Molecular marker for detecting self-fruity variation of Hanfu progeny and application of molecular marker

LAMP technology quickly detects self-fruit variability in apple varieties, solving the problems of time-consuming and complex operation of traditional methods, and achieving rapid screening of apple varieties with high self-fruit variability, improving orchard yield and detection efficiency.

CN120249539AInactive Publication Date: 2025-07-04CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510335408.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-20
Publication Date
2025-07-04
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

In the prior art, the apple self-incompatibility detection method is time-consuming, complicated to operate, and is not suitable for rapid field testing, affecting orchard cultivation and yield.

Method used

Using a fast visual detection method based on LAMP, specific primers were used to analyze the 23bp insertion and 18bp deletion mutation sites related to the auto-flowering nature of the ‘cold-rich’ offspring, isothermal amplification was performed through a simple thermostat, and the results were directly observed with naked eyes.

Benefits of technology

It has achieved rapid and accurate screening of apple varieties with high self-fruitness within 1 hour, which is suitable for on-site inspection, reduce manpower investment, and increase orchard production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249539A_ABST
    Figure CN120249539A_ABST
Patent Text Reader

Abstract

The invention provides a molecular marker for detecting self-fruity variation of Hanfu progeny and application of the molecular marker. According to the method, apple self-fruitfulness dominant strains can be screened through the LAMP-based rapid visual variation detection method, apple varieties with possible self-fruitfulness can be selected in advance, the method is very rapid in detection, detection results can be obtained within 1 h at most, only a simple thermostat is needed, the method is more suitable for on-site rapid detection, time, labor and labor are saved, and the method is suitable for large-scale popularization and application. And the method has very important significance in the cultivation of new self-fruity varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and specifically to a molecular marker for detecting the self-fruitfulness variation of the progeny of 'Hanfu' and its application. Background Art

[0002] Plant self-incompatibility refers to a reproductive isolation mechanism in which plants prevent self-pollination and promote cross-pollination during long-term evolution. Apples are typical gametophyte self-incompatible plants, and the main cultivated apples in production ('Red Fuji', 'Golden Delicious', 'Gala', etc.) all have obvious self-incompatibility phenomena. Pollination trees need to be configured, or pollination by bees, butterflies, etc. or artificial assisted pollination is required to ensure fruit setting or yield. In actual production, it is found that configuring pollination trees reduces the cultivable area of the orchard to a certain extent, and improper configuration seriously affects fruit setting and yield. At the same time, due to environmental conditions, the activities of insects such as bees and butterflies are greatly affected by the weather. Artificial pollination faces problems such as high costs, insufficient labor, and difficulty in popularizing pollination techniques. Therefore, in-depth research on the self-incompatibility traits of apples and the creation of varieties with strong self-pollination and fruit-setting abilities to increase the single yield of orchards and reduce labor input have become the goals of apple breeders. There are some varieties with strong self-fruitfulness in nature. For example, 'Hanfu', which is obtained by crossing 'Dongguang' as the female parent and 'Fuji' as the male parent, shows a phenotypic variation of self-fruitfulness, which provides important materials for the breeding of self-pollinating and fruit-setting apples. Traditional methods for detecting self-incompatibility are time-consuming and require waiting for flowering and fruiting, and cannot be completed at the seedling stage. Therefore, developing a rapid detection method has important value and practical significance for apple breeding and cultivation.

[0003] Loop-mediated isothermal amplification (LAMP) is a molecular diagnostic tool first invented and applied by Japanese scientist Notomi et al. in 2000. This method can achieve specific, rapid, and efficient amplification of DNA sequences under isothermal conditions. It mainly relies on 4-6 specific primers and Bst DNA polymerase with strand displacement activity for nucleic acid amplification, and can omit the DNA denaturation stage. Compared with conventional PCR detection techniques, it does not require processes such as thermal denaturation of the template, temperature cycling, electrophoresis, and ultraviolet observation, and has the advantages of high specificity, high sensitivity, short time consumption, and simple operation. At present, the LAMP technology has been successfully applied to the detection of pathogenic microorganisms, fungal detection, detection of pathogenic parasites, food safety detection, etc.

