Application of a SNP marker locus in evaluating the waist horn width of Dabie Mountain cattle

By using SNP marker sites in Dabie Mountain cattle to evaluate the width of waist angles, the accuracy of Dabie Mountain cattle breeding was solved, the growth traits and reproductive performance were improved, and the development of the beef cattle industry was promoted.

CN120249510BActive Publication Date: 2025-08-22INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE ANHUI ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510676948.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-26
Publication Date
2025-08-22
Estimated Expiration
2045-05-26

AI Technical Summary

Technical Problem

The existing technology has not yet clarified the key genes and molecular markers of the wide waist horn of Dabie Mountain, which has led to the inability to accurately carry out efficient breeding of Dabie Mountain cattle, affecting its growth traits and reproductive performance.

Method used

The SNP marker site located at position 122442807 of chromosome 2 in the bovine reference genome ARS1.2 was used to detect GG, GA or AA genotypes, and PCR amplification and sequencing were performed using primer pairs and kits to identify the genotype to evaluate waist angle width and increase the frequency of dominant genotypes generation by generation.

Benefits of technology

Early accurate selection of the wide veins of the horn of the bullock in Dabie Mountains has been achieved, which improves growth traits and reduces the difficulty of calving, accelerates the progress of genetic improvement, and improves the economic benefits of beef cattle breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249510B_ABST
    Figure CN120249510B_ABST
Patent Text Reader

Abstract

The present invention provides an application of a SNP marker site in evaluating the waist horn width of Dabie Mountain cattle, belonging to the field of molecular marker technology. The present invention proposes for the first time that the genotype polymorphism located at position 122442807 of chromosome 2 of the cattle reference genome ARS1.2 can be used to evaluate the waist horn width of Dabie Mountain cattle, thereby realizing early and accurate selection of the waist horn width trait of Dabie Mountain cattle. By using the SNP marker site provided by the present invention to evaluate the waist horn width of Dabie Mountain cattle, individuals with GA and AA genotypes can be eliminated generation by generation, and the frequency of the dominant genotype GG of the waist horn width trait can be increased generation by generation, thereby improving the waist horn width and improving the breeding efficiency of the growth and development traits and reproductive traits of Dabie Mountain cattle.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and particularly relates to an application of a SNP marker site in evaluating the waist horn width of Dabie Mountain cattle. Background Art

[0002] Dabie Mountain cattle are a dual-purpose breed for both draft and meat production, primarily produced in the Dabie Mountains region. They are a local cattle breed in Anhui Province, listed in the National Catalogue of Livestock and Poultry Breed Resources. Primarily raised on a free-range and pastured basis, Dabie Mountain cattle boast advantages such as tolerance to roughage and high temperatures, agility, and tender meat. However, their smaller size and low slaughter rate are also significant drawbacks. Limited by traditional breeding techniques and outdated selection, the production efficiency of Dabie Mountain cattle has not been fully realized, and the efficient utilization of their germplasm resources is low.

[0003] The rapid development of high-throughput genotyping technology has increased the feasibility of genome-wide association studies (GWAS) for genetic improvement in beef cattle. GWAS are widely used to identify genetic variants (single nucleotide polymorphisms (SNPs)) associated with specific phenotypic traits and are an important tool for discovering QTLs and candidate genes associated with economically important livestock traits. A cattle's haunch width refers to the maximum horizontal width between the outer edges of the haunches, also known as the cross width. Haunch width is a key indicator in cattle body measurement and is typically measured with a ruler or calipers. Haunch width reflects the angular width of the haunch and is a key parameter for determining a cattle's body conformation. Haunch width is measured by measuring the maximum horizontal width from the outer edges of the haunches. This metric is crucial in cattle conformation and breeding, helping to assess growth and development and body conformation, and is closely related to calving difficulty. For example: a larger waist width means that the cow has a wider pelvis, which is beneficial to the delivery of the fetus during the breeding process of the cow and reduces the risk of dystocia; in the fattening process of beef cattle, the waist width is closely related to the degree of development of the cattle's hindquarters muscles. Generally, cattle with wider waist widths have more developed hindquarters muscles and produce more meat. Therefore, accurately screening Dabie Mountain cattle individuals with the genetic potential for a larger waist width is of great significance for improving the overall production performance of the Dabie Mountain cattle population. However, there is still a large gap in the research on molecular markers related to waist width in Dabie Mountain cattle. Existing technologies have not yet identified the key genes and molecular markers for the important trait of waist width in Dabie Mountain cattle, resulting in the inability to accurately carry out efficient breeding of Dabie Mountain cattle based on molecular markers. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide an application of a SNP marker site in evaluating the waist angle width of Dabie Mountain cattle, which can increase the frequency of the dominant allele from generation to generation by optimizing the dominant allele of the SNP marker site, improve the growth traits of Dabie Mountain cattle, reduce calving dystocia, accelerate the progress of genetic improvement of Dabie Mountain cattle, and improve the economic benefits of beef cattle breeding.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides an application of a SNP marker site in evaluating the waist horn width of Dabie Mountain cattle. The SNP marker site is located at the base 122442807 of chromosome 2 of the cattle reference genome ARS1.2, and has a G / A polymorphism.

