Nucleic acid combination for detecting CGG sequence of FMR1 gene, product and application of nucleic acid combination

By designing a capillary electrophoretic detection method of nested primer pairs and fluorescent labels, the false negative and false positive problems of FMR1 gene CGG sequence detection in the prior art are solved, and efficient and accurate CGG repeat number and AGG embedded detection are achieved, which is suitable for the field of genetic disease detection.

CN120249478APending Publication Date: 2025-07-04SHENZHEN MATERNITY & CHILD HEALTHCARE HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510515614.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently and accurately detect the number of duplicates of the FMR1 gene CGG sequence, especially low proportion chimerism and AGG embedding, resulting in false negative, false positive and detection errors, and cannot fully cover all types of FMR1 gene mutations.

Method used

Two sets of nested primer pairs were designed, located on both sides of the repeating region of the CGG sequence. The full length of the CGG sequence was obtained by PCR amplification, and the shadow peak of the small fragment amplified by TP-PCR primer were combined to accurately calculate the number of CGG repeats, and capillary electrophoresis was detected by fluorescent labeling.

Benefits of technology

High sensitivity detection of the FMR1 gene CGG sequence is achieved, which can accurately distinguish between normal, intermediate, promutant and full mutant, simplify operations, reduce the nucleic acid demand for sample, and improve detection efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249478A_ABST
    Figure CN120249478A_ABST
Patent Text Reader

Abstract

The invention discloses a nucleic acid combination for detecting a CGG sequence of an FMR1 gene, a product and application of the nucleic acid combination, and relates to the technical field of genetic disease detection. The nucleic acid composition and the product provided by the invention can be used for simultaneously detecting AGG insertion information and CGG repetition number. The detection amplification range of the nucleic acid combination and the product can cover all normal persons, brittleness X pre-mutation carriers / patients and brittleness X full-mutation carriers / patients; and the method has the characteristics of short detection time, high flux, simplicity in operation and small amount of required sample nucleic acid.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic disease detection, and in particular, to a nucleic acid combination, a product and an application for detecting the CGG sequence of the FMR1 gene. Background Art

[0002] Fragile X Syndrome (FXS) is an X-linked incompletely penetrant genetic disease, and is the most common single-gene disease in hereditary intellectual disability (Intellectual Disability, ID) and autism spectrum disorders (ASDs), with an incidence second only to Down syndrome. The pathogenic gene FMR1 of FXS is located at Xq27.3, about 40 kb in length, with a total of 17 exons and 16 introns. There is a (CGG)n trinucleotide repeat (Trinucleotide Repeat, TNR) sequence in the 5' untranslated region (5'UTR) upstream of its exon 1. The (CGG)n repeat sequence has a high degree of polymorphism in length, and usually there is an AGG insertion every 9-10 (CGG)n repeats. The AGG insertion has no effect on the FMR1 transcription efficiency, but affects the stability of the CGG repeat number. The CpG island is located about 250 bp upstream of the CGG repeat sequence. FMR1 transcribes an mRNA of about 3.9 kb, and the translated FMR protein (Fragile X Messenger Ribonucleoprotein 1, FMRP) is essential in the early stage of human development and throughout the life course. More than 95% of FXS is caused by the amplification of the (CGG)n trinucleotide repeat of the FMR1 gene, resulting in hypermethylation of the upstream CpG island, transcriptional silencing and deficiency or absence of FMRP.

[0003] The American College of Medical Genetics (ACMG) defines the number of CGG repeats in the 5' untranscribed region of the FMR1 gene. A CGG repeat count less than 45 is defined as "normal", 45 - 54 as "intermediate", 55 - 200 as "premutation", and greater than 200 as "full mutation", etc. "Normal" and "intermediate" types do not have clinical symptoms. "Premutation" carriers are so called. The number of CGG repeats in female premutation carriers is unstable during generation transmission, and the risk of expansion increases with the increase in the number of CGG repeats. The probability is still relatively low at 60 CGG repeats, while almost 100% of the probability will expand to full mutation when the number of CGG repeats is >100. As a result, giving birth to a patient with the "full mutation" type of Fragile X Syndrome (FXS) will lead to the occurrence of Fragile X Syndrome (FXS), which is also the main cause of Autism Spectrum Disorder (ASD).

[0004] Fragile X syndrome has a wide range of symptoms, from mild learning disabilities to severe intellectual disabilities. In addition to intellectual disabilities, other possible symptoms include: emotional problems, language delay, inattention, hyperactivity, autism, and difficulty in contacting people. According to statistics, the incidence rate of this disease in males is about 1 / 4,000, and the carrier rate in females is about 1 / 5,000 - 1 / 8,000. The carrier rate of female premutations in some countries is even as high as 1 / 776 - 1 / 580. Therefore, carrier screening for women of childbearing age or in early pregnancy is the best prevention and control measure. At the same time, comprehensive and accurate genetic screening and diagnosis are of great significance for reducing the economic and psychological pressure of sick families seeking medical treatment everywhere, providing timely behavioral intervention for children, and providing genetic counseling for the re - reproduction of the parents of children.

