0021] Reverse: 3’- CAAACCTGCGCGTTTTCTGA -5’;
[0022] The specific primer sequences for detecting the expression of the tnfα gene are shown in SEQ ID NO: 5-6:
[0023] Forward: 5’- CGGTGAGGGAAAAGATGCCT -3’;
[0024] Reverse: 3’- AAATCACAACGCGAACACCC -5’.
[0025] The present invention is further configured such that zebrafish is used as an experimental model, and zebrafish hatched normally three days after fertilization is selected for subsequent experiments.
[0026] The present invention is further configured such that in step (1), in the blank group, zebrafish is first exposed to culture water for 5-10 minutes, and after the exposure is completed, the experiment is carried out; in the sample group, the stimulant to be evaluated is dissolved in culture water at a concentration of 0.5-2.0 mg / mL, and zebrafish is exposed in it for the same time as the blank group, and after the exposure is completed, the experiment is carried out.
[0027] The present invention is further configured such that the stimulant to be evaluated includes cosmetics; the cosmetics include rinse-off cosmetics.
[0028] The present invention also provides a kit for evaluating the degree of eye irritation caused by a stimulant, including the specific primer sequences shown in SEQ ID NO: 1-6.
[0029] The present invention is further configured such that the kit further includes RNA extraction reagents, reverse transcription reagents, and qPCR reagents.
[0030] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention selects a zebrafish model, discovers genes related to eye irritation in zebrafish, designs a new evaluation method for evaluating the degree of eye irritation caused by a stimulant, grades the degree of irritation, and constructs a kit to achieve rapid and accurate grading of the degree of irritation of the stimulant to be evaluated; (2) The present invention uses a zebrafish model, and zebrafish has the characteristics of high-throughput screening, short test cycle, and high credibility of experimental results. Brief Description of the Drawings
[0031] Figure 1Schematic diagram of the result of screening the degree of correlation between the zebrafish genes to be tested and eye irritation in Example 1.
[0032] Figure 2 Schematic diagram of the result of screening the degree of correlation between the zebrafish genes to be tested and eye irritation in Comparative Example 1.
[0033] Figure 3 Schematic diagram of the result of verifying the degree of correlation between the tail spin movement of zebrafish embryos and eye irritation in Verification Example 1.
[0034] Figure 4 Schematic diagram of the detection result of kdrl mRNA after the treatment in Example 2.
[0035] Figure 5 Schematic diagram of the detection result of flt4 mRNA after the treatment in Example 2.
[0036] Figure 6 Schematic diagram of the detection result of tnfα mRNA after the treatment in Example 2.
[0037] Figure 7 Schematic diagram of the detection result of kdrl mRNA after the treatment in Example 3.
[0038] Figure 8 Schematic diagram of the detection result of flt4 mRNA after the treatment in Example 3.
[0039] Figure 9 Schematic diagram of the detection result of tnfα mRNA after the treatment in Example 3.
[0040] Figure 10 Schematic diagram of the detection result of kdrl mRNA after the treatment in Example 4.
[0041] Figure 11 Schematic diagram of the detection result of flt4 mRNA after the treatment in Example 4.
[0042] Figure 12 Schematic diagram of the detection result of tnfα mRNA after the treatment in Example 4.
[0043] The above schematic diagrams of the detection results are all schematic diagrams of the results of one of the ten parallel experiments. Detailed implementation mode
[0044] The present invention will be further described below through examples. The following examples are only used to illustrate the present invention, but do not limit the implementation scope of the present invention.
[0045] All the stimulant samples used in the examples were purchased from the market;
[0046] The present invention provides a method for evaluating the degree of eye irritation caused by a stimulant, comprising the following steps:
[0047] (1) Divide the normally hatched zebrafish larvae after fertilization into two groups, namely a control group and a sample group. Among them, the control group is the zebrafish larvae without treatment with the stimulant to be evaluated, and the sample group is the treatment group containing the stimulant to be evaluated;
[0048] (2) Use qPCR method to respectively measure the relative expression levels of kdrl, flt4 and tnfα genes in the zebrafish of the control group and the sample group, and calculate the ratio of the relative expression level of each gene in each sample group to the relative expression level of each corresponding gene in each control group, and determine the response value integral of each gene to the stimulant to be evaluated;
[0049] (3) According to the sum of the response value integrals of each gene to the stimulant to be evaluated in step (2), classify the stimulant to be evaluated, which is divided into two levels: mild irritation and no irritation or mild irritation.