[0007] Preferably, the genotype of the SNP marker site is GG, GA or AA, and the waist width value of the GG genotype is greater than the waist width value of the GA genotype and greater than the waist width value of the AA genotype.

[0008] The present invention also provides a primer pair for detecting a SNP marker site, the nucleotide sequences of the primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2, respectively; the SNP marker site is located at base position 122442807 on chromosome 2 of the bovine reference genome ARS1.2, and has a G / A polymorphism.

[0009] The present invention also provides a kit for detecting SNP marker sites, which includes the above-mentioned primer pair.

[0010] The present invention also provides the use of the primer pair or the kit in evaluating the waist horn width of Dabieshan cattle.

[0011] The present invention also provides a method for evaluating the waist horn width of Dabie Mountain cattle, comprising the following steps: using the above-mentioned primer pair or the above-mentioned kit to perform PCR amplification on the genomic DNA of the sample to be tested to obtain an amplification product; identifying the genotype of the SNP marker site in the amplification product; the waist horn width value of the GG genotype is greater than the waist horn width value of the GA genotype, and the waist horn width value of the AA genotype.

[0012] Preferably, the sample to be tested includes a blood sample; and the identification method includes sequencing.

[0013] Preferably, the PCR amplification procedure is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0014] The present invention also provides the use of any one of the following in the detection of growth and development traits, calving difficulty assessment or breeding of Dabie Mountain cattle: (1) the above-mentioned SNP marker site; (2) the above-mentioned primer pair; (3) the above-mentioned kit; (4) the above-mentioned method.

[0015] Beneficial effects of the present invention:

[0016] The present invention proposes for the first time that the genotype polymorphism located at position 122442807 of chromosome 2 in the bovine reference genome ARS1.2 can be used to assess the loin width of Dabie Mountain cattle, thereby achieving early and precise selection for the loin width trait of Dabie Mountain cattle. Using the SNP marker loci provided by the present invention to assess the loin width of Dabie Mountain cattle can eliminate individuals with the GA and AA genotypes generation by generation, and increase the frequency of the dominant genotype GG for the loin width trait generation by generation, thereby improving loin width, improving the growth traits of Dabie Mountain cattle, reducing calving dystocia, accelerating the genetic improvement progress of Dabie Mountain cattle, and improving the economic benefits of beef cattle breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the Manhattan plot of genome-wide association analysis of the loin horn width trait of Dabieshan cattle;

[0018] Figure 2 This is the QQ graph of genome-wide association analysis of the loin horn width trait of Dabieshan cattle;

[0019] Figure 3 The waist horn width of Dabie Mountain cattle corresponding to different genotypes of nucleotide 122442807 on chromosome 2, where * indicates p < 0.05 and **** indicates p < 0.0001. DETAILED DESCRIPTION

[0020] The present invention provides an application of a SNP marker site in evaluating the waist horn width of Dabie Mountain cattle. The SNP marker site is located at the base 122442807 of chromosome 2 of the cattle reference genome ARS1.2, and has a G / A polymorphism.