[0005] However, the reality is that due to the extremely complex and diverse types of gene mutations in FXS, there is a lack of comprehensive, accurate and efficient gene detection methods worldwide so far. Southern Blot Analysis (SBA) and PCR - based molecular detection are two conventional detection methods for analyzing (CGG)n repeat expansions. SBA can detect all repeat expansions and can also be used to determine the methylation status of the FMR1 gene. However, the detection sensitivity of this method is low, and PCR detection is required to accurately determine the (CGG)n repeat number of premutation alleles. Moreover, the operation process of SBA is time - consuming and laborious, and the required amount of DNA is relatively large, thus hindering its large - scale clinical application. Since the first PCR detection for (CGG)n repeat expansion of the FMR1 gene came out, a large number of published studies have tried to solve the problem of amplifying large genomic fragments rich in CG, and attempted to reduce the amplification efficiency differences between alleles with different (CGG)n repeat lengths.

[0006] Currently, the most common method is to detect through PCR / Triple Repeat Primed PCR (TP-PCR) combined with Capillary Electrophoresis (CE). It can determine whether there is an amplification of (CGG)n with more than 200 repeats and can detect CGG repeat numbers less than 200. However, it is unable to detect larger allele CGG repeat numbers. And since CE infers the CGG repeat number based on the length of the PCR amplification product, the accuracy of this method depends on the accuracy of the standard product. At the same time, the noise in the detection signal will also have an adverse impact on the result judgment. Based on the sensitivity of the PCR amplification system, the amplification of the CGG repeat region has very high requirements for the PCR amplification enzyme, enabling it to amplify the full-length fragment of the repeat sequence. And because the amplification product containing longer repeats can be used as a template for the amplification of shorter products, after multiple rounds of PCR amplification, the amount of small fragment products with low repeat numbers will exponentially exceed the amount of large fragment products with high repeat numbers, resulting in too low amplification efficiency for large fragment products, and the signal of large fragment products cannot even be distinguished from the background noise, leading to an ineffective judgment of the repeat number.

[0007] Commercially available PCR-based detection kits, such as the AmplideX FMR1 PCR / CE kit (Asuragen) and the Molecular Fragile X PCR kit (Abbott), although they can accurately identify full mutation alleles and precisely detect the CGG repeat number of pre-mutation alleles, this method also has limitations: First, microdeletions are prone to occur in the flanking regions of repeated amplification, which may affect primer annealing during the PCR process, and both false negative and false positive cases have been reported. Second, even using the TP-PCR method, the detection of AGG insertion is very challenging technically, and the detection of female samples is also very complex. And some low-proportion chimeras of (CGG)n amplification may also be misdiagnosed.

[0008] In view of this, the present invention is specifically proposed. Summary of the Invention

[0009] The object of the present invention is to provide a nucleic acid combination, product and its application for detecting the CGG sequence of the FMR1 gene to solve the above technical problems.

[0010] The present invention is implemented as follows:

[0011] In a first aspect, the present invention provides a nucleic acid combination for detecting the CGG sequence of the FMR1 gene, which comprises: a first primer pair as shown in SEQ ID NO: 1-2, a second primer pair as shown in SEQ ID NO: 3-4, and a third primer as shown in SEQ ID NO: 5.

[0012] In a second aspect, the present invention further provides a product for detecting the CGG sequence of the FMR1 gene. The product is a reagent, a kit or a chip, and the product comprises the above-mentioned nucleic acid combination for detecting the CGG sequence of the FMR1 gene.

[0013] In a third aspect, the present invention further provides the application of the nucleic acid combination for detecting the CGG sequence of the FMR1 gene in the preparation of a product for detecting the CGG sequence of the FMR1 gene. The application comprises: obtaining a PCR amplification system by mixing the DNA of the sample to be tested with the nucleic acid combination, then performing a PCR amplification reaction, and detecting the PCR amplification product by capillary electrophoresis or by loading it onto a gene chip.

