Molecular marker closely linked with weak light resistance character of tomato and application of molecular marker

By developing a molecular marker WTS-1 at 2361 bp of the tomato SlMCS1 gene, combined with KASP primer pairs and fluorescence detection, the rapid screening problem of tomato weak-light resistance traits was solved, and breeding efficiency and yield were improved.

CN120249544AActive Publication Date: 2025-07-04INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510429444.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-07
Publication Date
2025-07-04
Estimated Expiration
2045-04-07

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately screen and identify the weak light-resistant traits of tomatoes, resulting in cumbersome breeding process and low seed purity, making it difficult to cultivate efficient low-light-resistant tomato varieties.

Method used

A molecular marker WTS-1, which is closely linked to the tomato-resistant weak light trait, is located at 2361bp of the nucleotide sequence of the SlMCS1 gene. PCR amplification and fluorescence detection are performed through KASP primer pairs to distinguish between low-light-resistant and low-light-sensitive tomatoes.

Benefits of technology

It has achieved rapid and accurate screening of low-light-resistant tomatoes in the early stage, improved breeding efficiency, reduced the risk of yield reduction caused by low-light stress, and promoted the breeding and yield of new low-light-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249544A_ABST
    Figure CN120249544A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker closely linked with the weak light resistance character of tomatoes and application of the molecular marker. The molecular marker developed by the invention is closely linked with the weak light resistance character of the tomato, and is positioned at the 2361bp position of the nucleotide sequence of the tomato SlMCS1 gene, and the single nucleotide polymorphism is T / G. When the tomato genotype is TT, the tomato is a weak light resistant tomato; when the tomato genotype is GG, the tomato is a weak light sensitive tomato; when the tomato genotyping result is TG, the tomato is a common tomato, and the weak light sensitivity is between that of a weak light tolerant tomato and that of a weak light sensitive tomato. The molecular marker developed by the invention can distinguish the low-light-resistant tomato strain or variety from the low-light-sensitive tomato strain or variety, the low-light-resistant character can be accurately screened in the early stage without large-scale low-light stress experiments, the breeding process of the new low-light-resistant tomato variety can be remarkably promoted, the tomato variety with the low-light-resistant character is obtained, and the tomato variety with the low-light-resistant character is obtained. And the yield of weak-light-resistant varieties is improved under the condition of weak light.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker closely linked to the low-light tolerance trait of tomatoes and its application. Background Art

[0002] The most suitable light intensity for tomato growth and development is 600-900 μmol·m -2 ·s -1 When the light intensity is lower than 100 μmol·m -2 ·s -1 Tomatoes will be subjected to low-light stress, and low light can cause a decrease in the photosynthetic rate of tomato leaves, plant growth stagnation, thinner hypocotyls, leaf discoloration and curling, and even complete crop failure in severe cases. In view of this, cultivating low-light tolerant tomato varieties has become an effective way and an urgent need to improve the low-light tolerance production capacity of tomatoes. At present, the main method of tomato breeding is cross-breeding, but this method requires several generations of cultivation, the seed production process is cumbersome, the seed production yield is difficult to guarantee, and there is also the problem of low seed purity.

[0003] The low-light tolerance trait of tomatoes is a complex quantitative trait jointly regulated by multiple genes. So far, no molecular markers have been developed for identifying the low-light tolerance trait of tomatoes. Based on this, providing an SNP marker for detecting the low-light tolerance trait of tomatoes has become a technical problem that needs to be solved urgently by those skilled in the art. Summary of the Invention

[0004] The purpose of the present invention is to provide a molecular marker closely linked to the low-light tolerance trait of tomatoes and its application, which can quickly screen and identify the low-light tolerance trait at an early stage without large-scale low-light stress experiments, distinguish low-light tolerant tomato and low-light sensitive tomato strains or varieties, and improve the breeding efficiency of low-light tolerant tomatoes.

[0005] The present invention provides a molecular marker closely linked to the low-light tolerance trait of tomatoes. The molecular marker is the WTS-1 marker, which is located at the 2361bp of the nucleotide sequence of the tomato SlMCS1 gene, and the single nucleotide polymorphism is T / G.

[0006] Preferably, the nucleotide sequence of the tomato SlMCS1 gene is as shown in SEQ ID NO:14.