[0021] The SNP marker described in this paper was obtained through genome-wide association analysis of the loin horn width trait in Dabie Mountain cattle. The genotype of the SNP marker is GG, GA, or AA, with the loin horn width value associated with the GG genotype being greater than the loin horn width value associated with the GA genotype and greater than the loin horn width value associated with the AA genotype. In this case, the SNP marker is the Matrilin-1 (MATN1) gene, whose nucleotide sequence is shown in SEQ ID NO. 3 (positions 122442657-122442957). A G / A polymorphism exists at base 122442807. This study identifies the MATN1 gene as a candidate gene influencing the loin horn width trait in Dabie Mountain cattle for the first time. By further exploring the intrinsic link between the MATN1 gene and loin horn width in Dabie Mountain cattle and developing specific molecular markers associated with it, it is possible to achieve early and precise selection for the loin horn width trait in Dabie Mountain cattle.

[0022] The present invention also provides a primer pair for detecting a SNP marker site, the nucleotide sequences of the primer pair being CATCAAGTCCGTCAGAAAGGTTTCTT (SEQ ID NO. 1) and AACCAAGATCCCACATGCCATAC (SEQ ID NO. 2); the SNP marker site is located at base position 122442807 on chromosome 2 of the bovine reference genome ARS1.2, and has a G / A polymorphism.

[0023] The present invention also provides a kit for detecting SNP marker sites, which includes the above-mentioned primer pair.

[0024] The present invention also provides the use of the primer pair or the kit in evaluating the waist horn width of Dabieshan cattle.

[0025] The present invention also provides a method for evaluating the waist horn width of Dabie Mountain cattle, comprising the following steps: using the above-mentioned primer pair or the above-mentioned kit to perform PCR amplification on the genomic DNA of the sample to be tested to obtain an amplification product; identifying the genotype of the SNP marker site in the amplification product; the waist horn width value of the GG genotype is greater than the waist horn width value of the GA genotype, and the waist horn width value of the AA genotype.

[0026] In the present invention, the sample to be tested preferably includes a blood sample; the identification method preferably includes sequencing. In the present invention, the PCR amplification procedure is preferably: 94°C pre-denaturation for 5 minutes; 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute, for a total of 35 cycles; 72°C extension for 5 minutes; 4°C storage; the PCR amplification reaction system is preferably: a 10μl reaction system, 1μl of genomic cDNA, 0.6μl of upstream and downstream primers, 5μl of 2×probe mixa solution, and sterile water to make up to 10μl.

[0027] The present invention also provides the use of any one of the following in the detection of growth and development traits, calving difficulty assessment or breeding of Dabie Mountain cattle: (1) the above-mentioned SNP marker site; (2) the above-mentioned primer pair; (3) the above-mentioned kit; (4) the above-mentioned method.

[0028] By using the SNP marker sites provided by the present invention to evaluate the waist and horn width of Dabie Mountain cattle, individuals with the GA and AA genotypes can be eliminated generation by generation, and the frequency of the dominant genotype GG for the waist and horn width trait can be increased generation by generation, thereby improving the waist and horn width and improving the breeding efficiency of the growth and development traits and reproductive traits of Dabie Mountain cattle. The present invention applies SNP marker sites with significant effects to molecular breeding of beef cattle, which can effectively improve the waist and horn width trait, thereby improving the production efficiency of beef cattle and enhancing the core competitiveness of the beef cattle industry. Compared with traditional breeding methods, the technical solution of the present invention can overcome the interference of environmental factors, greatly improve the efficiency and accuracy of breeding, and provide strong technical support for the cultivation of excellent Dabie Mountain cattle breeds and industrial development.

[0029] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] In the following examples, unless otherwise specified, all methods are conventional.

[0031] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0032] Example 1

[0033] 1. Phenotypic determination:

[0034] The experimental herd consisted of 515 Dabie Mountain cattle from Wanjia Modern Agriculture Co., Ltd. in Taihu County, Anhui Province. They were uniformly reared and managed after weaning, fattened to 30 months of age, and then slaughtered in batches. Body measurements were conducted in accordance with the "GB / T 27643-2011 Technical Specification for Linear Assessment of Body Conformation of Beef Cattle," and phenotypic data for the loin width trait were collected, representing the maximum horizontal width of the outer edges of the two loins.

[0035] 2. Blood sample collection:

[0036] Blood was collected from the jugular vein of the subjects to be tested, stored in EDTA anticoagulant tubes, and placed in a -20°C refrigerator for future use.

