Application of SNP (Single Nucleotide Polymorphism) site of porcine EGF (Epidermal Growth Factor) gene in detecting porcine

Abstract

The invention relates to application of an SNP site of a pig EGF gene in detection of pig reproductive capacity, and belongs to the technical field of molecular biology. The invention provides an application of SNP (Single Nucleotide Polymorphism) loci of a pig EGF (Epidermal Growth Factor) gene in pig reproductive capacity detection with a non-disease diagnosis purpose. The SNP loci comprise one or more of an S7 locus, an S8 locus, an S9 locus and an S10 locus; wherein the allele of the S7 site is A / G, the allele of the S8 site is A / G, the allele of the S9 site is A / T, and the allele of the S10 site is A / G; the nucleotide sequence of the pig EGF gene is as shown in SEQ ID NO. 1. The genotypes corresponding to the sites S7, S8, S9 and S10 of the EGF gene can significantly improve the breeding traits of Duroc pig breeds, and can be used for carrying out high-reproductive-capacity Duroc pig breed hybridization combination tests and high-quality breed breeding.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology technology, and particularly to the application of SNP loci of porcine EGF genes in detecting porcine fecundity. Background Art

[0002] The reproductive traits of pigs are one of the important factors affecting the production efficiency of modern pig farming industry, which are controlled by a series of major genes or quantitative trait loci. At present, multiple major genes have been discovered, including estrogen receptor gene ( ESRα ), follicle-stimulating hormone beta subunit gene ( FSH β ), prolactin gene ( PRL ), prolactin receptor gene ( PRLR ), epidermal growth factor gene ( EGF ), nuclear receptor coactivator 1 gene ( NCOA1 ), androgen receptor gene ( AR ), etc. Due to the low heritability and late trait manifestation, it is very difficult to improve the reproductive traits of pigs by using conventional breeding techniques.

[0003] Although many candidate genes related to pig reproduction have been reported in the prior art, there are few genes with clear functions, and some genes have different or even contradictory genetic effects in different pig breeds; the reproductive traits of pigs are controlled by multiple genes, and it is difficult to make great genetic progress through the information of one or a few molecular markers, and there are also few studies on the combined effects of multiple genes.

[0004] Duroc pigs are very widely used as crossbred parent breeds in commercial pig production, and are known for their large body size, fast growth, excellent feed conversion ratio, and strong meat production performance. At present, the pig farming industry in China mainly uses Taiwan Duroc and American Duroc. Among them, Taiwan Duroc has better body fullness, higher lean meat rate, faster weight gain, and excellent body appearance; American Duroc has strong reproductive performance, strong and firm limbs, and high breeding value. However, compared with Yorkshire pigs and Landrace pigs, Duroc pigs have prominent defects in reproductive performance, such as fewer litter sizes and poor lactation performance. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of SNP loci of porcine EGF genes in detecting porcine fecundity, so as to solve the problems of poor reproductive performance, low utilization efficiency of pig breeds such as Duroc pigs, and imperfect breeding technology system for high fecundity pigs in the prior art.

[0006] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions: The present invention provides the use of porcine EGFUse of SNP sites of a gene in detecting the fecundity of pigs for non-disease diagnosis purposes, wherein the SNP sites include one or more of S7 site, S8 site, S9 site and S10 site; The S7 site is located in the pig EGF gene at position 1615, and the alleles are A / G; The S8 site is located in the pig EGF gene at position 1715, and the alleles are A / G; The S9 site is located in the pig EGF gene at position 2257, and the alleles are A / T; The S10 site is located in the pig EGF gene at position 2383, and the alleles are A / G; The pig EGF gene has a nucleotide sequence as shown in SEQ ID NO.1.

[0007] Preferably, the genotype of the S7 site is AA, AG or GG, and the fecundity of pigs with genotype GG is higher than that of pigs with genotype AA or AG; The genotype of the S8 site is AA, AG or GG, and the fecundity of pigs with genotype AA is higher than that of pigs with genotype AG or GG; The genotype of the S9 site is AA, AT or TT, and the fecundity of pigs with genotype AA is higher than that of pigs with genotype AT or TT; The genotype of the S10 site is AA, AG or GG, and the fecundity of pigs with genotype AA or GG is higher than that of pigs with genotype AG.

