Molecular marker of corn lodging-resistant related gene ZmLRS1, primer and application

Abstract

The invention relates to the technical field of biology, in particular to a molecular marker of a corn lodging-resistant related gene ZmLRS1, a primer and application. The nucleotide sequence of the gene ZmLRS1 is shown as SEQ ID NO.1, the molecular marker Indel-1538 is subjected to deletion mutation of the 26-37th site AACAGCAGCA GC in the SEQ ID NO.1, the molecular marker Indel-1538 is shown as a Hap1 haplotype before mutation, the nucleotide sequence of the molecular marker Indel-1538 is shown as SEQ ID NO.4, and the molecular marker Indel-1538 is high in lodging resistance; after mutation, the mutant is shown as a Hap2 haplotype, the nucleotide sequence of the mutant is shown as SE Q ID NO.5, and the mutant is shown as weak lodging resistance. The molecular marker provided by the invention can be used for screening a new lodging-resistant corn variety through nucleotide sequences of different haplotypes, and has an important application value for improving the lodging resistance of corn.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a molecular marker, primer and application of a maize lodging resistance-related gene ZmLRS1. Background Art

[0002] As one of the three major food crops, maize has developed into an important feed, industrial raw material and biomass energy crop, playing an important role in ensuring food security and promoting national economic development. With the frequent occurrence of natural disasters and the increase in planting density, lodging has become the main factor restricting the safe production of maize. For every 1% increase in the lodging rate, the yield reduction is about 108 kg / hm -2 , and the annual grain yield reduction caused by maize lodging is 5% - 35%. Lodging also causes grain mildew and reduces the quality of maize. In addition, lodging also hinders the mechanization level and increases the harvesting cost.

[0003] Therefore, exploring molecular markers of maize lodging resistance genes is of great significance for high and stable yield and mechanized harvesting of maize. Summary of the Invention

[0004] To explore molecular markers of maize lodging resistance genes, the present invention provides a molecular marker Indel-1538, primer and application of a maize lodging resistance-related gene ZmLRS1. The gene ZmLRS1 provided by the present invention has the ability to regulate the lodging resistance of maize. The developed molecular marker Indel-1538 can be used to screen new varieties and new germplasms of lodging-resistant maize, and has important application value for improving the lodging resistance of maize.

[0005] The present invention provides a molecular marker Indel-1538 of a maize lodging resistance-related gene ZmLRS1. The nucleotide sequence of the gene ZmLRS1 is shown as SEQ ID NO.1. The molecular marker Indel-1538 has a deletion mutation of "AACAGCAGCAGC" at positions 26 - 37 in SEQ ID NO.1. Before the mutation, it shows the Hap1 haplotype, and its nucleotide sequence is shown as SEQ ID NO.4, showing strong lodging resistance; after the mutation, it shows the Hap2 haplotype, and its nucleotide sequence is shown as SEQ ID NO.5, showing weak lodging resistance.

[0006] The molecular marker Indel-1538 of the lodging resistance-related gene ZmLRS1 provided by the present invention is associated with the lodging resistance ability of maize. By examining the genotype and corresponding haplotype of the maize molecular marker Indel-1538, the lodging resistance trait of maize can be determined; the Hap1 haplotype, whose nucleotide sequence is shown in SEQ ID NO.4, shows strong lodging resistance ability, and the Hap2 haplotype, whose nucleotide sequence is shown in SEQ ID NO.5, shows weak lodging resistance ability, and it can be used for the breeding of maize varieties with lodging resistance.

[0007] The present invention also provides a primer pair for amplifying the molecular marker Indel-1538, and the primer pair sequences are shown in SEQ ID NO.2 to SEQ ID NO.3.