[0004] The research on the self-incompatibility trait of apples is one of the hotspots in the field of fruit trees. The research mainly focuses on the genetic mechanism, gene mapping, and molecular marker-assisted breeding of self-incompatibility traits. However, the current detection methods for self-incompatibility traits are relatively cumbersome and limited, including traditional PCR, field pollination hybridization experiments, molecular marker techniques such as SSR and SNP, or using techniques such as in vitro culture transformation of pollinated styles and AS-PCR (allele-specific polymerase chain reaction) to isolate and identify the S-RNase gene from Rosaceae fruit trees. Traditional PCR requires high operating equipment, has a long reaction time, and the experimental results cannot be observed with the naked eye, so it is not suitable for rapid field detection. Field pollination experiments take a long time, are subject to many interferences, and have low result accuracy and low detection efficiency; molecular markers require high technology, high-quality template DNA, are cumbersome to operate, and have certain risks. The LAMP loop-mediated isothermal amplification technology rapidly and efficiently amplifies DNA sequences under isothermal conditions, has good specificity and high sensitivity, and its detection results can also be directly observed with the naked eye or reflected by simple staining, which is suitable for rapid visual detection in the field and has good application prospects. Summary of the Invention

[0005] Aiming at the defects existing in the prior art, the purpose of the present invention is to provide a molecular marker for detecting the self-fruitfulness variation of 'Hanfu' offspring and its application. The present invention can screen for apple self-fruitfulness dominant lines through a method for rapidly visualizing and detecting variations based on LAMP, and can select apple varieties with possible self-fruitfulness in advance. The detection using the method of the present invention is very fast, and the detection result can be obtained in at most 1 hour, and only a simple thermostatic instrument is required, which is more suitable for on-site rapid detection, saving time, labor, and effort, and is of great significance in cultivating new varieties with self-fruitfulness.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] A set of LAMP primers for detecting self-fruitfulness-related variation sites in the 'Hanfu' population, characterized in that the primers are as shown in SEQ ID NO.1-4;

[0008] Outer primer B3: ATTGACTAAGTCACTTGAGACG (SEQ ID NO.1)

[0009] Outer primer F3: GGTCTCTGGACTATATTTTGAACTT (SEQ ID NO.2)

[0010] Inner primer BIP: AATACTGCTATCATGACAACCTGATGAGTAATGGGACCTT (SEQ ID NO.3)

[0011] Inner primer FIP: GCGTTTCATAGATTTAAGACGTTTCGTTTAATCGGTGGATGTG (SEQ ID NO.4)

[0012] The variation locus related to self - fruitfulness of 'Hanfu' is located at a 23 - bp insertion between positions 26752879 - 26752880 and an 18 - bp deletion between positions 26753058 - 26753075 on chromosome 4 of the apple genome version Malus x domestica GDDH13 Whole Genome v1.1;

[0013] The 23 - bp insertion sequence is: GTATAACGTAACTTCTAAAAAAA (SEQ ID NO.5);

[0014] The 18 - bp deletion sequence is: TATAAAACGCCTTAAATT (SEQ ID NO.6).

[0015] A method for quickly and visually screening self - fruitfulness apple varieties, characterized by comprising the following steps:

[0016] Step 1, extracting apple leaf DNA;

[0017] Step 2, using the apple leaf DNA obtained in Step 1 as a template and performing isothermal amplification with the LAMP primers described in Claim 1;

[0018] Step 3, observing the color change of the amplification system obtained in Step 2;

[0019] Step 4, judging the level of self - fruitfulness of the apple according to the color change of the amplification system.

[0020] If the color of the above - mentioned amplification system is blue, it is positive, that is, a variety with high self - fruitfulness; if it is purple, it is negative, that is, a variety with low self - fruitfulness.

[0021] An application based on the above - mentioned screening method, characterized by detecting whether there are variations at loci related to the improvement of self - fruitfulness in apple plants through the said method.