[0008] Preferably, the S7, S8, and S9 sites form the S7-S8-S9 linked locus; The genotype of the S7-S8-S9 linked locus is AA-GG-TT, GG-AA-AA or AG-AG-AT, and the fecundity of pigs with genotype GG-AA-AA is higher than that of pigs with genotype AA-GG-TT or AG-AG-AT.

[0009] The present invention also provides a primer pair for amplifying a nucleic acid molecule containing the SNP site of the pig EGF gene, including an upstream primer and a downstream primer; The nucleotide sequence of the upstream primer is as shown in SEQ.ID NO.18; The nucleotide sequence of the downstream primer is as shown in SEQ ID NO.19; The nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.4; The SNP site includes one or more of S7 site, S8 site, S9 site and S10 site; The S7 site is located in the pigEGF At position 1615 of the gene, the alleles are A / G; The S8 locus is located in the pig EGF At position 1715 of the gene, the alleles are A / G; The S9 locus is located in the pig EGF At position 2257 of the gene, the alleles are A / T; The S10 locus is located in the pig EGF At position 2383 of the gene, the alleles are A / G; The pig EGF The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0010] The present invention also provides the application of the primer pair in the preparation of a product for detecting the SNP locus of the pig EGF gene.

[0011] The present invention also provides a kit for detecting the SNP locus of the pig EGF gene, and the SNP locus includes one or more of the S7 locus, S8 locus, S9 locus and S10 locus; The S7 locus is located in the pig EGF At position 1615 of the gene, the alleles are A / G; The S8 locus is located in the pig EGF At position 1715 of the gene, the alleles are A / G; The S9 locus is located in the pig EGF At position 2257 of the gene, the alleles are A / T; The S10 locus is located in the pig EGF At position 2383 of the gene, the alleles are A / G; The pig EGF The nucleotide sequence of the gene is shown in SEQ ID NO.1; The kit includes the primer pair.

[0012] The present invention also provides typing primers for identifying the SNP locus of the pig EGF gene, and the SNP locus includes one or more of the S7 locus, S8 locus, S9 locus and S10 locus; The S7 locus is located in the pig EGF At position 1615 of the gene, the alleles are A / G; The S8 locus is located in the pig EGF At position 1715 of the gene, the alleles are A / G; The S9 locus is located in the pig EGF At position 2257 of the gene, the alleles are A / T; The S10 locus is located in the pigEGF At position 2383 of the gene, the alleles are A / G; The pig EGF The nucleotide sequence of the gene is as shown in SEQ ID NO.1; The nucleotide sequence of the genotyping primer for the S7 locus is as shown in SEQ.ID NO.28; The nucleotide sequence of the genotyping primer for the S8 locus is as shown in SEQ.ID NO.29; The nucleotide sequence of the genotyping primer for the S9 locus is as shown in SEQ.ID NO.30; The nucleotide sequence of the genotyping primer for the S10 locus is as shown in SEQ.ID NO.31.

[0013] The present invention also provides the application of the genotyping primer in the preparation of a product for genotyping the SNP locus of the pig EGF gene.

[0014] The present invention also provides a kit for genotyping the SNP locus of the pig EGF gene, and the SNP locus includes one or more of the S7 locus, S8 locus, S9 locus and S10 locus; The S7 locus is located at position 1615 of the pig EGF gene, and the alleles are A / G; The S8 locus is located at position 1715 of the pig EGF gene, and the alleles are A / G; The S9 locus is located at position 2257 of the pig EGF gene, and the alleles are A / T; The S10 locus is located at position 2383 of the pig EGF gene, and the alleles are A / G; The pig EGF The nucleotide sequence of the gene is as shown in SEQ ID NO.1; The kit includes the genotyping primer.

[0015] The present invention also provides the application of the kit in detecting the reproductive ability of pigs for non-disease diagnosis purposes.

[0016] The present invention also provides the application of the kit in the assisted breeding for improving the reproductive ability of pigs.