[0007] The present invention provides a DNA fragment closely linked to the low-light tolerance trait of tomatoes, which is characterized in that the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO:1 or SEQ ID NO:2;

[0008] Wherein, Y in the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is the base T / G

[0009] The present invention also provides a KASP primer pair for identifying the molecular marker or the DNA fragment described in the above technical solution, including a forward primer 1, a forward primer 2 and a reverse primer;

[0010] The forward primer 1 includes the nucleotide sequence shown in SEQ ID NO: 9; the 5' end of the nucleotide sequence shown in SEQ ID NO: 9 contains a fluorescent label 1;

[0011] The forward primer 2 includes the nucleotide sequence shown in SEQ ID NO: 10; the 5' end of the nucleotide sequence shown in SEQ ID NO: 10 contains a fluorescent label 2;

[0012] The reverse primer includes the nucleotide sequence shown in SEQ ID NO: 11;

[0013] The colors produced by the fluorescent label 1 and the fluorescent label 2 are different.

[0014] Preferably, the fluorescent label 1 is a FAM label; the fluorescent label 2 is a HEX label.

[0015] The present invention also provides a kit for identifying the molecular marker or the DNA fragment described in the above technical solution, and the kit contains the KASP primer pair described in the above technical solution.

[0016] The present invention also provides the application of the molecular marker or the DNA fragment or the KASP primer pair or the kit described in the above technical solution in one or more of the following:

[0017] (1) Identifying or assisting in identifying low-light tolerant tomato lines or varieties;

[0018] (2) Distinguishing low-light tolerant tomatoes from low-light sensitive tomato lines or varieties;

[0019] (3) Cultivating or assisting in cultivating low-light tolerant tomato plants, lines, lines or varieties;

[0020] (4) Screening or assisting in screening low-light tolerant tomato plants, lines, lines or varieties.

[0021] The present invention also provides a method for identifying low-light tolerant tomatoes, including the following steps:

[0022] Using the genomic DNA of the tomato to be identified as a template, performing PCR amplification with the KASP primer pair described in the above technical solution to obtain an amplification product;

[0023] Performing fluorescence detection on the amplification product and making a determination according to the fluorescence signal:

[0024] If only the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result of the tomato to be identified is TT, and the tomato to be identified is a low-light tolerant tomato;

[0025] If only the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result of the tomato to be identified is GG, and the tomato to be identified is a low-light sensitive tomato;

[0026] If the fluorescence signals corresponding to both the forward primer F1 and the forward primer F2 are detected simultaneously, the genotyping result of the tomato to be identified is TG, and the tomato to be identified is a common tomato, with low-light sensitivity between low-light tolerant tomatoes and low-light sensitive tomatoes.

[0027] Preferably, the PCR amplification system is calculated based on 10 μL and includes: 8 μL of 10 μmol / L SNP PrimerMix solution, 2 ng of genomic DNA, and the remaining sterile water;

[0028] In the SNP PrimerMix solution, the concentration ratio of forward primer 1, forward primer 2, and reverse primer is 1:1:1.

[0029] Preferably, the PCR amplification program is: denaturation at >91°C for 1 min, annealing at 55°C for 60 s, extension at 72°C for 1 min, for 25 - 35 cycles.

[0030] Beneficial effects:

[0031] The present invention provides a molecular marker closely linked to the low-light tolerance trait of tomatoes, located at the 2361bp of the nucleotide sequence of the tomato SlMCS1 gene, and the single nucleotide polymorphism is T / G. The molecular marker developed by the present invention is closely linked to the low-light tolerance trait of tomatoes. When the genotype of the tomato is TT, it is a low-light tolerant tomato; when the genotype of the tomato is GG, it is a low-light sensitive tomato; when the genotyping result of the tomato is TG, it is a common tomato, with low-light sensitivity between low-light tolerant tomatoes and low-light sensitive tomatoes. The molecular marker developed by the present invention can distinguish low-light tolerant tomato and low-light sensitive tomato strains or varieties, and can accurately screen the low-light tolerance trait at an early stage without large-scale low-light stress experiments, which can significantly promote the breeding process of new low-light tolerant tomato varieties, obtain tomato varieties with low-light tolerance characteristics, and improve the yield of low-light tolerant varieties under low-light conditions.