[0014] The present invention has the following beneficial effects:

[0015] The present invention designs two sets of nested primers, namely a first primer pair and a second primer pair, on both sides of the CGG sequence repeat region in the 5'-untranscribed region of the FMR1 gene, and amplifies the full length of the CGG sequence through these two sets of nested primers. The nested primers improve the sensitivity of the full-length amplification of the CGG sequence repeat region and avoid false negative amplification caused by factors such as primer region polymorphism. The nested primers are located on both sides of the CGG sequence repeat region. By amplifying the full-length CGG sequence fragment and combining with the small fragment shadow peak amplified by the TP-PCR primer, the CGG repeat number can be accurately calculated. The amplification product of the nested primer is the full-length sequence of the CGG sequence repeat region, which serves as the amplification template for TP-PCR (triple repeat primer PCR) to effectively improve the amplification of large fragment products with a high CGG repeat number, thereby accurately calculating the CGG repeat number.

[0016] The 5'-end sequence of the above-mentioned third primer is a non-human source sequence, and the 3'-end is a CGG repeat sequence that can be complementary to the full-length sequence of the CGG sequence repeat region. When performing PCR amplification using the nucleic acid combination of the present invention, the first primer pair and the second primer pair respectively amplify two full-length sequences of the CGG sequence repeat region. Using the full-length sequences as templates, through the cooperation of the third primer with the downstream primer of the first primer pair or the downstream primer of the second primer pair, since the third primer can randomly complement any CGG sequence, small fragment CGG repeat sequences with a non-human source sequence at one end and large fragment CGG repeat sequences with a non-human source sequence at one end can be amplified. The provision of this nucleic acid combination avoids the problem that when the existing (TP-PCR) combined with capillary electrophoresis method (Capillary Electrophoresis, CE) is used for detection, after multiple rounds of PCR amplification, the amount of small fragment products with low repeat numbers will exponentially exceed the amount of large fragment products with high repeat numbers, resulting in too low amplification efficiency for large fragment products, and the signal of large fragment products cannot even be distinguished from background noise, leading to an inability to make an effective judgment on the repeat number. The method of designing two sets of nested primers on both sides of the CGG sequence repeat region in the 5'-untranscribed region also breaks through the problems of false negatives and false positives in the prior art due to the inability to completely amplify the flanking regions of repeated amplification. In addition, the present invention also realizes the accurate detection of AGG insertion.

[0017] The nucleic acid combination and product provided by the present invention can simultaneously detect AGG insertion information and CGG repeat numbers. The detection and amplification range of this nucleic acid combination and product can cover all normal people, fragile X premutation carriers / patients, and fragile X full mutation carriers / patients; and it has the characteristics of short detection time, large throughput, simple operation, and small amount of sample nucleic acid required. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can also be obtained based on these drawings without creative efforts.

[0019] Figure 1 It is a schematic diagram of primer positions, where the 5'-ends of downstream primer 1 and downstream primer 2 are modified with 6-FAM;

[0020] Figure 2Full-length agarose gel electrophoresis map amplified using upstream and downstream primers; Marker is 50bp Marker, amplifying normal type (24 / Y - 30 / Y) samples of the FMR1 gene, and the amplified full-length fragment is about 300bp - 350bp (0bp Ladder: GeneRuler 50bp DNA Ladder; 2-1, 2-2 are 2 replicates of normal type (24 / Y - 30 / Y) samples of the FMR1 gene);

[0021] Figure 3 Capillary electrophoresis analysis map of normal type (24 / Y - 30 / Y) samples of the FMR1 gene;

[0022] Figure 4 Capillary electrophoresis peak map of samples P1 and P2;

[0023] Figure 5 Capillary electrophoresis peak map of sample P7;

[0024] Figure 6 Capillary electrophoresis peak map of sample P9;

[0025] Figure 7 Capillary electrophoresis peak map of samples N1 and N5;

[0026] Figure 8 Capillary electrophoresis peak map of samples N7 and N9;

[0027] Figure 9 Capillary electrophoresis peak map of samples FMS1 and FMS2;

[0028] Figure 10 Capillary electrophoresis peak map of samples FMS3 and FMS4;

[0029] Figure 11 Capillary electrophoresis detection result map of samples P1 and P2 at a concentration of 10ng / μL;

[0030] Figure 12 Capillary electrophoresis detection result map of samples P5 and P6 at a concentration of 10ng / μL. Detailed implementation manners

[0031] Reference to the embodiments of the present invention will now be provided in detail, with one or more examples described below. Each example is provided by way of explanation and not limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the present invention. For example, features described or illustrated as part of one embodiment can be used in another embodiment to yield a still further embodiment.

[0032] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of those of ordinary skill in the art. Such techniques are fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Animal Cell Culture (R.I. Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D.M. Weir and C.C. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987); Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (Mullis et al., eds., 1994); and Current Protocols in Immunology (J.E. Coligan et al., eds., 1991), each of which is hereby expressly incorporated by reference.