[0017] The present invention has the following technical effects and advantages: The pig EGFThe genotypes corresponding to the S7, S8, S9, and S10 loci of the gene can significantly improve the reproductive traits of Duroc pigs and can be used to establish a high-fertility breeding technology system, conduct cross-combination tests of Duroc pigs with high fertility, and breed high-quality varieties. This can not only provide ideas for solving the problem of the "introduction-degeneration-reintroduction" cycle but also, by combining the determination of growth performance, meat quality, and reproductive performance, screen out high-quality Duroc pig cross-combinations with high reproductive performance, promoting the efficient application of Duroc pigs. Description of the Drawings

[0018] Figure 1 For EGF Genotype determination results of the S1-S6 loci of the gene. In the figure, the peaks from left to right represent the S1, S3, S2, S5, S6, and S4 loci respectively. Among them, the genotype represented by A is AA-GG-AG-CC-GG-CG, the genotype represented by B is AG-AG-AG-CT-AG-CC, the genotype represented by C is AA-GG-GG-CC-GG-CC, and the genotype represented by D is AG-AG-AA-CT-AG-CG; the vertical coordinate in the figure represents the fluorescence signal intensity (RFU), and the horizontal coordinate represents the base position (bp); Figure 2 For EGF Genotype determination results of the S7, S9-S12 loci of the gene. In the figure, the peaks from left to right represent the S7, S12, S10, and S9 loci respectively. Among them, the genotype represented by A is GG-TT-AA-AA, the genotype represented by B is AA-TT-GG-TT, and the genotype represented by C is AG-TT-AG-AT; the vertical coordinate in the figure represents the fluorescence signal intensity (RFU), and the horizontal coordinate represents the base position (bp); Figure 3 For EGF Genotype determination results of the S8 locus of the gene, representing the AA, GG, and AG genotypes from left to right; the vertical coordinate in the figure represents the fluorescence signal intensity (RFU), and the horizontal coordinate represents the base position (bp); Figure 4 For EGF Linkage disequilibrium analysis results of the S1-S6 loci of the gene, where A is the D’ value, and B is the r 2 value; in the figure, S1-S6 represent SNP loci, the color of the rectangular frame represents the degree of linkage disequilibrium (LD), the darker the color, the higher the degree of linkage, and the number in the rectangular frame represents the LD value between two SNP loci; Figure 5 For EGF Linkage disequilibrium analysis results of the S7-S9 loci of the gene, where A is the D’ value, and B is the r 2Value; S7 to S9 in the figure represent SNP loci. The color of the rectangular box represents the degree of linkage disequilibrium (LD). The darker the color, the higher the degree of linkage. The number in the rectangular box represents the LD value between two SNP loci. Detailed implementation mode

[0019] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0020] Among the test animals of the present invention, 203 local pig breeds (31 Bamei pigs, 76 Shengxian Spotted pigs, 96 Jiaxing Black pigs), 322 Duroc pigs, 95 Yorkshire pigs, and 78 Landrace pigs are from the Haining Science and Technology Ranch of the Institute of Animal Husbandry and Veterinary Medicine, Zhejiang Academy of Agricultural Sciences. Duroc pigs, Yorkshire pigs, and Landrace pigs have complete records of 2,256 effective farrowing and weaning data, including 1,802 farrowing records of Duroc pigs, 296 farrowing records of Yorkshire pigs, and 158 farrowing records of Landrace pigs. Among the reagents of the present invention, Taq DNA polymerase and dNTPs are purchased from MBI Fermentas, Canada.

[0021] Example 1: Sample collection and segment amplification

[0022] (1) Sample collection: Select 10 pigs from each of the Bamei pig (BM), Shengxian Spotted pig (SXHZ), Jiaxing Black pig (JXHZ), Duroc pig (D), Yorkshire pig (Y), and Landrace pig (L). Use an ear tag pliers to collect ear samples of each pig breed, and extract the DNA of each pig breed by the phenol-chloroform method disclosed by Sambrook et al. in the literature (Sambrook J, Green MR. Molecular Cloning: A Laboratory Manual [M]. Beijing: Science Press, 1992).

[0023] (2) Primer synthesis: Based on the DNA sequence of the pig EGF gene (NCBI ID: NC010450.3, as shown in SEQ ID NO.1), design primers for amplifying EGF gene R1 - R4 segments, and entrust Shanghai Jierui Biotechnology Co., Ltd. to synthesize them. The nucleotide sequences of each primer are shown in Table 1.