[0050] The criteria for determining the response value integral according to the ratio of the relative expression levels of each gene in the sample group and the control group are as follows:
[0051] For tnfα: when the ratio of the relative expression level of the tnfα gene in the sample group to the relative expression level of the tnfα gene in the control group is less than 2, the integral is recorded as 0; when the ratio ≥ 2 and ≤ 2.7, the integral is recorded as 1; when the ratio > 2.7, the integral is recorded as 2; for kdrl: when the ratio of the relative expression level of the kdrl gene in the sample group to the relative expression level of the kdrl gene in the control group is less than 2, the integral is recorded as 0; when the ratio ≥ 2 and ≤ 3.5, the integral is recorded as 1; when the ratio > 3.5, the integral is recorded as 2; for flt4: when the ratio of the relative expression level of the flt4 gene in the sample group to the relative expression level of the flt4 gene in the control group is less than 2, the integral is recorded as 0; when the ratio ≥ 2 and ≤ 4, the integral is recorded as 1; when the ratio > 4, the integral is recorded as 2.
[0052] In step (3), the criteria for classifying the stimulant to be evaluated are: when the sum of the response value integrals of tnfα, kdrl and flt4 to the stimulant to be evaluated < 5 points, it is determined as no irritation or mild irritation; ≥ 5 points, it is determined as mild irritation.
[0053] The specific primer sequences for detecting the expression of the kdrl gene are shown in SEQ ID NO: 1-2:
[0054] Forward: 5’- CGCCAGAGGCCATTTTTGAC-3’;
[0055] Reverse: 3’- TAAGGGGAGGCACCAAGAGA-5’;
[0056] The specific primer sequences for detecting the expression of the flt4 gene are shown in SEQ ID NO: 3-4:
[0057] Forward: 5’- TCCTGTGGCACATCCTCTTG -3’;
[0058] Reverse: 3’- CAAACCTGCGCGTTTTCTGA -5’;
[0059] The specific primer sequences for detecting the expression of the tnfα gene are shown in SEQ ID NO: 5-6:
[0060] Forward: 5’- CGGTGAGGGAAAAGATGCCT -3’;
[0061] Reverse: 3’- AAATCACAACGCGAACACCC -5’.
[0062] In one embodiment of the present invention, in step (1), in the blank group, zebrafish are first exposed to culture water for 5-10 minutes, and after the exposure is completed, the experiment is carried out; in the sample group, the stimulant to be evaluated is dissolved in culture water at a concentration of 0.5-2.0 mg / mL, and zebrafish are exposed to it for the same time as the blank group, and after the exposure is completed, the experiment is carried out.
[0063] In one embodiment of the present invention, a method for evaluating the irritation degree of a stimulant to the eye specifically comprises the following steps:
[0064] The first step, zebrafish are exposed in culture water containing the stimulant to be evaluated
[0065] Zebrafish larvae hatched three days after fertilization are divided into two groups, with 30 fish in each group. One group is the control group, and the other group is the sample group. Among them, the control group is normal zebrafish larvae without treatment with the stimulant to be evaluated, and in the sample group, the stimulant to be evaluated is dissolved in culture water at a concentration of 1 mg / mL. Zebrafish in both the control group and the sample group are exposed for 5 minutes, and after the exposure is completed, the experiment is carried out.