[0033] The present invention designs two sets of nested primers on both sides of the CGG sequence repeat region in the 5'-untranscribed region of the FMR1 gene for amplifying the full-length CGG sequence. The nested primers can avoid false negative amplification caused by factors such as primer region polymorphism, improve the sensitivity of full-length amplification of the CGG sequence repeat region, increase the template amplification efficiency, and at the same time avoid false negative amplification caused by factors such as primer region polymorphism. The nested primers are located on both sides of the CGG sequence repeat region. By amplifying the full-length CGG sequence fragment and combining with the small fragment shadow peak amplified by the third primer, the CGG repeat number (i.e., the number of shadow peaks) can be accurately calculated. The amplification product of the nested primers is the full-length sequence of the CGG sequence repeat region, which serves as the template for TP-PCR amplification, effectively improving the amplification of large fragment products with high CGG repeat numbers, and thus accurately calculating the CGG repeat number. The number of shadow peak gaps is equal to the number of AGG insertions.

[0034] In a first aspect, the present invention provides a nucleic acid combination for detecting the CGG sequence of the FMR1 gene, which includes: a first primer pair as shown in SEQ ID NO: 1-2, a second primer pair as shown in SEQ ID NO: 3-4, and a third primer as shown in SEQ ID NO: 5.

[0035]

[0036]

[0037] The 5'-end sequence of the above-mentioned third primer is a non-human source sequence, and the 3'-end is a CGG repeat sequence that can be complementary to the full-length sequence of the CGG sequence repeat region.

[0038] When performing PCR amplification using the nucleic acid combination of the present invention, the first primer pair and the second primer pair respectively amplify two full-length sequences of the CGG sequence repeat region. Using the full-length sequence as a template, through the cooperation of the third primer (as the upstream primer) with the downstream primer of the first primer pair or the downstream primer of the second primer pair, since the third primer can randomly complement any CGG sequence, small fragment CGG repeat sequences with a non-human source sequence at one end and large fragment CGG repeat sequences with a non-human source sequence at one end can be amplified. The provision of this nucleic acid combination avoids the problem that when the existing (TP-PCR) combined with capillary electrophoresis method (Capillary Electrophoresis, CE) is used for detection, after multiple rounds of PCR amplification, the amount of small fragment products with low repeat numbers will exponentially exceed the amount of large fragment products with high repeat numbers, resulting in too low amplification efficiency for large fragment products, and the signal of large fragment products cannot even be distinguished from background noise, resulting in an inability to make an effective judgment on the repeat number. The method of designing two sets of nested primers on both sides of the CGG sequence repeat region in the 5'-untranscribed region also overcomes the problems of false negatives and false positives in the prior art due to the inability to completely amplify the flanking regions of repeated amplification.

[0039] The present invention provides a nucleic acid combination, which can detect the CGG sequence of the FMR1 gene in all normal people, fragile X premutation carriers / patients, and fragile X full mutation carriers / patients. It has the characteristics of short detection time, high throughput, simple operation, and small amount of sample nucleic acid required.

[0040] In a preferred embodiment of the application of the present invention, the 5' ends of the downstream primers of the first primer pair and the second primer pair are both labeled with a fluorescent dye. After such fluorescent labeling, it is convenient to detect the amplification products on a fluorescence capillary electrophoresis system subsequently; the original data is collected by the software supporting the capillary electrophoresis system, and the original data is imported into the software to analyze and obtain the CGG sequence data of the FMR1 gene.

[0041] In a preferred embodiment of the application of the present invention, the fluorescent dye is selected from any one of 5-FAM, 6-FAM, TAMRA, ATTO-590, PET, NED, VIC, HEX, TET, JOE, Cy3, Cy3.5, ROX, Texas Red, Cy5, Cy5.5, and Quasar670.

[0042] For example, the 5' ends of the downstream primers of the first primer pair and the second primer pair are both labeled with 5-FAM or 6-FAM. To facilitate the labeling of different PCR products, dyes with different fluorescence emission wavelengths can also be set at the 5' ends of the downstream primers of the first primer pair and the second primer pair.

[0043] In a second aspect, the present invention also provides a product for detecting the CGG sequence of the FMR1 gene. The product is a reagent, a kit, or a chip, and the product includes the above-mentioned nucleic acid combination for detecting the CGG sequence of the FMR1 gene.

[0044] In a preferred embodiment of the application of the present invention, the reagent is selected from PCR reaction premixes, and the forms of the reagent include, but are not limited to, solids, liquids, or semi-solids.

[0045] The kit further includes an amplification enzyme, a positive control product, and a negative control product. Further, the kit may also include at least one of a buffer solution, a diluent, and a washing solution, and is not limited thereto.

[0046] The PCR reaction premix includes, for example: primers, dNTP, MgCl2, Buffer, 7-deaza-dGTP, an enhancer, and Q-Solution. The enhancer is selected from one or more of betaine, dimethyl sulfoxide, glycerol, or ethylene glycol.