[0024] Table 1 Primer sequences for amplifying EGF each segment of the gene

[0025] SEQ ID NO.1: (3) PCR amplification: Using the DNA of each pig breed obtained in step (1) as a template to amplify EGF gene segments R1 - R4. The PCR amplification system is 25 μL in volume and includes 1 μL of Taq DNA polymerase (1 U / μL), 1 μL of the DNA of each pig breed, 2.5 μL of 10× buffer (Mg 2+ free), 2 μL of 25 mmol / L Mg 2+ 2, 1 μL of 2.5 mmol / L dNTPs, 1 μL of each upstream and downstream primer, and the balance of deionized water; The PCR amplification program is: pre-denaturation at 94°C for 3 min, followed by 9 Tm-decreasing cycles (denaturation at 94°C for 30 s → annealing at 65 - 55°C for 30 s → extension at 72°C for 30 s), then 28 amplification cycles (denaturation at 94°C for 30 s → annealing at 55°C for 30 s → extension at 72°C for 50 s / kb), and finally extension at 72°C for 3 min to obtain EGF each gene segment.

[0026] Example 2: Screening and genotyping of SNP sites

[0027] (1) Screening of SNP sites: Comparing the nucleotide sequences of gene segments R1 - R4 of each pig breed obtained in Example 1 with each other, and performing SNP mutation scanning in pig breeds such as Bamei pig (BM), Shengxian Spotted pig (SXHZ), Jiaxing Black pig (JXHZ), Duroc pig (D), Yorkshire pig (Y), and Landrace pig (L), etc. 11 SNP sites were screened, and the results are shown in Table 2. EGF

[0028] Table 2 EGF Scanning results of each SNP site of the gene

[0029] EGF (2) Primer synthesis: Since EGF there are many and relatively concentrated SNP sites in the gene, S1 - S4 sites are close to each other, S5 - S6 sites are close to each other, S7 - S10 sites are close to each other. Therefore, based on the DNA sequence of the EGF gene, primers for amplifying gene nucleic acid molecules S1 - S4 and genotyping primers for each SNP site were designed. Among them, S1 nucleic acid molecule covers S1 - S4 sites, S5 nucleic acid molecule covers S5 - S6 sites, S7 nucleic acid molecule covers S7 - S10 sites, S11 nucleic acid molecule covers S11 site, and they were entrusted to Shanghai Jierui Bio-Engineering Co., Ltd. for synthesis. The nucleotide sequences of each primer are shown in Tables 3 - 4; In Table 4, the description format of the sequencing parameters is: sequencing direction + genotyping primer length + SNP site mutation type.

[0030] Table 3 Amplification EGF Primer sequences of each nucleic acid molecule of the gene

[0031] Table 4 EGF Genotyping primer sequences of each SNP locus of the gene

[0032] The nucleotide sequence of the S1 nucleic acid molecule is shown in SEQ ID NO.2.

[0033] SEQ ID NO.2: CATTCTGAGTCTTGCGTCCAGAAAACAATGGAATATTCCGCGTATCTCCCCACATGACTTCTGCTGCCCCTTAGGGTCTGTTTCTCCTATGAGGGGTCAGAGCTGCCTGACAGGCCGACTGAAATCAGAGGAGTCTTGATTTTAGCCATTTCAGAAAAGAGACCCAGTATTTGAGGAATGATGAGGATATAATTCAACATAAGAAAAGGGCTTGCCGTCGTTCCCATTCTCCATAAGGGGTGTCCGCTAGTGTGACTGTTATTTTTGTGACTATCGCTTTATCTACATTTGGACTAGCCCTTGGAACACTACCTCCGGGCCACTTAAATGAAAGCTTGTTTTCTAGAATGAAGTAAGCTGGCAGAA The nucleotide sequence of the S5 nucleic acid molecule is shown in SEQ ID NO.3.