[0032] Based on the above molecular markers, the present invention develops KASP primer pairs, which can quickly and high-throughput select the low-light tolerance traits of tomatoes without large-scale low-light stress experiments. Only through simple genomic DNA extraction, PCR amplification, and KASP genotyping detection, it is possible to distinguish low-light tolerant tomatoes from low-light sensitive tomatoes. The method is simple, low-cost, high-throughput, and not easily affected by human factors, which can solve the problem that the low-light tolerance phenotype of tomato individuals cannot be predicted by phenotype in the early growth stage, and reduce the risk of tomato yield reduction or even crop failure caused by high temperature. Brief Description of the Drawings

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0034] Figure 1 It is the phenotypic identification result of the low-light tolerant tomato inbred line GC303 and the low-light sensitive tomato inbred line LA2838; among them, different lowercase letters indicate P < 0.05;

[0035] Figure 2 It is the bulked segregant analysis (BSA) of tomato low-light tolerance;

[0036] Figure 3 It is the fine mapping of the tomato low-light tolerance gene;

[0037] Figure 4 It is the screening result of variant sites; among them, ST represents low-light tolerant plants in F2, and SS represents low-light sensitive plants in F2;

[0038] Figure 5 It is the genotyping map of different tomato germplasms detected by the molecular markers in Example 2; among them, green markers represent low-light tolerant tomato germplasms with the genotype GG, gray markers represent insertion-deletion mutation types; red markers represent common tomato germplasms with the genotype GA; blue markers represent low-light sensitive tomato germplasms with the genotype AA. Detailed Embodiments

[0039] The present invention provides a molecular marker closely linked to the low-light tolerance trait of tomatoes. The molecular marker is the WTS-1 marker, which is located at the 2361bp of the nucleotide sequence of the tomato SlMCS1 gene, and the single nucleotide polymorphism is T / G.

[0040]

[0041] The present invention provides a DNA fragment closely linked to the weak light tolerance trait of tomatoes, characterized in that the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO:1 or SEQ ID NO:2; wherein, Y in the nucleotide sequences shown in SEQ ID NO:1 or SEQ ID NO:2 is the base T / G. The specific nucleotide sequence of SEQ ID NO:1 is: 5'-CACGGTTAGGTCTTTGGTGGAYTACTTCCAGAAA TAAAAGTTATTTCTGGTGATCCATTTAATTCAGATCCAGATGACCAAGAAGTAATGAGCGCTGA-3'. The specific nucleotide sequence of SEQ ID NO:2 is: 5'-TTGTGTCTTTTG CTGAATGTAATAGATCCAAAGATTGGAGGCGTGATGATTATGGGTGATAGAGGAACTGGGAAGTCCACCACGGTTAGGTCTTTGGTGGAYTACTTCCAGAAATAAAAGTTATTTCTGGTGATCCATTTAATTCAGATCCAGATGACCAAGAAGTAATGAGCGCTGAAGTCCGTGACAAATTGAGGAAGG-3'.

[0042] The molecular marker developed by the present invention is closely linked to the weak light tolerance trait of tomatoes. When the genotype of tomatoes is TT, they are weak light tolerant tomatoes; when the genotype of tomatoes is GG, they are weak light sensitive tomatoes; when the genotyping result of tomatoes is TG, they are ordinary tomatoes, and the weak light sensitivity is between weak light tolerant tomatoes and weak light sensitive tomatoes. The molecular marker developed by the present invention can distinguish weak light tolerant tomato and weak light sensitive tomato strains or varieties, and can accurately screen the weak light tolerance trait at an early stage without large-scale weak light stress experiments, which can significantly promote the breeding process of new weak light tolerant tomato varieties, obtain tomato varieties with weak light tolerance characteristics, and improve the yield of weak light tolerant varieties under weak light conditions.

[0043] The present invention also provides a KASP primer pair for identifying the molecular marker described in the above technical solution, including forward primer 1, forward primer 2 and reverse primer; the forward primer 1 includes the nucleotide sequence shown in SEQ ID NO:9; the 5' end of the nucleotide sequence shown in SEQ ID NO:9 contains fluorescent label 1; the forward primer 2 includes the nucleotide sequence shown in SEQ ID NO:10; the 5' end of the nucleotide sequence shown in SEQ ID NO:10 contains fluorescent label 2; the reverse primer includes the nucleotide sequence shown in SEQ ID NO:11; the colors produced by the fluorescent label 1 and the fluorescent label 2 are different.