[0022] The beneficial effects of a molecular marker for detecting self - fruitfulness variations in the offspring of 'Hanfu' and its application according to the present invention are:

[0023] The present invention discovers that the structural variation molecular marker related to self-fertility is located on the nucleotide sequence of apple chromosome 4. According to the relationship between the presence of the variation and the self-fertility of the hybrid offspring of 'Hanfu', the self-fertility ability can be judged by detecting the variation situation. The superior strains can be screened by the method for rapid visual detection of variation based on LAMP, and the apple varieties with possible self-fertility can be selected in advance. The detection by the method of the present invention is very fast, and the detection result can be obtained in at most 1 hour, and only a simple thermostatic instrument is needed, which is more suitable for on-site rapid detection, saving time, labor and work, and has very important significance in the cultivation of new varieties with self-fertility. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The present invention has the following drawings:

[0025] Figure 1 It is the Manhattan plot of genome-wide association study (GWAS) on the self-fertility trait of apple for 'Hanfu' × 'Yueshuai' on the chromosome; wherein: the abscissa represents the position of the variation on the apple chromosome; the ordinate represents the -logP value.

[0026] Figure 2 It is the analysis diagram of the difference between the variation situation and the self-fertility rate of apple.

[0027] Figure 3 It is the template sequence designed for LAMP amplification according to the screened variation, and the red areas are the two relevant variations.

[0028] Figure 4 It is the color-changing negative and positive control of the system.

[0029] Figure 5 It is the result of the specificity test of the self-fertility variation method for the hybrid offspring of 'Hanfu' (Tube 1: negative control with water as the template; Tube 2: template with the offspring with high self-fertility having the above variation; Tube 3: template with the offspring with low self-fertility without the above variation).

[0030] Figure 6 It is the experimental result of Example 1.

[0031] Figure 7 It is the experimental result of Example 2.

[0032] Figure 8 It is the experimental result of Example 3. DETAILED DESCRIPTION OF THE INVENTION

[0033] The present invention will be further described in detail below with reference to the drawings.

[0034] Example 1: Detection of self-fertility of the hybrid offspring of 'Hanfu' and 'Yueshuai'.

[0035] (1) The present invention uses a hybrid population of 'Hanfu' × 'Yueshuai', which is planted in the Liaoning Institute of Pomology.

[0036] (2) Through self-pollination experiments, 29 plants with self-fruitfulness and 20 plants with non-self-fruitfulness were selected. Their leaves were collected in spring and temporarily stored in liquid nitrogen, and then taken back and stored in a -80°C refrigerator for later use.

[0037] (3) DNA was extracted using a DNA extraction kit (TIANGEN), and paired-end sequencing was performed based on the Illumina HiSeqXten sequencing platform to obtain a large number of high-quality SNPs. Using the GLM model program (TASSEL 5.2.36), a genome-wide association analysis was conducted on the self-fruitfulness trait of the population materials. The GWAS analysis results are as shown in the appendix Figure 1 As shown, in this population, there is a locus Chr04-26879899 on chromosome 4 that significantly affects the self-fruitfulness of 'Hanfu' apples. Near this locus, a structural variation locus was found, which is a 23-bp insertion between 26752879-26752880 and an 18-bp deletion between 26753058-26753075 on chromosome 4. As shown in the appendix Figure 3 As shown, the coincidence rate reaches 93.88%.

[0038] (4) LAMP detection:

[0039] Among them, there is 1 sample with a low self-fruitfulness rate (<45%), labeled as A1; 1 sample with a high self-fruitfulness rate (≥45%), labeled as B1.

[0040] (5) Detection method:

[0041]

[0042] Configure the reaction according to the above table system. The final reaction system is made up to 25 μL with pure water. The reaction conditions are 65°C for 1 h. The negative control is: adding ultrapure water equivalent to the template volume to the reaction tube. After placing the whole reaction in a thermostatic instrument or water bath for 1 h, take it out directly and observe the results with the naked eye for positive and negative.