[0047] In a preferred embodiment of the application of the present invention, the positive control product is selected from pre-mutated cell line DNA, fully mutated cell line DNA or intermediate cell line DNA, and the negative control product is normal cell line DNA. In particular, the positive control product is selected from fully mutated cell line DNA.

[0048] The chip can also be referred to as a suspension array or a liquid array. It includes a carrier and nucleic acid molecules (such as primers and / or probes) and / or antibodies bound to the surface of the carrier.

[0049] The aforementioned carrier can be of various materials and forms. For example, it can preferably be selected from containers with a flat bottom. A more typical and preferred example is the multi-well plates, microplates, microfluidics-based devices (such as microfluidic chips), petri-dish-like containers, etc. widely used in biochemical detection, and is not limited thereto.

[0050] The microfluidic chip is selected from a PDMS chip or a metal droplet generator of a T-type chip, a flow focusing type chip or a coaxial flow type chip, or a PMMA microfluidic chip.

[0051] In a third aspect, the present invention also provides the application of a nucleic acid combination for detecting the CGG sequence of the FMR1 gene in the preparation of a product for detecting the CGG sequence of the FMR1 gene. The application includes: obtaining a PCR amplification system by combining the DNA of the sample to be tested with the nucleic acid combination, then performing a PCR amplification reaction, and detecting the PCR amplification product by capillary electrophoresis or loading it onto a gene chip.

[0052] In a preferred embodiment of the application of the present invention, the PCR amplification system includes: a first primer pair with a concentration of 0.1 μM to 1.0 μM, a second primer pair with a concentration of 0.1 μM to 1.0 μM, a third primer with a concentration of 0.01 μM to 0.1 μM, dNTPs with a final concentration of 0.1 μM to 0.5 μM, 7-deaza-dGTP with a final concentration of 0.2 μM to 1.0 μM, PCR Buffer, and amplification enzyme.

[0053] Under the above amplification system, good detection accuracy is achieved.

[0054] In a preferred embodiment of the application of the present invention, the PCR amplification system further includes an enhancer, and the enhancer is selected from one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.

[0055] In a preferred embodiment of the application of the present invention, the conditions for the PCR amplification reaction include:

[0056] 94°C, 5 min; 98°C, 10 s, (63 - 1°C) / 30 s, 68°C, 2 min, cycle 10 times; 98°C, 10 s, (68 - 1°C) / 30 s, 68°C, 2 min, cycle 10 times; 98°C, 10 s, 65°C, 30 s, 68°C, 3 min, cycle 30 times; 72°C, 1 - 10 min. (63 - 1°C) / 30 s means decreasing by 1°C from each cycle, starting from 63°C and decreasing by 1°C for each cycle, maintaining this temperature for 30 s.

[0057] Through a three-stage (10 + 10 + 30) amplification program, it is possible to preferentially amplify and obtain the full length of the CGG sequence repeat region, avoiding the preferential amplification of small fragment products with low repeat numbers, which may lead to the exponential growth of the amount of small fragment products exceeding that of large fragment products with high repeat numbers, resulting in too low amplification efficiency for large fragment products. In the second cycle of 10 times, mainly the third primer and the downstream primer of the first primer pair or the downstream primer of the second primer pair are used to amplify the full length of the CGG sequence repeat region, obtaining a small fragment CGG repeat sequence with a non-human source sequence at one end and a large fragment CGG repeat sequence with a non-human source sequence at one end. In the third cycle program (30 times), the number of amplification products is further amplified. This program has high amplification efficiency, can accurately distinguish the signal of large fragment products and background noise, and can effectively judge the repeat number.

[0058] In a preferred embodiment of the application of the present invention, after capillary electrophoresis, the CGG repeat number is obtained according to the number of shadow peaks; the number of AGG insertions is obtained according to the number of shadow peak gaps.

[0059] Relationship between CGG repeat number and genotype:

[0060] CGG repeat number Genotype ≤45 Normal type 45~55 Intermediate type 55~200 Premutation >200 Full mutation

[0061] The fluorescently labeled amplification products of the present invention can be electrophoresed in a capillary. Its signal is clear, the size difference of amplified fragments is obvious. After capillary electrophoresis, the CGG repeat number can be accurately obtained according to the number of shadow peaks; the electrophoretic peak patterns are different and easy to judge. It has the advantages of high sensitivity, good resolution, accurate and reliable results, high efficiency and speed. Using the primer combination provided by the present invention, the normal type, intermediate type, pre-mutation type and full-mutation type of the CGG sequence of the FMR1 gene can be conveniently and quickly distinguished, and the number of AGG insertions can be accurately judged, realizing the advantages of cost saving, efficiency improvement, convenient operation and accurate results.