[0037] 3. 100K chip genotyping:

[0038] The frozen blood samples were thawed at room temperature, and the whole genomic DNA of the tested individuals was extracted from the whole blood according to the standard phenol-chloroform method. The A260 / 280 and A260 / 230 ratios were detected using a Nanodrop-ND1000 spectrophotometer, and electrophoresis was performed on 1% agarose gel to detect the concentration and quality of the DNA.

[0039] DNA samples were sent to Newgene Biotech (Shanghai) Co., Ltd. for genotyping based on a 100K chip. PLINK v1.90 software was used for quality control of individual genotypes. Individuals with a detection rate below 90%, a minimum allele frequency below 5%, and a Hardy-Weinberg equilibrium significance level above 1×10 were excluded. -6 Finally, 67943 SNPs were retained.

[0040] 4. Genome-wide association analysis:

[0041] Phenotype correction was performed by considering factors such as sex, birth year, and slaughterhouse as fixed effects, and factors such as fattening days and arrival weight as covariates. Based on the loin horn width trait and genotype data of 515 Dabie Mountain cattle, a genome-wide association analysis was conducted using the GCTA software mixed linear model (MLM). -6 As the genomic significance level threshold for GWAS analysis of the loin horn width trait of Dabie Mountain cattle.

[0042] GWAS analysis results are as follows Figure 1 and Figure 2 As shown, a candidate SNP site significantly affecting the loin horn width trait of Dabie Mountain cattle exists at bp 122442807 on chromosome 2. Based on the Ensembl ARS1.2 genome annotation file, functional genes within 1 Mb upstream and downstream of the SNP site were annotated, and the candidate gene at this SNP site was identified as MATN1. Subsequent selection for this SNP site could improve the loin horn width trait in Dabie Mountain cattle and accelerate the breeding process for growth, development, and reproductive traits.

[0043] 5. Correlation analysis between different genotypes and waist width traits:

[0044] To examine the effects of different genotypes of the SNP molecular marker at position 122442807 on chromosome 2 on the waist and groin width trait, a one-way between-group analysis of variance (ANOVA) was performed using the R language ano() function on the waist and groin width trait for different genotypes at position 122442807 on chromosome 2. The results, shown in Table 1, showed significant differences in waist and groin width among individuals with different genotypes. The homozygous GG genotype had a higher waist and groin width phenotypic value than those with the GA and AA genotypes, and the GA genotype had a higher waist and groin width phenotypic value than those with the AA genotype.

[0045] Table 1. The phenotypic values ​​of waist width corresponding to different genotypes (expressed as mean ± standard deviation)

[0046]

[0047] Example 2

[0048] A method for evaluating the width of the loin angle of Dabie Mountain cattle is as follows:

[0049] Genomic DNA was extracted from bovine blood samples as follows: blood was collected from the jugular vein of each individual, stored in EDTA-anticoagulant tubes, and stored at -20°C for later use. The frozen blood samples were thawed at room temperature, and whole-genome DNA was extracted from the blood using the standard phenol-chloroform method. The A260 / 280 and A260 / 230 ratios were measured using a Nanodrop-ND1000 spectrophotometer. The A260 / A280 ratio should be greater than 1.8 (DNA), and the A260 / 230 ratio should be between 1.8 and 2.2. Electrophoresis was performed on a 1% agarose gel. The brightness and integrity of the DNA bands on the gel were used to assess DNA concentration and quality. Bright, clear DNA bands without significant tailing indicated good DNA quality and a concentration sufficient for subsequent experimental applications.

[0050] PCR amplification of genomic DNA from bovine blood samples was performed using upstream primer primer-F: 5'-CATCAAGTCCGTCAGAAAGGTTTCTT-3' and downstream primer primer-R: 5'-AACCAAGATCCCACATGCCATAC-3'. The PCR amplification procedure was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 1 min, for a total of 35 cycles; 72°C extension for 5 min; and storage at 4°C. The PCR amplification reaction system (10 μl) consisted of 1 μl of genomic cDNA, 0.6 μl of each upstream and downstream primers, 5 μl of 2× probe mix, and sterile water to make up to 10 μl to obtain the amplified product.

