Haplotype molecular marker based on pank1 gene and application in judging ability of milk cow to balance ketone body metabolism

Abstract

The application discloses a haplotype molecular marker based on a PANK1 gene and application thereof in judging the ability of ketone body metabolism balance of a dairy cow, and belongs to the field of animal molecular breeding and auxiliary selection of metabolic traits. The haplotype molecular marker is composed of SNP1 and SNP2, the SNP1 is located at NC_037353.1:g.103497G>C, and the SNP2 is located at NC_037353.1:g.104241A>G. The haplotype combination of the SNP1 and the SNP2 from high to low in the ability of ketone body metabolism balance of the dairy cow is CG / CG, GA / CG and GA / GA in turn. The two SNPs can be used for screening the dairy cow individuals with low BHB concentration and excellent metabolic balance ability, and the application has important significance for improving the health level and production performance of a dairy cow group.

Description

Technical Field

[0001] This invention relates to the field of animal molecular breeding and metabolic trait-assisted selection, specifically to haplotype molecular markers based on the PANK1 gene and their application in determining the ability of dairy cows to maintain ketone body metabolism balance. Background Technology

[0002] Ketone body metabolism imbalance in dairy cows is a common metabolic disorder in the early stages of lactation. It is mainly caused by a negative energy balance, which leads to the mobilization of large amounts of fat and insufficient carbohydrate metabolism, resulting in elevated levels of β-hydroxybutyrate (BHB) in the blood.

[0003] Blood BHB concentration is an important biological indicator reflecting the energy metabolism status of dairy cows. High BHB levels are closely related to decreased milk production, reduced reproductive performance, and increased susceptibility to disease. Therefore, screening dairy cows with low BHB concentrations and excellent metabolic balance is of great significance for improving the health and productivity of the dairy herd.

[0004] The PANK1 (Pantothenate kinase 1) gene, located on bovine chromosome 26 (NCBI accession number: NC_037353.1), encodes the rate-limiting enzyme in the coenzyme A biosynthesis pathway, playing a crucial regulatory role in lipid metabolism, energy metabolism, and stress response. Currently, no correlation has been found between this gene and ketone body metabolism imbalance in dairy cows.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] The purpose of this invention is to conduct research on the bovine PANK1 gene, provide haplotype molecular markers based on the PANK1 gene, and their application in determining the ability of dairy cows to maintain ketone body metabolic balance, so as to provide a theoretical basis for healthy breeding of dairy cows and prevention and control of peripartum metabolic diseases.

[0007] The technical solution of this invention is described in detail below:

[0008] In a first aspect, the present invention provides a haplotype molecular marker based on the PANK1 gene, wherein the haplotype molecular marker consists of SNP1 and SNP2, wherein SNP1 is located at NC_037353.1: g.103497G>C and SNP2 is located at NC_037353.1: g.104241A>G.

[0009] Optionally or preferably, the haplotype molecular markers SNP1 and SNP2 are located at positions 677 and 1420 of the sequence shown in SEQ ID NO: 1, respectively.

[0010] Secondly, the present invention provides the application of the above-mentioned haplotype molecular markers in judging the ability of dairy cows to maintain ketone body metabolism balance. The haplotype combinations of SNP1 and SNP2 with dairy cows’ ability to maintain ketone body metabolism balance from high to low are CG / CG, GA / CG, and GA / GA.

[0011] Thirdly, the present invention provides a product for detecting the above-mentioned haplotype molecular markers, the product comprising primer pairs, the nucleotide sequences of which are shown in SEQ ID NO: 2~3.

[0012] Fourthly, the present invention provides a method for determining the level of ketone body metabolic balance in dairy cows, comprising the following steps:

[0013] (1) Extracting genomic DNA from cow blood;

[0014] (2) Design specific primers for haplotype molecular markers, use genomic DNA as a template, perform PCR reaction, and obtain the amplified product sequence;

[0015] The haplotype molecular markers consist of SNP1 and SNP2, where SNP1 is located at NC_037353.1: g.103497G>C and SNP2 is located at NC_037353.1: g.104241A>G;

[0016] (3) Sequencing determined the SNP1 and SNP2 haplotype combinations in the amplified product sequence. The haplotype combinations with high to low ketone body metabolic balance in dairy cows were CG / CG, GA / CG, and GA / GA.

[0017] Optionally or preferably, in the above method, the primer nucleotide sequence is as shown in SEQ ID NO: 2~3.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This invention involves collecting blood samples from lactating dairy cows to extract DNA, and using direct sequencing, comparing the DNA with the PANK1 gene sequence (NCBI accession number: NC_037353.1) to screen for two functional SNP sites (g.103497G>C and g.104241A>G) in exon 7. Haplotype construction and linkage disequilibrium analysis were performed using SHEsis software, revealing two main haplotypes: H1 (GA type) and H2 (CG type), with a linkage disequilibrium coefficient D' of 0.97 between the two sites, indicating high linkage. Three haplotype combinations were detected in the dairy cow population: H1H1, H1H2, and H2H2. Further analysis using SAS software revealed the association between different haplotype combinations and blood BHB concentration. The results showed that individuals with the H2H2 haplotype combination had significantly lower blood BHB concentrations than those with the H1H1 haplotype combination.P <0.05), indicating that dairy cows with this haplotype combination have better ketone body metabolic balance.