[0043] (6) Detection results:

[0044] As shown in the appendix Figure 6 As shown, after reacting for 1 h simultaneously using this method, the reaction tube A1 of the sample without the above-mentioned variation still shows a purple negative result, while the reaction tube B1 of the sample with the variation still shows a blue positive amplification result.

[0045] Example 2: Detection of self-fruitfulness of the offspring of the 'Hanfu' × 'Yueshuai' hybrid population.

[0046] (1) Obtain the self-fertility variation available for LAMP detection as a template as in Example 1

[0047] (2) LAMP detection:

[0048] Among them, there is 1 sample with a low self-fertility rate (<45%), labeled as A2; 1 sample with a high self-fertility rate (≥45%), labeled as B2.

[0049] (3) Detection method:

[0050] Configure the reaction according to the above system, and finally make up the reaction system to 25 μL with pure water. The reaction conditions are 65 °C for 1 h. The negative control is: add ultrapure water equivalent to the volume of the template to the reaction tube. Place the whole reaction in a thermostatic instrument or water bath for 1 h, then directly take it out and observe with the naked eye to determine the positive and negative results.

[0051] (4) Detection results:

[0052] As shown in the appendix Figure 7 As shown, after reacting for 1 hour simultaneously using this method, the reaction tube A2 of the sample without the above variation is still a purple negative result, while the reaction tube B2 of the sample with the variation still shows a blue positive amplification result.

[0053] Example 3: Detection of self-fertility of the offspring of the 'Hanfu' × 'Yueshuai' hybrid population.

[0054] (1) Obtain the self-fertility variation available for LAMP detection as a template as in Example 1

[0055] (2) LAMP detection:

[0056] Among them, there is 1 sample with a low self-fertility rate (<45%), labeled as A3; 1 sample with a high self-fertility rate (≥45%), labeled as B3.

[0057] (3) Detection method:

[0058] Configure the reaction according to the above system, and finally make up the reaction system to 25 μL with pure water. The reaction conditions are 65 °C for 1 h. The negative control is: add ultrapure water equivalent to the volume of the template to the reaction tube. Place the whole reaction in a thermostatic instrument or water bath for 1 h, then directly take it out and observe with the naked eye to determine the positive and negative results.

[0059] (4) Detection results:

[0060] As shown in the appendix Figure 8 As shown, after reacting for 1 hour simultaneously using this method, the reaction tube A3 of the sample without the above variation is still a purple negative result, while the reaction tube B3 of the sample with the variation still shows a blue positive amplification result.

[0061] Each example shows that the rapid visual detection method for the variation of self-fruitfulness in the hybrid offspring of 'Hanfu' established in this study based on the LAMP technology has good accuracy.

[0062] The content not described in detail in this specification belongs to the prior art well-known to those skilled in the art.

Claims

1. A set of LAMP primers for detecting self - fruit - setting related variant loci in the 'Hanfu' population, characterized in that, The primers are as shown in SEQ ID NO.1-4; The self-pollination related variation sites of 'Hanfu' are located at the 23bp insertion between positions 26752879-26752880 and the 18bp deletion between positions 26753058-26753075 on chromosome 4 of the apple genome version Malus x domestica GDDH13 Whole Genome v1.1; The 23bp insertion sequence is: GTATAACGTAACTTCTAAAAAAA; The 18bp deletion sequence is: TATAAAACGCCTTAAATT.

2. A method for rapid visual screening of self-fruitful apple varieties, characterized in that, It includes the following steps: Step 1, extract apple leaf DNA; Step 2, using the apple leaf DNA obtained in Step 1 as a template, perform isothermal amplification using the LAMP primers described in Claim 1; Step 3, observe the color change of the amplification system obtained in Step 2; Step 4, judge the level of self-pollination of apples according to the color change of the amplification system.

3. An application of the method according to claim 2, characterized in that, Detect whether there are variations in the apple plants at the sites related to the improvement of self-pollination through the described method.

Citation Information

Patent Citations

  • SNP molecular marker for self-flowering and fruiting performance of Hanfu hybrid progeny and application

    CN110923351A

  • Apple subfamily plant S locus InDel marker and application thereof

    CN117568505A