[0051] The amplified product was sequenced to identify the genotype of nucleotide No. 122442807 on chromosome 2; the waist width value of the G / G genotype was greater than the waist width value of the G / A genotype and greater than the waist width value of the A / A genotype.

[0052] Example 3

[0053] 80 Dabie Mountain cattle were collected from Wanjia Modern Agriculture Co., Ltd. in Taihu County, Anhui Province. They were uniformly raised and managed after weaning. 30 days after weaning, the waist horn width of the 80 Dabie Mountain cattle was evaluated and classified using the method for evaluating the waist horn width of Dabie Mountain cattle described in Example 2. The results showed that the genotype of the SNP marker site was GG for 2 cattle, GA for 29 cattle, and AA for 49 cattle. The genotypes of the SNP marker sites of the 80 Dabie Mountain cattle were marked respectively.

[0054] After fattening to 30 months of age, the cattle were slaughtered in batches. The body dimensions of the experimental cattle were measured according to the "GB / T 27643-2011 Technical Specification for Linear Assessment of Body Conformation of Beef Cattle" and the phenotypic data of the waist angle width trait were collected, that is, the horizontal maximum width of the outer edges of the two waist angles. Figure 3 As shown, the waist horn width of Dabie Mountain cattle with SNP marker site genotype GG is greater than the waist horn width of Dabie Mountain cattle with SNP marker site genotype GA, and the waist horn width of Dabie Mountain cattle with SNP marker site genotype AA, and the waist horn width phenotypic value data between each group have significant or extremely significant differences.

[0055] Example 4

[0056] The statistics are from the BGVD database http: / / animal.omics.pro / code / index.php / BosVar. The distribution of allele frequencies at position 122442807 on chromosome 2 in cattle populations from different regions is shown in Table 2. The brown color represents the reference allele Ref: T (A) and the variant allele Alt: C (G). In the European taurine (38) European common cattle population, the variant allele frequency is 0.342, indicating that 34.2% of individuals in this population carry this variant allele. In the Chinese indicine (19) southern Chinese zebu population, the variant allele frequency is 0.000, indicating that this variant allele has not been detected in this population. The allele frequency at position 122442807 on chromosome 2 varies significantly between Eurasian cattle populations, and is consistent with the phenotypic trend of smaller body size in Chinese cattle.

[0057] Table 2 Allele frequency distribution of nucleotide 122442807 on chromosome 2 in six ancestral cattle populations in the BGVD database

[0058]

[0059] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Application of a SNP marker site in evaluating the waist horn width of Dabie Mountain cattle, characterized in that: The SNP marker site is located at base 122442807 of chromosome 2 of the cattle reference genome ARS1.2, and has a G / A polymorphism.

2. The use according to claim 1, characterized in that The genotype of the SNP marker site is GG, GA or AA, and the waist width value of the GG genotype is greater than the waist width value of the GA genotype and greater than the waist width value of the AA genotype.

3. A method for evaluating the width of the loin angle of Dabie Mountain cattle, characterized in that: The method comprises the following steps: using a primer pair whose nucleotide sequences are respectively shown as SEQ ID NO.1 and SEQ ID NO.2, to perform PCR amplification on genomic DNA of a sample to be tested to obtain an amplified product; identifying the genotype of a SNP marker site in the amplified product; the waist-angle width value of the GG genotype is greater than the waist-angle width value of the GA genotype, and the waist-angle width value of the AA genotype; the SNP marker site is located at the base 122442807 of chromosome 2 of the bovine reference genome ARS1.2, and has a G / A polymorphism.

4. The method according to claim 3, characterized in that The sample to be tested includes a blood sample; the identification method includes sequencing.

5. The method according to claim 3, characterized in that The PCR amplification procedure was as follows: pre-denaturation at 94° C. for 5 min; denaturation at 94° C. for 30 s, annealing at 60° C. for 30 s, and extension at 72° C. for 1 min, for a total of 35 cycles; extension at 72° C. for 5 min; and storage at 4° C.

6. The use of any of the following in the assessment of calving difficulty due to wide loin horns in Dabie Mountain cattle, characterized in that: (1) The SNP marker site of claim 1; (2) the method according to any one of claims 3 to 5.

Citation Information

Patent Citations

  • Method for detecting milk production properties of dairy cows using APOM gene snps molecular marker and use

    WO2024098242A1