[0020] By performing the above haplotype combination detection on individual dairy cows, the ketone body metabolism balance ability of individual dairy cows can be effectively determined. A molecular marker method based on PANK1 gene haplotype combination for screening energy metabolism homeostasis traits in dairy cows can be established, providing a theoretical basis for healthy breeding of dairy cows and prevention and control of peripartum metabolic diseases. Attached Figure Description

[0021] Figure 1 The above are statistical results comparing the blood β-hydroxybutyrate concentrations of dairy cows with three haplotype combinations at two SNP sites of the PANK1 gene in the examples. Detailed Implementation

[0022] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.

[0023] Example 1: Screening and identification of SNP sites and correlation analysis with blood BHB concentration

[0024] (1) Sample collection and DNA extraction:

[0025] Peripheral blood samples were collected from 257 lactating dairy cows and preserved in EDTA anticoagulant tubes. Genomic DNA was extracted using a commercial DNA extraction kit and stored at -20°C for later use.

[0026] (2) Identification of SNP sites and genotyping:

[0027] Based on the bovine PANK1 gene sequence (NCBI accession number: NC_037353.1), amplification primers were designed as follows:

[0028] PANK1-F: AGTGGGCAGCATTCCTCAAA, SEQ ID NO: 2,

[0029] PANK1-R: TGCATAGGGCTACACTACAGC, SEQ ID NO: 3;

[0030] PCR amplification was performed to identify SNP sites in the exon regions. The sequences after PCR amplification are as follows:

[0031] AGTGGGCAGCATTCCTCAAATTATGAAAAACAGCAGGTATTGGGCCAAGGTTCAGAGATAATCATACAGAAGTTTTTCCCATTGTTGTTGTAGGGTTACTTTGGAGCTGTCGGGGCACTGTTGGAACTGTTCAAAATGCCTGATGACCAGTAGAGATGAGCCATAGACAT GGAGCAGCCCTCTGTGAGGACAGGGACGCAAGCTCTGCTGCTGGAGAGGGTGAGAGCCACGGGACGGAAGCCAAGCCATTATGGCAGATGAACCTGCTGGATTTGTACATAATTTAAAATCCTTCTTGCTGATCTTTTACTCTTGGGTTTTGAGCTTATGATTCAAAAT GGGGAATACAAGAGTTTTTTCTGTATACTGTATTTTTAAAAAAAGAAAAACATTTGTGCAACGTGGCCAAACCTACCAATTTTATGCATTGACTCTGAAAAACTGAATGATGTTTAAAGAAGGACCTGAAATGTAAGTGCTGGTTATTTTTCTTCTGGGGTTTACTGATCAGTGTGATAATTTTTAATTTCATTTAGTAATGACTCTAGAAGATTTTACCTTGACATATTTTTCATGACGTTTCATGATTTGCTGTTGGTTTCAAATGAAACTACAAATCTGGCATGTTTTACTGTGAACACTATTTTGTTTGTTTGTTTGTCTGTTTCCCTTTTTTT GGTCTTGTTTTTTCTGTTTGACTGTCTTATGGAAAAAGAGAATCCTTCCCCGTTTCTATCCTCAGATGACCCCTCCCCCACCCCTGCAACACATTCGTTCTTCAGTGTCCTTGTTCACATTAATCAAGGTGCTGACCAACTCAATACAAAGTTAAGCACGAGACCTAAAGCTCTCAAAAGTGCCCTTGAAGAGAAAACTCTGAAGAAGTGTTCATGAATTTAGTGAGTCTGGCAAAAGTTGAAAATGATTAATATATGCAATTTTGTCATCACCCTTATGAATATAAAGTGTTGCATTGAATTTCTTTTATGTTAGGTTATAATGTTACATTGAAATGTTCTCTGATTAAATGTCCTCATCCATGCAGAGCA TGTGAGTGGCAGCGAATCCTGTGCAAGATGCTGGAATTTACAGGGAAAGTCTCCCGGTAGATAACTGTTCACACTGGGATGTTTAGGAGAAGTCATGGGTTGAGGTGTCATGTAGTAACATCTGTGTTTTGTACATGTATGTACCTAGGAGCTTTGTAACAATGCATCTTAAATAATAACAAACTTTTTTATTTAAAAATATTTTAGACTGAAAACTGTATTTCAATCCCACTTTCTAAAATTTAAAAAAAAAATTATGATACTGATCTATATTTTTTTTTCTGTTTGAAAGATATCATTGGGACTGATGGGTAACTTGAAAATGAGAGCTTTGTACAAATATTGAAACATGAGATCTAATGATTCAGAACT AATTAATCTTTTGAATTGAGCATATTGTCGAAAGGGATTTTTGAAGGGCAGTACCATTGTTCCATGATGAGACTTTCCTCTTTGCCTTCTGGGCACCATTCTTAATTTCCATGTCTTCAAGTCTTGAAGAAGTTGATGTTAATGAAAGTGTTCACTTGTCTGGTTGAAATAAAGCCTGTTTCTGTTGTGA TTTGTTTTAGTGTGTATGTCATTTTCATATCTTAACCTTTATGTCCATATTATCTGCTTTTGTATCATAAAAGGAATATGTGTTATACTTTAGCTACTCTACGTTTCATAATTTGAAGCTTTCACAATAAGCTTGGTAAGGTCCAAAATCCTCTGTCTTCACTTAAAGCTGTAGTGTAGCCCTATGCA, SEQ. ID NO: 1 (underlined and bold font indicate two SNP sites).