[0066] The second step, the gene expression of the related factors to be measured in zebrafish is determined by qPCR method
[0067] (1)RNA extraction: Put the zebrafish embryos of each group into a grinding tube respectively, add 1 ml of Trizol, homogenize, and let it stand for 3 min; add 200 μL of chloroform, vortex and mix well, and let it stand for 5 min; adjust the centrifuge speed to 12,000 rpm and centrifuge at 4 °C for 15 min. After completion, aspirate the supernatant containing RNA into a new 1.5 mL enzyme-free centrifuge tube; add an equal volume of isopropanol to the supernatant to precipitate RNA, and let it stand at -20 °C in the refrigerator for 15 min; centrifuge at 12,000 rpm at 4 °C for 10 min to obtain the RNA precipitate; after washing and dissolving, check the purity and integrity of RNA, and immediately reverse transcribe the extracted and separated RNA. Extract the RNA of the test sample by the Trizol method.
[0068] (2)Reverse transcription to synthesize cDNA: Perform reverse transcription according to the methods and conditions shown in Tables 1 - 3 below.
[0069] Table 1 Specific primer sequences designed
[0070]
[0071] Table 2 Reverse transcription reaction system
[0072]
[0073] Table 3 Reverse transcription reaction conditions
[0074]
[0075] (3)qPCR reaction: Perform qPCR according to the methods in Tables 4 - 5 below.
[0076] Table 4 PCR amplification reaction system
[0077]
[0078] Table 5 PCR amplification reaction conditions
[0079]
[0080] Collect real-time PCR data. Ct is used as the amplification result, the amplification amount of the β-actin gene is used as the internal reference gene, and the relative expression amount of the relevant gene is calculated as the test result.
[0081] Result determination: Based on the obtained CT value, using β-actin as the internal reference, use the 2 -∆∆CT method to calculate the expression level. Integrate according to the multiple relationship between the expression level of the sample group and the control group. As shown in Tables 6 - 7, if the total integral ≥ 5 points, it is considered that the sample group has a mild irritation to the eyes. If the total integral of the sample group < 5 points, it is considered that the sample group has no irritation or mild irritation to the eyes.
[0082] Table 6 Eye irritation scoring criteria
[0083]
[0084] Table 7 Eye irritation classification
[0085]
[0086] The technical solution of the present invention will be further described below in conjunction with specific application embodiments.
[0087] Example 1
[0088] Evaluation of the degree of correlation between the gene to be tested and eye irritation
[0089] First, the purchased cosmetic irritants were tested in a rabbit eye acute eye irritation experiment according to the Cosmetics Safety and Technical Standards 2015 edition to obtain the corresponding irritation degrees of each irritant. The detection results of the test substances and the irritation degrees are shown in Table 1.
[0090] Table 1
[0091]
[0092] (2) Take one sample each rated as non-irritating, slightly irritating, and mildly irritating in the above rabbit eye experiment, namely the No. 1 body wash sample, the No. 1 facial cleansing gel sample, and the No. 1 shampoo sample. Take 10 mg of each and dissolve it with 1 mL of 10% DMSO to prepare a stock solution of 10 mg / mL.
[0093] (3) Dilute the stock solution with zebrafish culture water to prepare a 1 mg / mL solution and prepare it for subsequent experiments.
[0094] (4) Divide the zebrafish larvae hatched three days after fertilization into two groups, with 30 fish in each group placed in a 6-well plate. One group is the control group and the other group is the sample group. Among them, the control group is normal zebrafish larvae without any treatment, and the sample group dissolves the irritant to be evaluated in the culture water at a concentration of 1 mg / mL. The zebrafish in the control group and the sample group are both exposed for 5 minutes before the experiment.
[0095] (5) Add RNA extraction solution to extract total RNA, perform reverse transcription and then qPCR. Collect the real-time PCR data. Ct is used as the amplification result, and the amplification amount of the β-actin gene is used as the internal reference gene to calculate the relative expression levels of the genes kdrl, flt4, and tnfα related to the eye irritation degree as the experimental results. The results are as Figure 1 shown.