[0062] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Those not specified in the embodiments are carried out according to conventional conditions or conditions recommended by the manufacturer. Those reagents or instruments not specified by the manufacturer are all conventional products that can be obtained through commercial purchase.

[0063] The features and performance of the present invention will be further described in detail below in conjunction with embodiments.

[0064] Example 1

[0065] This example provides a nucleic acid combination for detecting the number of CGG sequence repeats in the FMR1 gene of fragile X syndrome.

[0066] Two sets of nested primers are designed on both sides of the CGG sequence repeat region in the 5' untranslated region of the FMR1 gene ( Figure 1 as shown) for amplifying the full length of the CGG sequence. The nested primers improve the sensitivity of amplifying the full length of the CGG sequence repeat region, avoiding false negative amplification caused by factors such as primer region polymorphisms. The nested primers are located on both sides of the CGG sequence repeat region. By amplifying the full length CGG sequence fragment and combining with the small fragment shadow peak amplified by the TP-PCR primers, the number of CGG repeats can be accurately calculated. The amplification product of the nested primers is the full length sequence of the CGG sequence repeat region, which serves as the template for TP-PCR amplification, effectively improving the amplification of large fragment products with high CGG repeat numbers, and thus accurately calculating the number of CGG repeats.

[0067] Primer list:

[0068] Primer name Sequence (5’-3‘) Forward primer 1 AGGCGCTCAGCTCCGTTTCG Forward primer 2 CGCTCAGCTCCGTTTCGGTTTCACTTCC Reverse primer 1 GCCATTGGAGCCCCGCACTT Reverse primer 2 CTTCAGCCCTGCTAGCGCCG TP primer TCAGACGTGTGCTCTTCCGATCTCGGCGGCGGCGGCGG

[0069] Among them, the 5' ends of downstream primer 1 and downstream primer 2 are modified with 6-FAM.

[0070] Example 2

[0071] This example provides a detection method for detecting the number of CGG sequence repeats in the FMR1 gene of fragile X syndrome.

[0072] The specific steps of the detection method disclosed by the present invention are as follows:

[0073] (1) DNA extraction, and the DNA is dissolved in 1X Low TE buffer. The DNA concentration is not less than 10 ng / μL.

[0074] (2) Use an amplification enzyme and reaction system that can specifically amplify the high GC-rich region of the CGG repeat sequence. On the one hand, it can amplify the full length high CGG-rich region, and on the other hand, it can significantly reduce the amplification efficiency of short fragments with low CGG repeat numbers during TP-PCR amplification and improve the amplification efficiency of long fragments with high CGG repeat numbers, accurately calculating the number of CGG repeats.

[0075] The PCR amplification reaction system is as follows:

[0076]

[0077]

[0078] List of amplification enzymes:

[0079]

[0080] The amplification enzyme used in the present invention is one or a combination of multiple enzymes among the above amplification enzymes.

[0081] (3) Reaction conditions

[0082]

[0083]

[0084] (4) Capillary electrophoresis analysis of PCR amplification products: Detection is carried out using ABI3130, ABI3730, ABI3500Dx, or ABISeqStudio Genetic Analyzer capillary gene analyzer. Take 0.5 μL of PCR amplification product, 0.5 μL of 1200LIZ Size Standard, and 9 μL of Hi Di Formamide, mix well, denature at 95 °C for 5 min, immediately place on ice for 2 min, and then perform on-machine detection.

[0085] (5) Result interpretation and analysis

[0086] Due to the insertion of AGG in the CGG repeat sequence, slippage of the TP-PCR primer occurs, resulting in a gap of 5 consecutive fragments in the TP-PCR amplification shadow peak. The number of AGG insertions can be calculated based on the number of gaps, and the number of gaps in the shadow peak is equal to the number of AGG insertions. The CGG repeat number can be directly obtained from the number of shadow peaks.

[0087] Relationship between CGG repeat number and genotype:

[0088] CGG repeat number Genotype ≤45 Normal type 45~55 Intermediate type 55~200 Premutation >200 Full mutation

[0089] AGG status:

[0090] AGG status AGG insertion Number of shadow peak gaps

[0091] Example 3

[0092] This example provides a detection kit for detecting the repeat number of the CGG sequence of the FMR1 gene in fragile X syndrome.

[0093] The composition of the kit is as follows:

[0094]

[0095] Detection method:

[0096] (1) DNA extraction: The DNA is dissolved in 1X Low TE buffer. The DNA concentration is not less than 10 ng / μL.

[0097] (2) During each detection process, the sample is co - detected and analyzed with negative and positive control products. Configure the reaction solution according to the following PCR amplification reaction system.