[0034] SEQ ID NO.3: TGTTGACATTTGGTCACATCACAAGCTGAAGGTCAATTTTCTGTAGTATTCCTCGGGCGAATGATCAATGGCTCCAAGTCTGAATTATCAGCAGTGCTATTCACCGTTGATTTATGCAACATGGTTTAACTTTGTCTCCATCCTTCCAGATAGTAAAACATAGCCCGGATTCAGCAGGTACCTCGCAGACACCAGGAGCAACTCCACA The nucleotide sequence of the S7 nucleic acid molecule is shown in SEQ ID NO.4.

[0035] SEQ ID NO.4: The nucleotide sequence of the S11 nucleic acid molecule is shown in SEQ ID NO.5.

[0036] SEQ ID NO.5: TCACATCTTCTATTCAACATGGAAAAAGAAGACAATTTGGGTAGCTAACAAGCACACTGGGAAGGATATGGTTAAAATGAACCTCAATCCAGCATTTGTACCACCTGGTGGAATTAAAGTAGTGCATCCACTTGTTCAGCCCAAGGCAGAGGGTGATGCTTGGGCCTCTGATCAGAAACTCTGCAAACTGAGGAAGGGTAACTGCAGAGGCAGCATGTGTGGGCAAGAGCCAAAGTCCCAC (3) Genotyping of SNP sites: Using the DNA of each pig breed described in Example 1 as a template, amplify each nucleic acid molecule of the gene according to the PCR amplification system and procedure described in Example 1 with each primer described in Table 3. EGF Then, use each genotyping primer described in Table 4 to perform SNP site genotyping and genotype determination on each nucleic acid molecule. The results are as Figures 1 - 3 shown.

[0037] Example 3: EGF Analysis of S1 - S6 sites of the gene (1) Gene frequency analysis: Perform mutation scanning on the S1 - S6 sites of the gene in pig breeds such as Yorkshire pigs (Y), Bamei pigs (BM), Shengxian Spotted pigs (SXHZ), and Jiaxing Black pigs (JXHZ). EGF Perform χ 2 test for Hardy - Weinberg equilibrium using SAS 8.0, and perform haplotype analysis and linkage disequilibrium analysis using Shesis software. The results are as Figure 4 shown in and Tables 5 - 10.

[0038] (2) Genetic effect analysis: Select the effective farrowing and weaning data of Yorkshire pigs with at least 4 effective total number of piglets born, organize and record reproductive traits such as total number of piglets born (TNB), number of live piglets born (NBA), birth litter weight (BLW), weaning litter weight (WLW), number of weaned piglets (WN), average weaning weight (AWW), survival rate during lactation (SRS), gestation length (GL), etc. Establish a least-squares effect model for each pig breed for analysis. Use the UNIVARIATE procedure of SAS8.0 to conduct a normality compliance test on GL, use the NPARIWAY procedure of SAS8.0 to conduct a non-parametric one-way analysis of variance on GL factors that do not conform to the normal distribution, and use the GLM procedure of SAS8.0 to analyze factors such as year of farrowing, season of farrowing, parity, bloodline, etc. that affect GL. The results are shown in Tables 11 - 12; The least-squares effect model for first parity is: Y ijklm =µ+M i +Y j +S l +e ijkl ; Where: Y ijkl is the gestation length (GL), µ is the overall mean, M i is the bloodline effect, Y j is the year of farrowing effect + strain effect, S l is the season of farrowing effect, e ijkl is the residual effect (haplotype effect + residual); The least-squares effect model for multiple parities is: Y ijklm =µ+M i +Y j +P k +S l +e ijkl ; Where: Y ijkl is the gestation length (GL), µ is the overall mean, M i is the bloodline effect, Y j is the year of farrowing effect + strain effect, Pk is the parity effect, S l is the parturition season effect, e ijkl is the residual effect (haplotype effect + individual effect + residual); Among them, the parturition seasons of January, February, November, and December are regarded as season one, March, April, September, and October are regarded as season two, and May, June, July, and August are regarded as season three.