[0096] According to Figure 1As can be seen from the results shown, the expression trends of the three genes kdrl, flt4, and tnfα are consistent with the degree of stimulation evaluated in the rabbit eye experiment. The above experiment was carried out 10 parallel experiments, with each parallel experiment repeated three times, and the accuracy rate of each gene in distinguishing lightly stimulated samples was detected. The calculation method of the accuracy rate is: the number of parallel experiments that meet the expectations / the total number of parallel experiments. The results are shown in Table 2. According to Figure 1 and the test results in Table 2, it is known that the three genes kdrl, flt4, and tnfα are selected to distinguish stimulated samples with high accuracy.
[0097] Comparative Example 1
[0098] The same method as in Example 1 was used, except that the relevant genes to be verified were different. In this comparison, the relative expression levels of other genes including flt1, notch1a, notch3, hey1, kdr, gpx1a, cat, il-1β, il-8, and nos2b were used as experimental results in the same way. The results are as Figure 2 shown.
[0099] The above experiment was carried out 10 parallel experiments, with each parallel experiment repeated three times, and the accuracy rate of each gene in distinguishing lightly stimulated samples was detected. The results are shown in Table 2. According to Figure 2 and the results in Table 2, it can be seen that the relevant factors selected in the comparative example cannot accurately evaluate the degree of stimulation of the stimulant.
[0100] Table 2 Accuracy rate of each detected gene in distinguishing lightly stimulated samples
[0101]
[0102] Verification Example 1
[0103] Healthy and developmentally consistent AB strain zebrafish embryos at 24 hpf were randomly selected and placed in a 96-well plate, with 7 embryos in each well. The 1st body wash sample, the 1st facial cleansing gel sample, and the 1st shampoo sample were selected and the zebrafish embryos were treated with the same grouping method, concentration, and exposure time as in the gene experiment. A stereomicroscope was used to record the number of spin movements of the zebrafish embryos within 30 s.
[0104] There is a certain relationship between the spin movement of the zebrafish embryo tail and the effect of eye irritation, that is, as the concentration of the stimulant increases, the effects on the tail spin movement and eye irritation will intensify. Therefore, the effects of the genes kdrl, flt4, and tnfα in distinguishing lightly stimulated products can be further verified through this experiment. The experimental results are as Figure 3As shown, the higher the number of spins of the tail of the zebrafish embryo, the greater the degree of stimulation it receives. The trend of the change in the number of spins of its tail is the same as that measured by the three genes kdrl, flt4, and tnfα. Therefore, it is further proven that the three genes can distinguish mild-stimulus samples.
[0105] Example 2
[0106] The qPCR method described in Example 1 was used to evaluate the irritation degree of Sample 1 body wash, Sample 1 facial cleansing gel, and Sample 1 shampoo on the eyes. The specific implementation steps are as follows:
[0107] (1) Respectively take 10 mg of the irritant sample to be evaluated, dissolve it with 1 mL of 10% DMSO, and prepare the mother liquor at 10 mg / mL.
[0108] (2) Dilute the mother liquor with zebrafish culture water to prepare a 1 mg / mL solution and prepare it for subsequent experiments.
[0109] (3) Divide the zebrafish larvae hatched three days after fertilization into two groups, with 30 fish in each group placed in a 6-well plate. One group is the control group, and the other group is the sample group. Among them, the control group is normal zebrafish larvae without any treatment, and in the sample group, the irritant to be evaluated is dissolved in culture water at a concentration of 1 mg / mL. After the zebrafish in both the control group and the sample group are exposed for 5 minutes, the experiment is carried out.
[0110] (4) Add RNA extraction solution to extract total RNA, perform reverse transcription and then qPCR. Collect real-time PCR data. Ct is used as the amplification result, and the amplification amount of the β-actin gene is used as the internal reference gene to calculate the relative expression levels of kdrl, flt4, and tnfα as the experimental results. The results are as Figures 3 - 5 shown.
[0111] From Figures 4 - 6 the test results shown, for Sample 1 body wash, the sum of the relative expression level integrals of kdrl, flt4, and tnfα is 0, belonging to no irritation or mild irritation; for Sample 1 facial cleansing gel, the sum of the relative expression level integrals of kdrl, flt4, and tnfα is 0, belonging to no irritation or mild irritation; for Sample 1 shampoo, the sum of the relative expression level integrals of kdrl, flt4, and tnfα is 5 points, belonging to mild irritation.