[0032] The sequencing results were compared with the gene sequence published by NCBI, and two SNP sites were found in exon 7 of the bovine PANK1 gene: SNP1: g.103497G>C, located at position 677 of the above SEQ ID NO:1 sequence, and SNP2: g.104241A>G, located at position 420 of the above SEQ ID NO:1 sequence.

[0033] Genotyping of exon 7 SNP sites g.103497G>C and g.104241A>G was performed using direct sequencing with the primers described above.

[0034] (3) Haplotype analysis:

[0035] Haplotype construction and linkage disequilibrium analysis were performed on the two SNP loci using SHEsis software, resulting in two main haplotypes: H1 (composed of g.103497G and g.104241A, GA type) and H2 (composed of g.103497C and g.104241G, CG type). The linkage disequilibrium (D') between the two loci was 0.97, indicating high linkage. Three haplotype combinations were detected in the dairy cow population: H1H1 (GA / GA), H1H2 (GA / CG), and H2H2 (CG / CG).

[0036] (4) Association analysis between haplotype combinations and blood BHB concentration

[0037] The association between three haplotype combinations H1H1, H1H2, and H2H2 and bovine blood BHB concentration was analyzed using SAS software. The results showed that the blood BHB concentration in individuals with the H2H2 haplotype combination was significantly lower than that in individuals with the H1H1 haplotype combination. P <0.05), suggesting that the H2H2 haplotype can serve as an important molecular marker for screening dairy cows with excellent ketone body metabolic balance.

[0038] Table 1. Association analysis between different haplotype combinations of the PANK1 gene in dairy cows and blood BHB concentration.

[0039]

[0040] Note: Different letters indicate significant differences between groups. P <0.05).

[0041] Example 2: Verification of the correlation between haplotype combinations of two SNP sites and the ability of dairy cows to maintain ketone body metabolism balance

[0042] Table 2. Haplotype combinations and blood BHB concentration detection results of different dairy cows in the validation experiment.

[0043]

[0044] As shown in Table 2 above, there were significant differences in the overall BHB concentration among different haplotype combinations in the 30 dairy cow samples in the validation group.

[0045] This document uses specific examples to illustrate the inventive concept in detail. The description of the embodiments above is only for the purpose of helping to understand the core idea of ​​this application. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of this application.

Claims

1. The application of a reagent for detecting haplotype molecular markers of the PANK1 gene in the preparation of products for assessing the ability of dairy cows to maintain ketone body metabolic homeostasis, characterized in that... The haplotype molecular markers, as shown in SEQ ID NO:1, include the combination of SNP1 and SNP2. SNP1 is located at position 677 of the sequence shown in SEQ ID NO:1 and is a G / C mutation. SNP2 is located at position 1420 of the sequence shown in SEQ ID NO:1 and is an A / G mutation. The SNP1 and SNP2 haplotype combinations with the highest to lowest ketone body metabolism balance in dairy cows are CG / CG, GA / CG, and GA / GA.

2. The application according to claim 1, characterized in that, The product includes primer pairs, the nucleotide sequences of which are shown in SEQ ID NO: 2~3.

3. The application according to claim 1, characterized in that, The method for determining the level of ketone body metabolism balance in dairy cows includes the following steps: (1) Extracting genomic DNA from cow blood; (2) Design specific primers for haplotype molecular markers to prepare reagents for detecting haplotype molecular markers of the PANK1 gene. Use genomic DNA as a template to perform PCR reaction and obtain the amplified product sequence. The haplotype molecular markers, as shown in SEQ ID NO:1, include the combination of SNP1 and SNP2. SNP1 is located at position 677 of the sequence shown in SEQ ID NO:1 and is a G / C mutation. SNP2 is located at position 1420 of the sequence shown in SEQ ID NO:1 and is an A / G mutation. (3) Sequencing determined the SNP1 and SNP2 haplotype combinations in the amplified product sequence. The haplotype combinations with high to low ketone body metabolic balance in dairy cows were CG / CG, GA / CG, and GA / GA.

Images