[0008] The present invention also provides a method for identifying maize varieties with lodging resistance using the molecular marker Indel-1538 or the primer pair, which is characterized by including the following steps:

[0009] Extract the genomic DNA of the maize to be tested;

[0010] Using the maize genomic DNA as a template, perform PCR amplification with the primer pair shown in SEQ ID No.2 to SEQ ID No.3 to obtain a PCR amplification product;

[0011] When the fragment size of the PCR amplification product is 160bp and the sequence is shown in SEQ ID NO.4, it is identified as the haplotype Hap1, and the maize shows strong lodging resistance ability. When the fragment size of the PCR amplification product is 148bp and the sequence is shown in SEQ ID NO.5, it is identified as the haplotype Hap2, and the maize shows weak lodging resistance ability.

[0012] Further, the amplification of the PCR amplification includes PCR mix, DNA template, primer Indel-1538-F, primer Indel-1538-R and ddH2O.

[0013] Further, the amplification program of the PCR amplification is:

[0014] Pre-denature at 96°C for 5 min; denature at 96°C for 30 s, anneal at 58°C for 30 s, extend at 72°C for 20 s, for 36 cycles; extend at 72°C for 5 min, and terminate the reaction at 12°C for 10 min.

[0015] The present invention also provides an application of the molecular marker Indel-1538 or the primer pair in maize breeding, and uses the molecular marker Indel-1538 or the primer pair to breed maize varieties with lodging resistance.

[0016] Furthermore, the molecular marker Indel-1538 is amplified by the primer pair shown in SEQ ID No.2 to SEQ ID No.3. The nucleotide sequence of haplotype Hap1 of the molecular marker Indel-1538 is as shown in SEQ ID No.4, with a sequence length of 160bp; the nucleotide sequence of haplotype Hap2 of the molecular marker Indel-1538 is as shown in SEQ ID No.5, with a sequence length of 148bp. The lodging resistance of haplotype Hap1 is significantly higher than that of haplotype Hap2. The maize variety amplified with haplotype Hap1 is a lodging-resistant variety and can be used for later breeding.

[0017] Furthermore, the maize is a maize inbred line.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] The present invention firstly reveals that the gene ZmLRS1 is involved in regulating the lodging stress response of maize and can enhance the lodging resistance of maize. The molecular marker Indel-1538 of the maize lodging resistance-related gene ZmLRS1 provided by the present invention can be used to breed lodging-resistant maize varieties, and lodging-resistant maize varieties can be selected through the nucleotide sequences corresponding to different genotypes of the molecular marker Indel-1538.

[0020] Haplotype analysis also found that there are significant differences in lodging resistance between different haplotypes. The nucleotide sequence of haplotype Hap1 of the molecular marker Indel-1538 is as shown in SEQ ID No.4, with a sequence length of 160bp; the nucleotide sequence of haplotype Hap2 of the molecular marker Indel-1538 is as shown in SEQ ID No.5, with a sequence length of 148bp. The lodging resistance of haplotype Hap1 is significantly higher than that of haplotype Hap2. The maize variety amplified with haplotype Hap1 is a lodging-resistant variety and can be used for later breeding. The lodging resistance of Hap1 is stronger than that of Hap2. By checking the genotype and corresponding haplotype of the maize molecular marker Indel-1538, the lodging resistance trait of maize can be determined. It can be used for the breeding of lodging-resistant maize varieties. It can be used to screen new germplasms and new varieties of lodging-resistant maize, and has important application value for improving the lodging resistance of maize. Description of the Drawings

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0022] Figure 1Genome-wide association analysis of maize lodging traits; in the figure, A is the Q-Q plot; B is the Manhattan plot.

[0023] Figure 2 Candidate gene association analysis; in the figure, A is the candidate gene association analysis and LD analysis; B is the difference analysis of lodging phenotypes of different haplotypes; Note: *** represents P<0.001; R 2 represents the degree of linkage.

[0024] Figure 3 Analysis of the root projection area of different haplotypes; Note: ** represents P<0.01.

[0025] Figure 4 SDS-PAGE electrophoresis detection map of the Indel-1538 molecular marker. Specific implementation manners

[0026] The following is a detailed description of the specific implementation manners of the present invention, but it should be understood that the protection scope of the present invention is not limited by the specific implementation manners. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0027] Example 1: Genome-wide association analysis using natural population field lodging traits to obtain lodging-resistant candidate genes.