[0112] Example 3
[0113] The qPCR method was used to evaluate the irritation degree of Sample 2, Sample 3, and Sample 4 body washes on the eyes. The specific implementation steps are as follows:
[0114] (1) Weigh 10 mg of the shower gel sample to be evaluated respectively, dissolve it with 1 mL of 10% DMSO, and prepare a stock solution with a concentration of 10 mg / mL.
[0115] (2) Dilute the stock solution with zebrafish culture water to prepare a 1 mg / mL solution for subsequent experiments.
[0116] (3) Divide the zebrafish larvae hatched three days after fertilization into two groups, with 30 fish in each group placed in a 6-well plate. One group is the control group, and the other is the sample group. The control group consists of normal zebrafish larvae without any treatment. In the sample group, the stimulant to be evaluated is dissolved in culture water at a concentration of 1 mg / mL. After the zebrafish in both the control group and the sample group are exposed for 5 minutes, the experiment is carried out.
[0117] (4) Add RNA extraction solution to extract total RNA, perform reverse transcription, and then carry out qPCR. Collect the real-time PCR data. Ct is used as the amplification result, and the amplification amount of the β-actin gene is used as the internal reference gene to calculate the relative expression levels of kdrl, flt4, and tnfα as the experimental results. The results are as Figures 7 - 9 shown.
[0118] As Figures 7 - 9 shown, for the shower gel sample No. 2, the sum of the relative expression level integrals of kdrl, flt4, and tnfα is 4, belonging to non-irritating or slightly irritating; for the shower gel sample No. 3, the sum of the relative expression level integrals of kdrl, flt4, and tnfα is 0, belonging to non-irritating or slightly irritating; for the shower gel sample No. 4, the sum of the relative expression level integrals of kdrl, flt4, and tnfα is 6, belonging to mildly irritating.
[0119] Example 4
[0120] Evaluate the irritation degree of shampoo sample No. 2, shower gel sample No. 5, and shower gel sample No. 6 on the eyes by qPCR method. The specific implementation steps are as follows:
[0121] (1) Weigh 10 mg of the shampoo and shower gel samples to be evaluated respectively, dissolve them with 1 mL of 10% DMSO, and prepare a stock solution with a concentration of 10 mg / mL.
[0122] (2) Dilute the stock solution with zebrafish culture water to prepare a 1 mg / mL solution for subsequent experiments.
[0123] (3) Divide the zebrafish larvae hatched three days after fertilization into two groups, with 30 fish in each group placed in a 6-well plate. One group is the control group, and the other is the sample group. The control group consists of normal zebrafish larvae without any treatment. In the sample group, the stimulant to be evaluated is dissolved in culture water at a concentration of 1 mg / mL. After the zebrafish in both the control group and the sample group are exposed for 5 minutes, the experiment is carried out.
[0124] (4) Add RNA extraction solution to extract total RNA, perform reverse transcription, and then perform qPCR. Collect real-time PCR data. Ct is used as the amplification result, the amplification amount of the β-actin gene is used as the internal reference gene, and the relative expression levels of kdrl, flt4, and tnfα are calculated as the experimental results. The results are as Figures 9 - 11 shown.
[0125] As Figures 10 - 12 shown, for the shampoo sample No. 2, the sum of the relative expression level integrals of kdrl, flt4, and tnfα is 1 point, belonging to no irritation or slight irritation; for the body wash sample No. 5, the sum of the relative expression level integrals of kdrl, flt4, and tnfα is 2 points, belonging to no irritation or slight irritation; for the body wash sample No. 6, the sum of the relative expression level integrals of kdrl, flt4, and tnfα is 5 points, belonging to mild irritation.
[0126] The above embodiments are only for illustrating the technical concept and features of the present invention, and the purpose is to enable those who are familiar with this technology to understand the content of the present invention and implement it accordingly, and it should not be used to limit the protection scope of the present invention. Any equivalent transformation or modification made according to the spirit and essence of the present invention should be covered within the protection scope of the present invention.