[0039] Table 5 EGF Genotype and allele frequencies of gene S1 locus

[0040] Table 6 EGF Genotype and allele frequencies of gene S2 locus

[0041] Table 7 EGF Genotype and allele frequencies of gene S3 locus

[0042] Table 8 EGF Genotype and allele frequencies of gene S4 locus

[0043] Table 9 EGF Genotype and allele frequencies of gene S5 locus

[0044] Table 10 EGF Genotype and allele frequencies of gene S6 locus

[0045] Table 11 EGF Association analysis of gene S5 locus with first-parity reproductive traits in Yorkshire pigs

[0046] Table 12 EGF Association analysis of gene S5 locus with multiparous reproductive traits in Yorkshire pigs

[0047] The results of gene frequency analysis show that there is polymorphism only at the S5 locus in Yorkshire pigs, and there is no polymorphism at the other 5 SNP loci; in indigenous pig breeds, all 6 SNP loci show rich polymorphism; the distributions of the 6 SNP loci in different pig breeds all conform to the Hardy-Weinberg equilibrium law; The allele frequencies at the S1, S3, and S6 loci are exactly the same. Linkage disequilibrium analysis shows that these three SNP loci are in a linked state (S1-S3-S6 linkage locus, D’ =1, r 2 >0.985), forming the haplotypes H1 (GAA) and H2 (AGG); among them, the Large White pig breed has the H1 haplotype; in the Bamei pig breed, the H1H2 diplotype is the most common (54.8%), and the distributions of the H1 and H2 haplotypes are quite equal; in the Shengxian Spotted pig breed, the H2H2 and H1H2 diplotypes each account for half, there is no H1H1 diplotype, and the H2 haplotype is the dominant haplotype (77.8%); in the Jiaxing Black pig breed, the H1H1 diplotype is the most common (76.1%), there is no H2H2 diplotype, and the H1 haplotype is the dominant haplotype (88%); The results of the genetic effect analysis show that in the Large White pig breed, different haplotypes or diplotypes at the S5 locus have no significant association with each reproductive trait, and there are no significant differences among the haplotypes or diplotypes; In summary, EGF The S1-S6 loci of the gene have no practical application significance for improving the reproductive traits of the Duroc pig breed.

[0048] Example 4: EGF Analysis of the S7-S9 loci of the gene (1) Gene frequency analysis: The method described in Example 3 was used to perform mutation scanning and gene frequency analysis on the S7-S9 loci of the gene in pig breeds such as Duroc pigs (D), Large White pigs (Y), Landrace pigs (L), Jiaxing Black pigs (JXHZ), Bamei pigs (BM), and Shengxian Spotted pigs (SXHZ). EGF The results are as Figure 5 shown in and Tables 13-15.

[0049] (2) Genetic effect analysis: The method described in Example 3 was used to perform genetic effect analysis on Duroc pig breeds with an effective total litter size of no less than 4. The results are shown in Tables 16-17.

[0050] Table 13 EGF Genotype and allele frequencies at the S7 locus of the gene

[0051] Table 14 EGF Genotype and allele frequencies at the S8 locus of the gene

[0052] Table 15 EGF Genotype and allele frequencies at the S9 locus of the gene

[0053] Table 16 EGFAssociation Analysis of Gene S7-S8-S9 Linkage Locus with First-parity Reproductive Traits in Duroc Pigs

[0054] Table 17 EGF Association Analysis of Gene S7-S8-S9 Linkage Locus with Multiparous Reproductive Traits in Duroc Pigs

[0055] The results of gene frequency analysis showed that at the S7 locus, allele A was the dominant allele in pig breeds such as Duroc, Yorkshire, and Landrace, while allele G was the dominant allele in pig breeds such as Shengxian Spotted Pig, Bamei Pig, and Jiaxing Black Pig; at the S8 and S9 loci, allele G was the dominant allele in pig breeds such as Duroc, Yorkshire, and Landrace, while allele A was the dominant allele in pig breeds such as Shengxian Spotted Pig, Bamei Pig, and Jiaxing Black Pig, and their distribution patterns were exactly the same; The genotype frequencies of the S7, S8, and S9 loci were completely consistent with the allele frequencies. Linkage disequilibrium analysis showed that these three loci were in a complete linkage state (S7-S8-S9 linkage locus, D’ =1, r 2 =1), forming haplotypes H1 (AGT) and H2 (GAA); the genotypes were homozygous H1H1 (AA-GG-TT), homozygous H2H2 (GG-AA-AA), and heterozygous H1H2 (AG-AG-AT); The results of genetic effect analysis showed that in first-parity Duroc pigs, different haplotypes or genotypes of the S7-S8-S9 linkage locus had no significant association with each reproductive trait, and there were no significant differences among the genotypes; in multiparous Duroc pigs, the S7-S8-S9 linkage locus showed a significant difference in the AWW trait, and the AWW trait of the homozygous H2H2 was 0.64 kg higher than that of the homozygous H1H1( P <0.05), and there were no significant differences in other reproductive traits; In summary, EGF The H2 haplotype composed of the S7-S8-S9 linkage locus of the gene was a favorable haplotype, which could improve the reproductive traits of Duroc pigs.