[0028] In order to find the genes controlling maize lodging, in the early stage of the present invention, 441 maize inbred lines were used as materials, and the occurrence of maize lodging was investigated using a 4-level evaluation index, and genome-wide association analysis was carried out in combination with 1.25 million SNP markers. The mixed linear model (MLM) was used to perform genome-wide association analysis on the lodging traits, and 11 QTL loci were found, which were named qLRS1.01, qLRS2.01, qLRS3.01, qLRS4.01, qLRS6.01, qLRS6.02, qLRS7.01, qLRS8.01, qLRS9.01, qLRS10.01 and qLRS10.02. One gene encoding a transcription factor was found within 50 kb upstream and downstream of the qLRS4.01 locus, and it was named ZmLRS1, as Figure 1 shown.

[0029] Example 2: Association analysis of candidate gene ZmLRS1

[0030] To determine whether the gene ZmLRS1 is associated with the lodging resistance phenotype, SNPs and Indels in the 2 kb upstream region, the gene ZmLRS1 region, and the 0.5 kb downstream region of the gene ZmLRS1 were extracted from the resequencing data in the present invention. The sequencing results were analyzed and SNPs with a minor allele frequency (MAF) < 0.05 were removed. A total of 58 valid SNPs and Indels were found. The general linear model was used to perform an association analysis of all SNP and Indel sites with natural lodging, and 29 significant SNPs and Indels were found above the threshold line (-log(p) > 4). Among them, SNP-1515, Indel-1538, SNP-1550, and Indel-1865 caused amino acid changes. The base at position 1515 changed from G to C, resulting in the amino acid changing from glutamine (Gln) to histidine (His); the deletion of AACAGCAGCAGC at position 1538 caused the deletion of four glutamines (Gln); the base at position 1550 changed from T to C, resulting in the amino acid changing from valine (Val) to alanine (Ala); the deletion of 3 bases ATG at position 1865 caused the deletion of an aspartic acid (Asp). SNP-1515 had the highest degree of association with natural lodging. Linkage disequilibrium analysis found high linkage among SNP-1515, Indel-1538, SNP-1550, and Indel-1865. Therefore, as Figure 2 shown, according to the 4 SNPs / Indels, the haplotypes can be divided into 2 haplotypes, namely haplotype 1 (Hap1) and haplotype 2 (Hap2), and the lodging resistance of Hap1 is stronger than that of Hap2. At the same time, the root projected area of different haplotypes was analyzed. As Figure 3 shown, it was found that the root area of Hap1 was significantly higher than that of Hap2, indicating that the materials of Hap1 type had larger roots and stronger lodging resistance. The above results all show that the gene ZmLRS1 has the ability to regulate the lodging resistance of maize, and the nucleotide sequence of the gene ZmLRS1 is shown in SEQ ID No.1.

[0031] SEQ ID No.1: ATGGAGAACCACCA G CTGCAGCAGC AACAGCAGCAG CC GGCCGCTCCGG TGGCCGCCGCTGCCAGCTCCCCGCAGTACCGAGGCGTGAGGCGGCGGAAGTGGGGCAAGTGGGTGTCGGAGATCCGGCAGCCCGGCACCAAGGTCCGCGTCTGGCTCGGCAGCTTCGACTCCGCCGAGGCCGCGGCCGTGGCGCACGACGTGGCCGCGCTGTGCATGCGCGGCCCGCGGGACGCGCAGCTCAACTTCCCGGGGTCCGCTGGGTGGCTGCCCCGCCCGGCCAGCACCGACCCAGCCGACATCCGCGCCGCCGCTGCTGAGGCAGCCGAGCGCGTGCGCCGTGAACCGGCGCTTGTCGGCACTGATG C CGCCGCCGAGCCCGGCAGGGGCCCTGCCAGTGCCAGCCGTCTTGACCTGGCCGTGGGAGACGAGTTTGACGACGACCTCGAGTCGCCCAGGCTGTGGACCGAGATGGCAGAGGCCATGCTGCTGGACCCACCTAAGTGGGGCCCGGATGGTAGCGACGGTTCCGAGGGCTCTGGCTCCCAGAATTGGCCCCATGGGTCCCTGTGGGATGCATGCTGA。