Claims
1. A method for evaluating the degree of eye irritation caused by a stimulant, characterized in that, It includes the following steps: (1) Divide the normally hatched zebrafish larvae after fertilization into two groups, namely the control group and the sample group. Among them, the control group is the zebrafish larvae without the treatment of the stimulant to be evaluated, and the sample group is the treatment group containing the stimulant to be evaluated; (2) Use qPCR method to measure the relative expression levels of kdrl, flt4 and tnfα genes in zebrafish in the control group and the sample group respectively, and calculate the ratios of the relative expression levels of each gene in each sample group to the relative expression levels of each gene in the corresponding control group respectively. Determine the response value integral of each gene to the stimulant to be evaluated according to the ratio; (3) Classify the stimulant to be evaluated according to the total response value integral of each gene to the stimulant to be evaluated in step (2), and divide it into two levels, namely mild stimulation and no stimulation or microstimulation; Among them, in step (2), the criteria for determining the integral of the response value according to the ratio of the relative expression levels of each gene in the sample group and the control group are as follows: For tnfα: when the ratio of the relative expression level of the tnfα gene in the sample group to the relative expression level of the tnfα gene in the control group is less than 2, the integral is recorded as 0; when the ratio ≥ 2 and ≤ 2.7, the integral is recorded as 1; when the ratio > 2.7, the integral is recorded as 2; For kdrl : when the ratio of the relative expression level of the kdrl gene in the sample group to the relative expression level of the kdrl gene in the control group is less than 2, the integral is recorded as 0; when the ratio ≥ 2 and ≤ 3.5, the integral is recorded as 1; when the ratio > 3.5, the integral is recorded as 2; For flt4 : when the ratio of the relative expression level of the flt4 gene in the sample group to the relative expression level of the flt4 gene in the control group is less than 2, the integral is recorded as 0; when the ratio ≥ 2 and ≤ 4, the integral is recorded as 1; when the ratio > 4, the integral is recorded as 2; In step (3), the criteria for classifying the stimuli of the stimuli to be evaluated are as follows: when tnfα, kdrl and flt4 the integral sum of the response values of the stimuli to be evaluated < 5 points, it is determined as no stimulus or mild stimulus; ≥ 5 points, it is determined as mild stimulus.
2. The method for evaluating the degree of eye irritation caused by a stimulant according to claim 1, characterized in that, In step (2), the specific primer sequences used for detecting kdrl gene expression are shown in SEQ ID NO: 1-2: Forward: 5’- CGCCAGAGGCCATTTTTGAC-3’; Reverse: 3’- TAAGGGGAGGCACCAAGAGA-5’; For detection flt4 The specific primer sequences for gene expression are shown in SEQ ID NO: 3-4: Forward: 5’- TCCTGTGGCACATCCTCTTG -3’; Reverse: 3’- CAAACCTGCGCGTTTTCTGA -5’; For detection tnfα The specific primer sequences for gene expression are shown in SEQ ID NO: 5-6: Forward: 5’- CGGTGAGGGAAAAGATGCCT -3’; Reverse: 3’- AAATCACAACGCGAACACCC -5’.
3. The method for evaluating the degree of eye irritation caused by a stimulant according to claim 1, characterized in that, In step (1), in the blank group, first use culture water to let zebrafish be exposed in it for 5-10 minutes, and then conduct the experiment after the exposure is completed; in the sample group, dissolve the stimulant to be evaluated in culture water at a concentration of 0.5-2.0 mg / mL, let zebrafish be exposed for the same time as the blank group, and then conduct the experiment after the exposure is completed.
4. A method for evaluating the degree of eye irritation caused by a stimulant according to claim 1, characterized in that, The stimulant to be evaluated includes cosmetics.
5. A kit for evaluating the degree of eye irritation caused by a stimulant, characterized in that, It includes the specific primer sequences shown in SEQ ID NO: 1-6.
6. The kit for evaluating the degree of eye irritation caused by a stimulant according to claim 5, characterized in that, It also includes RNA extraction reagents, reverse transcription reagents and qPCR reagents.