[0044] As an implementation manner, the fluorescent label 1 is a FAM label. As an implementation manner, the fluorescent label 2 is a HEX label. As an implementation manner, the nucleotide sequence of the forward primer 1 is as shown in SEQ ID NO:12. As an implementation manner, the nucleotide sequence of the forward primer 2 is as shown in SEQ ID NO:13.

[0045] The present invention also provides a kit for identifying the molecular marker or the DNA fragment described in the above technical solution, and the kit contains the KASP primer pair described in the above technical solution.

[0046] As an implementation manner, the kit further includes other reagents for KASP detection, including but not limited to KASP 2x PCR Mix.

[0047] Based on the above molecular marker, the present invention develops a KASP primer pair, which can select the low light tolerance trait of tomatoes. Without large-scale low light stress experiments, only through simple genomic DNA extraction, PCR amplification, and KASP genotyping detection, the rapid and high-throughput detection of samples can be completed, distinguishing low light tolerant tomatoes from low light sensitive tomatoes, and it is truly effective for identifying low light tolerant tomatoes and can be applied to breeding and high-quality genetic improvement applied research.

[0048] In view of the advantages of the molecular marker or DNA fragment or KASP primer pair or kit provided by the present invention, the application of the molecular marker or KASP primer pair or kit in one or more of the following also belongs to the protection scope of the present invention: (1) identifying or assisting in identifying low light tolerant tomato lines or varieties; (2) distinguishing low light tolerant tomatoes from low light sensitive tomato lines or varieties; (3) cultivating or assisting in cultivating low light tolerant tomato plants, lines, lines or varieties; (4) screening or assisting in screening low light tolerant tomato plants, lines, lines or varieties.

[0049] The present invention also provides a method for identifying low light tolerant tomatoes, including the following steps:

[0050] Using the genomic DNA of the tomato to be identified as a template, performing PCR amplification with the KASP primer pair described in the above technical solution to obtain an amplification product;

[0051] Performing fluorescence detection on the amplification product and making a determination according to the fluorescence signal:

[0052] If only the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result of the tomato to be identified is TT, and the tomato to be identified is a low light tolerant tomato;

[0053] If only the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result of the tomato to be identified is GG, and the tomato to be identified is a low-light sensitive tomato;

[0054] If the fluorescence signals corresponding to the forward primer F1 and the forward primer F2 are detected simultaneously, the genotyping result of the tomato to be identified is TG, and the tomato to be identified is a common tomato, and its low-light sensitivity is between that of low-light tolerant tomatoes and low-light sensitive tomatoes.

[0055] In the present invention, the genomic DNA of the foxtail millet to be identified is used as a template, and PCR amplification is carried out using the KASP primer pair described in the above technical solution to obtain an amplification product. The present invention has no strict requirements on the method for obtaining the genomic DNA, and conventional methods in the art can be used, such as the CTAB (cetyltrimethylammonium bromide) extraction method.

[0056] As an implementation manner, the PCR amplification system is calculated based on 10 μL and includes: 8 μL of 10 μmol / L SNP Primer Mix solution, 2 ng of genomic DNA, and the remaining sterile water; the concentration ratio of the forward primer 1, the forward primer 2, and the reverse primer in the SNP Primer Mix solution is 1:1:1. As an implementation manner, the PCR amplification procedure is: denaturation at 91 °C for 1 min, annealing at 55 °C for 60 s, extension at 72 °C for 1 min, for 25 to 35 cycles.

[0057] The method provided by the present invention is simple, low-cost, high-throughput, and not easily affected by human factors, and can solve the problem that the low-light tolerance phenotype of tomato individuals cannot be predicted by phenotype in the early growth stage, reducing the risk of tomato production reduction or even complete crop failure caused by low-light stress.

[0058] To further illustrate the present invention, the following describes in detail a molecular marker closely linked to the low-light tolerance trait of tomato and its application provided by the present invention in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0059] The molecular biology experimental techniques used in the following examples, including DNA extraction, PCR amplification, PAGE gel electrophoresis, enzyme digestion, transformation and other experiments, unless otherwise specified, are usually operated according to conventional methods. Specifically, reference can be made to "Molecular Cloning: A Laboratory Manual" (Third Edition) (Sambrook J, Russell D W, Janssen K, Argentine J. Translated by Huang Peitang et al., 2002, Beijing: Science Press), or according to the conditions recommended by the manufacturer.