[0032] In the nucleotide sequence of gene ZmLRS1, the underlined positions indicate the mutation sites of SNP-1515, Indel-1538, SNP-1550, and Indel-1865. Among them, SNP-1515 is the mutation of "G" at position 15 of SEQ ID No.1 to "C"; Indel-1538 is the deletion mutation of "AACAGC AGCAGC" at positions 26-37 of SEQ ID No.1; SNP-1550 is the mutation of "T" at position 50 of SEQ ID No.1 to "C"; Indel-1865 is the deletion mutation of "ATG" at positions 362-364 of SEQ ID No.1.

[0033] Example 3: Development of Molecular Markers for Gene ZmLRS1

[0034] Primers were designed according to Indel-1538 as shown in Table 1. The upstream primer Indel-1538-F is as shown in SEQ ID No.2, and the downstream primer Indel-1538-R is as shown in SEQ ID No.3.

[0035] Table 1 Indel-1538 Molecular Marker Sequence

[0036] Number Primer Name Primer Sequence (5’-3’) SEQ ID No.2 Indel-1538-F TAGCTAGCTTCTCCTCTCAT SEQ ID No.3 Indel-1538-R CCTCGGTACTGCGGGGAGC

[0037] Based on the bands on the agarose gel electrophoresis diagram, Hap1 and Hap2 can be judged. The product length of the Hap1 haplotype is 160 bp, and the product length of the Hap2 haplotype is 148 bp. The band amplified by haplotype 1 is 12 bases larger than the band amplified by haplotype 2.

[0038] Example 4: Molecular Marker Verification

[0039] (1) Randomly select 7 maize inbred lines of haplotype 1 (Hap1) and haplotype 2 (Hap2) respectively for genomic DNA extraction; the lodging resistance of the Hap1 type is significantly higher than that of the Hap2 type of materials. The maize inbred lines of the haplotype 1 (Hap1) are: CIMBL94, CF3, IRF291, ZZ01, JI63, ZHONG69, and B73 respectively. The maize inbred lines of the haplotype 2 (Hap2) are: BGY, 04K5686, TX5, YE515, XI502, QI205, and CIMBL105 respectively, all from the laboratory of Professor Jianbing Yan of Huazhong Agricultural University.

[0040] (2) Using maize genomic DNA as a template and the nucleotide fragments shown in SEQ ID No. 2 to SEQ ID No. 3 as primers for PCR amplification to obtain PCR amplification products.

[0041] The total PCR reaction system (10 μL) is shown in Table 2:

[0042] Table 2 PCR Amplification System

[0043] Component Dosage / μL DNA 0.5 2x Magic Green Taq SuperMix 5 Indel-1538-F 0.5 Indel-1538-R 0.5 <![CDATA[ddH2O]]> 3.5

[0044] The PCR amplification program is shown in Table 3:

[0045] Table 3 PCR Amplification Program

[0046]

[0047] (3) The PCR amplification products are detected by SDS-PAGE electrophoresis to distinguish these two haplotypes, as Figure 4 shown; when the product with a fragment size of 160 bp and a sequence as shown in SEQ ID NO. 4 is amplified, it is identified as Hap1, and when the product with a fragment size of 148 bp and a sequence as shown in SEQ ID NO. 5 is amplified, it is identified as Hap2. This shows that this marker can effectively distinguish lodging-resistant materials.