[0056] Example 5: EGF Analysis of the S10 Locus of the Gene (1) Gene frequency analysis: The method described in Example 3 was used to perform mutation scanning and gene frequency analysis on the S10 locus of the gene in pig breeds such as Duroc (D), Yorkshire (Y), Landrace (L), Jiaxing Black Pig (JXHZ), Bamei Pig (BM), and Shengxian Spotted Pig (SXHZ) EGF The results are shown in Table 18.

[0057] (2) Genetic effect analysis: The method described in Example 3 was used to conduct a genetic effect analysis on Duroc pigs with an effective total litter size of not less than 4. The results are shown in Tables 19 - 20.

[0058] Table 18 EGF Genotype and allele frequencies at gene S10 locus

[0059] Table 19 EGF Association analysis of gene S10 locus with the first - parity reproductive traits of Duroc pigs

[0060] Table 20 EGF Association analysis of gene S10 locus with the parity - farrowing reproductive traits of Duroc pigs

[0061] The results of allele frequency analysis showed that at the S10 locus, allele A was the dominant allele in Landrace pigs, and allele G was the dominant allele in other pig breeds; except for Duroc pigs, the distribution of the S10 locus in other pig breeds conformed to the Hardy - Weinberg equilibrium law. The results of genetic effect analysis showed that in first - parity Duroc pigs, there was a significant difference at the S10 locus in the AWW trait, and the AWW trait of the homozygous AA was 1.15 kg higher than that of the heterozygous AG ( P <0.05), and there were no significant differences in other reproductive traits; in parity - farrowing Duroc pigs, the BLW trait of the homozygous GG was 0.88 kg higher than that of the heterozygous AG ( P <0.05), and there were no significant differences in other reproductive traits. In summary, EGF The S10 locus of the gene can improve the reproductive traits of Duroc pigs.

[0062] Example 6: EGF Analysis of gene S11 locus Allele frequency analysis: The method described in Example 3 was used to conduct a mutation scan and allele frequency analysis on the S11 locus of genes in pig breeds such as Bamei pigs (BM), Shengxian Spotted pigs (SXHZ), and Jiaxing Black pigs (JXHZ). EGF The results are shown in Table 21.

[0063] Table 21 EGF Genotype and allele frequencies at gene S11 locus

[0064] The results showed that there was only allele C at the S11 locus in Jiaxing black pigs; in pig breeds such as Bamei pigs and Shengxian Spotted pigs, the distributions of allele A and allele C both conformed to the Hardy-Weinberg equilibrium law. In summary, EGF The S11 locus of the gene has no practical application significance for improving the reproductive traits of Duroc pigs.

[0065] As can be seen from the above embodiments, the present invention provides the application of SNP loci of porcine EGF genes in detecting porcine fertility. EGF The genotypes corresponding to the S7, S8, S9, and S10 loci of the gene can significantly improve the reproductive traits of Duroc pigs and can be used to conduct hybridization combination tests of Duroc pigs with high fertility and high-quality variety breeding.