[0098] PCR Amplification Reaction System

[0099] Name Input volume (μL) PCR reaction premix 40 Amplification enzyme mixture 2 DNA 50 ng Deionized water X Total volume 50 μL

[0100] (3) Perform PCR amplification according to the following reaction conditions.

[0101]

[0102] (4) Capillary electrophoresis analysis of PCR amplification products: Use ABI3130, ABI3730, ABI3500Dx, or ABISeqStudio Genetic Analyzer capillary gene analyzer for detection. Take 0.5 μL of PCR amplification product, 0.5 μL of 1200LIZ Size Standard, and 9 μL of HiDi Formamide, mix well, denature at 95 °C for 5 min, immediately place on ice for 2 min, and then perform on - machine detection.

[0103] (5) Result interpretation and analysis

[0104] The CGG repeat number can be directly obtained from the number of shadow peaks; the number of shadow peak gaps is equal to the number of AGG insertions.

[0105] Relationship between CGG repeat number and genotype:

[0106]

[0107]

[0108] AGG status:

[0109] AGG status AGG insertion Number of shadow peak gaps

[0110] Use the upstream primer and downstream primer to amplify the normal - type (24 / Y - 30 / Y) samples of the FMR1 gene. The amplified full - length fragment is about 300 bp - 350 bp. The detection results are referred to Figure 2 as shown. Lanes 2 - 1 and 2 - 2 are two repetitions. The capillary electrophoresis detection results of the normal - type (24 / Y - 30 / Y) samples of the FMR1 gene are referred to Figure 3 as shown.

[0111] In the following examples, the ABI3500Dx capillary gene analyzer is used for detection.

[0112] Example 4

[0113] The compliance rate of the positive reference product was analyzed using the kit provided in Example 3.

[0114] Detect the positive reference products P1 - P12 of the national reference product for nucleic acid detection of the FMR1 gene for fragile X syndrome, 12 positive reference products. The test results are shown in the following table:

[0115]

[0116] Samples P1 - P2, P5 - P6, P9, and P11 - 12 are all male, and the remaining samples are female.

[0117] Figure 4 are the capillary electrophoresis peak maps of samples P1 and P4; Figure 5 are the capillary electrophoresis peak maps of sample P7. Figure 6 are the capillary electrophoresis peak maps of sample P9.

[0118] The test results show that P1 and P2 are intermediate types of the FMR1 gene for fragile X syndrome, P3 - P6 are pre - mutation types of the FMR1 gene for fragile X syndrome, P7 - P10 are full - mutation types of the FMR1 gene for fragile X syndrome, P11 is a chimeric type of pre - mutation and full - mutation of the FMR1 gene for fragile X syndrome, and P12 is a chimeric type of wild and full - mutation of the FMR1 gene for fragile X syndrome. The positive compliance rate of the national reference product is 100%.

[0119] Example 5

[0120] The compliance rate of the negative reference product was analyzed using the kit provided in Example 3.

[0121] Detect the negative reference products N1 - N9 of the national reference product for nucleic acid detection of the FMR1 gene for fragile X syndrome, 9 negative reference products.

[0122] The test results of the kit are shown in the following table:

[0123]

[0124] Figure 7 are the capillary electrophoresis peak maps of samples N1 and N5; Figure 8 are the capillary electrophoresis peak maps of samples N7 and N9.

[0125] The test results show that N1 - N6 are wild - type samples of the FMR1 gene for fragile X syndrome, and N7, N8, N9 are negative samples of the FMR1 gene for fragile X syndrome; the negative compliance rate of the national reference product is 100%.

[0126] Example 6

[0127] The kit provided in Example 3 was used to analyze the minimum detection limit.

[0128] When the positive reference was diluted to 10 ng / μL, 2 μL was taken for detection. The detection results should meet the following: P1 - P2 are intermediate types of the FMR1 gene of fragile X syndrome, P3 - P6 are pre-mutation types of the FMR1 gene of fragile X syndrome, P7 - P10 are full-mutation types of the FMR1 gene of fragile X syndrome, P11 is a chimeric type of pre-mutation and full-mutation of the FMR1 gene of fragile X syndrome, and P12 is a chimeric type of wild and full-mutation of the FMR1 gene of fragile X syndrome.

[0129] The detection results are shown in the following table:

[0130]

[0131]

[0132] Figure 11 It is the capillary electrophoresis detection result diagram of samples P1 and P2 at a concentration of 10 ng / μL. Figure 12 It is the capillary electrophoresis detection result diagram of samples P5 and P6 at a concentration of 10 ng / μL.

[0133] The detection results show that the minimum detection limit of the kit is a sample DNA with a detectable DNA concentration as low as 10 ng / μL and a total amount of 20 ng.

[0134] Example 7

[0135] The repeatability of the kit provided in Example 3 was detected.