[0060] Example 1

[0061] Construction of genetic population and genetic analysis

[0062] 1. Test materials

[0063] The heat-tolerant and low-light-tolerant, crack-resistant fruit, and sepal-variation inbred line 'NTBM216' discovered in 2014; the inbred line 'LA-2838' for studying the fruit quality of low-light-sensitive

[0064] The above materials are disclosed in the literature: Xu Weijie, Hu Yingxue, Li Tao, et al. Morphological and Physiological Studies on Tomato Seedlings under Weak Light Conditions in an Artificial Climate Chamber [J]. Guangdong Agricultural Sciences, 2024, 51(12): 54-63.

[0065] 2. Phenotypic identification

[0066] Using 'NTBM216' as the male parent and 'LA-2838' as the female parent, an F2 population containing 400 lines was constructed, and 300 lines of F8 recombinant inbred lines (RIL) were obtained through single-seed descent. From 2021 to 2022, the low-light tolerance of 300 lines of the F8 generation was investigated in the greenhouse of the Baiyun Base of the Guangdong Academy of Agricultural Sciences. The specific steps are as follows: First, soak tomato seeds in warm water at 55°C, then germinate the tomato seeds at a constant temperature of 27°C. Sow the tomato seeds in 50-hole trays containing a substrate (the mass ratio of vermiculite to peat is 1:2) for seedling raising, and irrigate with Yamazaki's special tomato nutrient solution (containing 540 mg / L calcium ammonium nitrate (containing 25% calcium oxide and 15% total nitrogen) and 700 mg / L potassium nitrate magnesium (containing 42% potassium oxide)) every 3 days. During this period, the management of each material is the same. When the seedlings have two leaves and one heart, select 15 seedlings with consistent growth of each tomato material and transplant them into flower pots (upper diameter 18 cm, lower diameter 13 cm, width 103 cm, height 15 cm). After 1 week, transfer them into an artificial climate chamber for treatment. With a light intensity of 600 μmol·m -2 ·s -1 as the control, 100 μmol·m -2 ·s -1It was the low - light treatment. The environmental temperature was set at 28°C, the outlet air temperature was 18°C, the relative humidity was 70 - 80%, the photoperiod was 12 / 12 h. After 15 days, the phenotypes were measured to screen for low - light - tolerant tomato inbred lines and low - light - sensitive tomato inbred lines. Among them, the screening criteria for low - light - tolerant tomato inbred lines were as follows: the maximum photochemical efficiency of leaves (Fv / Fm)>0.79, the non - photochemical quenching value (NPQ)<0.20, and the quenching value of photosynthetic inhibition damage (qL)<0.62; the screening criteria for low - light - sensitive tomato inbred lines were as follows: the maximum photochemical efficiency of leaves (Fv / Fm)≤0.79, the non - photochemical quenching value (NPQ)≥0.20, and the quenching value of photosynthetic inhibition damage (qL)≥0.62. According to the above - mentioned method and criteria, in this example, the low - light - tolerant tomato inbred line 'GC303' and the low - light - sensitive tomato inbred line 'LA2838' were screened. Among them, the detection results of 'GC303' and 'LA2838' are as Figure 1 shown in Table 1. Subsequently, 'GC303' and 'LA2838' were used as experimental materials to carry out research on the morphology and physiology of seedlings under low - light treatment conditions.

[0067] Table 1 Results of phenotypic investigation of tomato inbred lines (n = 20)

[0068] Phenotype GC303 LA2838 Maximum photochemical efficiency of leaves (Fv / Fm) 0.81 0.64 Non-photochemical quenching value (NPQ) 0.13 0.23 Quenching value of photosynthetic inhibition damage (qL) 0.57 0.69

[0069] 3. Genetic analysis

[0070] Using 'GC303' as the male parent and 'LA2838' as the female parent, F1 was obtained by hybridization, and an F2 population was obtained by self - crossing F1. In the F2 population, the low - light - tolerant phenotypes were investigated in the same way as in step 2. The eigenvectors were calculated by principal component analysis and the comprehensive evaluation value of the tomato F2 population was obtained. The results showed that the phenotypes such as fruit size and leaf dry weight of low - light - tolerant plants increased significantly. Further investigation of the traits of the segregating population showed that the F2 population showed a ratio of low - light - sensitive (218 plants): low - light - tolerant (82 plants) of 3:2 (R 2 = 0.8711), indicating that the low - light - tolerant trait of the low - light - tolerant tomato inbred line 'GC303' was controlled by a pair of recessive genes.