[0066] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of SNP loci of porcine EGF genes in detecting porcine fecundity for non-disease diagnosis purposes, characterized in that The SNP sites include one or more of S7 site, S8 site, S9 site and S10 site; The S7 locus is located in pigs EGF at position 1615 of the gene, and the alleles are A / G; The S8 locus is located in the pig EGF gene at position 1715, and the alleles are A / G; The S9 locus is located in the pig EGF gene at position 2257, and the alleles are A / T; The S10 locus is located in the pig EGF gene at position 2383, and the alleles are A / G; The pig EGF The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that The genotype of the S7 site is AA, AG or GG, and the reproductive performance of pigs with genotype GG is higher than that of pigs with genotype AA or AG; The genotype of the S8 site is AA, AG or GG, and the reproductive performance of pigs with genotype AA is higher than that of pigs with genotype AG or GG; The genotype of the S9 site is AA, AT or TT, and the reproductive performance of pigs with genotype AA is higher than that of pigs with genotype AT or TT; The genotype of the S10 site is AA, AG or GG, and the reproductive performance of pigs with genotype AA or GG is higher than that of pigs with genotype AG.

3. A primer pair for amplifying a nucleic acid molecule of an SNP locus containing a porcine EGF gene, characterized in that It includes an upstream primer and a downstream primer; The nucleotide sequence of the upstream primer is as shown in SEQ.ID NO.18; The nucleotide sequence of the downstream primer is as shown in SEQ ID NO.19; The nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.4; The SNP sites include one or more of S7 site, S8 site, S9 site and S10 site; The S7 locus is located in the pig EGF gene at position 1615, and the alleles are A / G; The S8 locus is located in the pig EGF gene at position 1715, and the alleles are A / G; The S9 locus is located in the pig EGF gene at position 2257, and the alleles are A / T; The S10 locus is located in the pig EGF gene at position 2383, and the alleles are A / G; The pig EGF The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. Use of the primer pair according to claim 3 in the preparation of a product for detecting SNP sites of the EGF gene in pigs.

5. A kit for detecting SNP sites of genes in pigs EGF which is characterized in that The SNP sites include one or more of S7 site, S8 site, S9 site and S10 site; The S7 locus is located in pigs EGF at position 1615 of the gene, and the alleles are A / G; The S8 locus is located in the pig EGF gene at position 1715, and the alleles are A / G; The S9 locus is located in the pig EGF gene at position 2257, and the alleles are A / T; The S10 locus is located in the pig EGF gene at position 2383, and the alleles are A / G; The pig EGF The nucleotide sequence of the gene is shown in SEQ ID NO.1; The kit includes the primer pair described in claim 3.

6. SNP typing primers for identifying swine EGF genes, characterized in that The SNP sites include one or more of S7 site, S8 site, S9 site and S10 site; The S7 locus is located in the pig EGF gene at position 1615, and the alleles are A / G; The S8 locus is located in the pig EGF gene at position 1715, and the alleles are A / G; The S9 locus is located in the pig EGF gene at position 2257, and the alleles are A / T; The S10 locus is located in the pig EGF gene at position 2383, and the alleles are A / G; The pig EGF The nucleotide sequence of the gene is shown in SEQ ID NO.1; The nucleotide sequence of the genotyping primer for the S7 site is as shown in SEQ.ID NO.28; The nucleotide sequence of the genotyping primer for the S8 site is as shown in SEQ.ID NO.29; The nucleotide sequence of the genotyping primer for the S9 site is as shown in SEQ.ID NO.30; The nucleotide sequence of the genotyping primer for the S10 site is as shown in SEQ.ID NO.

31.

7. Use of the typing primer according to claim 6 in the preparation of a product for genotyping SNP sites of the EGF gene of pigs.

8. A kit for genotyping SNP sites of a EGF gene in pigs, characterized in that The SNP sites include one or more of S7 site, S8 site, S9 site and S10 site; The S7 locus is located in the pig EGF gene at position 1615, and the alleles are A / G; The S8 locus is located in the pig EGF gene at position 1715, and the alleles are A / G; The S9 locus is located in pigs EGF at the 2257th position of the gene, and the alleles are A / T; The S10 locus is located in the pig EGF gene at position 2383, and the alleles are A / G; The pig EGF The nucleotide sequence of the gene is shown in SEQ ID NO.1; The kit includes the genotyping primer described in claim 6.

9. Use of the kit according to claim 5 or 8 in detecting the reproductive performance of pigs for non-disease diagnosis purposes.

10. Use of the kit according to claim 5 or 8 in the assisted breeding for improving the reproductive performance of pigs.

Images