[0048] SEQ ID NO.4:

[0049] TAGCTAGCTTCTCCTCTCATCATCATCCGGCCGAGCGTTACCACATTGCGGAAAAAAACGCTCACGATCGATCAGCCATGGAGAACCACCAGCTGCAGCAGCAACAGCAGCAGCCGGCCGCTCCGGTGGCCGCCGCTGCCAGCTCCCCGCAGTACCGAGG。

[0050] SEQ ID NO.5:

[0051] TAGCTAGCTTCTCCTCTCATCATCATCCGGCCGAGCGTTACCACATTGCGGAAAAAAACGCTCACGATCGATCAGCCATGGAGAACCACCAGCTGCAGCAGCCGGCCGCTCCGGTGGCCGCCGCTGCCAGCTCCCCGCAGTACCGAGG。

[0052] Table 4 Analysis of differences in lodging levels of different haplotype materials

[0053]

[0054] The above results prove that the Hap1 type of material has stronger lodging resistance. This marker can effectively distinguish lodging-resistant materials.

[0055] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they learn the basic creative concepts.

[0056] Obviously, those skilled in the art can make various changes and deformations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and deformations of the present invention fall within the scope of the claims of the present invention and its equivalent technologies, the present invention also intends to include these changes and deformations.

Claims

1. A molecular marker Indel-1538 of the maize lodging resistance-related gene ZmLRS1, characterized in that, The nucleotide sequence of the gene ZmLRS1 is shown in SEQ ID NO.

1. The molecular marker Indel-1538 has a deletion mutation of "AACAGCAGCAGC" at positions 26-37 in SEQ ID NO.

1. Before the mutation, it shows the Hap1 haplotype, and its nucleotide sequence is shown in SEQ ID NO.4, showing strong lodging resistance; after the mutation, it shows the Hap2 haplotype, and its nucleotide sequence is shown in SEQ ID NO.5, showing weak lodging resistance.

2. A primer pair for amplifying the molecular marker Indel-1538 recited in claim 1, characterized in that, The primer pair sequences are shown in SEQ ID NO.2 to SEQ ID NO.

3.

3. A method for identifying maize varieties resistant to lodging using the molecular marker Indel-1538 described in claim 1 or the primer pair described in claim 2, characterized in that, It includes the following steps: Extract the genomic DNA of the maize to be tested; Using the maize genomic DNA as a template, perform PCR amplification with the primer pair shown in SEQ ID No.2 to SEQ ID No.3 to obtain a PCR amplification product; When the fragment size of the PCR amplification product is 160bp and the sequence is shown in SEQ ID NO.4, it is identified as the Hap1 haplotype, and the maize shows strong lodging resistance. When the fragment size of the PCR amplification product is 148bp and the sequence is shown in SEQ ID NO.5, it is identified as the Hap2 haplotype, and the maize shows weak lodging resistance.

4. The method for identifying maize lodging-resistant varieties according to claim 3, characterized in that, The amplification of the PCR amplification includes PCR mix, DNA template, primer Indel-1538-F, primer Indel-1538-R, and ddH2O.

5. The method for identifying maize lodging-resistant varieties according to claim 3, characterized in that, The amplification program of the PCR amplification is: pre-denaturation at 96°C for 5 min; denaturation at 96°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 20 s, for 36 cycles; 72°C for 5 min, and termination of the reaction at 12°C for 10 min.

6. Use of the molecular marker Indel-1538 according to claim 1 or the primer pair according to claim 2 in maize breeding, characterized in that, Use the molecular marker Indel-1538 or the primer pair to breed maize varieties with lodging resistance.

7. The application according to claim 6, characterized in that, The molecular marker Indel-1538 is amplified by the primer pair shown in SEQ ID NO.2 to SEQ ID NO.

3. The nucleotide sequence of the Hap1 haplotype of the molecular marker Indel-1538 is shown in SEQ ID NO.4, with a sequence length of 160bp; the nucleotide sequence of the Hap2 haplotype of the molecular marker Indel-1538 is shown in SEQ ID NO.5, with a sequence length of 148bp. The lodging resistance of the Hap1 haplotype is significantly higher than that of the Hap2 haplotype. The maize variety amplified with the Hap1 haplotype is a lodging-resistant variety and can be used for later breeding.

8. The application according to claim 6, characterized in that, The maize is a maize inbred line.

Images