[0136] Three positive reference products, P2, P3, and P7, were each repeatedly detected 10 times. The detection results showed that P2 is an intermediate type of the FMR1 gene of fragile X syndrome; P3 is a pre-mutation type of the FMR1 gene of fragile X syndrome, and P7 is a full-mutation type of the FMR1 gene of fragile X syndrome.

[0137] Example 8

[0138] The clinical samples were detected using the kit provided in Example 3.

[0139] Test method: Four clinical samples with FMR1 gene detection results (Molecular Fragile X PCR kit (Abbott)) were collected. The CGG sequence repeat number of the FMR1 gene was detected using the kit of the present invention, and the consistency between the detection results of this kit and the clinical detection results was analyzed.

[0140] Test results: The detection results of this kit are shown in the following table, and the consistency between the detection results of the kit and the clinical detection results is 100%.

[0141]

[0142] Among them, the capillary electrophoresis analysis diagram of the normal type (CGG repeat number 24 / 30) of the FMR1 gene in sample FMS1 is referred to Figure 9 as shown. The results show that the CGG repeat number is 24 / 30, belonging to the normal type. The capillary electrophoresis analysis diagram of sample FMS2 is referred to Figure 9 as shown, belonging to the intermediate type. The capillary electrophoresis peak diagram of sample FMS3 is referred to Figure 10 as shown, belonging to the premutation, and the capillary electrophoresis peak diagram of sample FMS4 is referred to Figure 10 as shown, belonging to the full mutation.

[0143] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A nucleic acid combination for detecting the CGG sequence of the FMR1 gene, characterized in that, It includes: The first primer pair shown in SEQ ID NO: 1-2, the second primer pair shown in SEQ ID NO: 3-4, and the third primer shown in SEQ ID NO:

5.

2. The nucleic acid combination for detecting the CGG sequence of the FMR1 gene according to claim 1, wherein The 5' ends of the downstream primers of the first primer pair and the second primer pair are both labeled with a fluorescent dye; Preferably, the fluorescent dye is selected from any one of 5-FAM, 6-FAM, TAMRA, ATTO-590, PET, NED, VIC, HEX, TET, JOE, Cy3, Cy3.5, ROX, Texas Red, Cy5, Cy5.5, and Quasar670.

3. A product for detecting the CGG sequence of the FMR1 gene, characterized in that, The product is a reagent, a kit, or a chip, and the product includes the nucleic acid combination for detecting the CGG sequence of the FMR1 gene according to any one of claims 1-2.

4. The product for detecting the CGG sequence of the FMR1 gene according to claim 3, characterized in that, The reagent is selected from PCR reaction premixes, and the kit further includes an amplification enzyme, a positive control product, and a negative control product.

5. The product for detecting the CGG sequence of the FMR1 gene according to claim 4, wherein The positive control product is selected from premutation cell line DNA, full mutation cell line DNA, or intermediate cell line DNA, and the negative control product is normal cell line DNA.

6. Use of the nucleic acid combination for detecting the CGG sequence of the FMR1 gene according to any one of claims 1-2 in the preparation of a product for detecting the CGG sequence of the FMR1 gene, characterized in that, The application includes: obtaining a PCR amplification system by combining the DNA of the sample to be tested with the nucleic acid combination, then performing a PCR amplification reaction, and detecting the PCR amplification product by capillary electrophoresis or loading it onto a gene chip.

7. The application according to claim 6, wherein The PCR amplification system includes: the first primer pair with a concentration of 0.1 μM to 1.0 μM, the second primer pair with a concentration of 0.1 μM to 1.0 μM, the third primer with a concentration of 0.01 μM to 0.1 μM, dNTPs with a final concentration of 0.1 μM to 0.5 μM, 7-deaza-dGTP with a final concentration of 0.2 μM to 1.0 μM, PCR Buffer, and an amplification enzyme.

8. The application according to claim 7, characterized in that, The PCR amplification system further includes an enhancer, and the enhancer is selected from one or more of betaine, dimethyl sulfoxide, glycerol, or ethylene glycol.

9. The application according to claim 6, wherein The conditions of the PCR amplification reaction include: 94°C, 5 min; 98°C for 10 s, (63 - 1°C) / 30 s, 68°C for 2 min, cycle 10 times; 98°C for 10 s, (68 - 1°C) / 30 s, 68°C for 2 min, cycle 10 times; 98°C for 10 s, 65°C for 30 s, 68°C for 3 min, cycle 30 times; 72°C, 1 - 10 min.

10. The application according to claim 6, wherein After the capillary electrophoresis, the CGG repeat number is obtained according to the number of shadow peaks; the AGG insertion number is obtained according to the number of shadow peak gaps.