[0071] Example 2

[0072] 1. Mapping of tomato low - light - tolerant genes

[0073] (1) Establishment of low - light - tolerant DNA pool and low - light - sensitive DNA pool

[0074] Using ‘GC303’ as the male parent and ‘LA2838’ as the female parent, F1 was obtained by hybridization, and an F2 population was obtained by self-crossing of F1. 436 plants of the F2 population were planted in the greenhouse, with 1 plant per hole, and transplanted into flower pots (upper diameter 18 cm, lower diameter 13 cm, width 103 cm, height 15 cm) when they had two leaves and one heart. After 1 week, they were then transferred to an artificial climate chamber for treatment. With a light intensity of 600 μmol·m -2 ·s -1 as the control, 100 μmol·m -2 ·s -1 was used for low-light treatment. The environmental temperature was set at 28 °C, the outlet air temperature was 18 °C, the relative humidity was 70 - 80%, the photoperiod was 12 / 12 h. After 15 days, the phenotypes were measured, and 50 extremely low-light tolerant plants (denoted as ST) and 50 low-light sensitive plants (denoted as SS) were selected. The DNA of each single plant was extracted by the conventional CTAB method, the DNA concentration was detected by Thermo nanodrop 2000, and the DNA purity and integrity were detected by 1% agarose electrophoresis. After passing the detection, the DNA of 50 low-light tolerant single plants and 50 low-light sensitive single plants was mixed equally to form a low-light tolerant DNA pool and a low-light sensitive DNA pool with a final concentration of 40 ng / μL.

[0075] (2) Locating resistance genes by BSA combined with RNA-seq analysis method

[0076] By combining BSA-Seq and GBTS genotyping, the regulatory gene was located on chromosome 10, and a candidate interval of 17 kb in size was screened. A total of 11 candidate genes were identified in this interval. Through gene annotation and transcriptome analysis, a candidate gene MCS1 encoding a magnesium subfamily protein of gene chelase was identified. See Figure 2 and Figure 3 for details; among them, Figure 2 the black line in it represents the SNP index map, the red line represents the probability value of 99% confidence level (P < 0.01), the blue box represents the target genomic region controlling leaf color, the abscissa represents the chromosome position, the ordinate represents the ED value, and the larger the ED value, the stronger the correlation; Figure 3 in it, A is the development of SNP molecular markers in the low-light tolerant interval of the tomato QTL interval; B is the heat map of the expression levels of genes in the candidate interval in the low-light tolerant tomato inbred line ‘GC303’ and the low-light sensitive tomato inbred line ‘LA2838’.

[0077] (3) Development of SNP locus variations

[0078] Through reduced-representation genome sequencing, further analysis found that a non-synonymous SNP mutation occurred at the 2361 bp position in the coding region of the MCS1 gene on chromosome 10 of the tomato genome, the nucleotide changed from G to A, and lysine mutated into arginine ( Figure 4 ).

[0079] 2. Molecular marker amplification

[0080] Using the shade-tolerant DNA pool and shade-sensitive DNA pool as templates respectively, PCR amplification was carried out with the upstream primer (5'-CACGGTTAGGTCTTTGGTGGA-3', SEQ ID NO:3) and the downstream primer (5'-TACTTCCAGAAATAAAAGTTATTTCTGG-3', SEQ ID NO:4). After obtaining the molecular marker amplification products, polyacrylamide gel electrophoresis (PAGE) was performed. Among them, the PCR amplification system was calculated based on 10 μL, including: 8 μL of 10 μmol / L SNP PrimerMix solution, 2 ng of genomic DNA, and the remaining sterile water. The concentration ratio of the upstream primer to the downstream primer in the SNP PrimerMix solution was 1:1. The PCR amplification procedure was as follows: Denaturation: First, the reaction mixture containing the DNA sample to be amplified was placed in a high-temperature (>91°C) environment and heated for 1 minute to denature the double-stranded DNA. Annealing: Then the reaction temperature was lowered (about 55°C) to allow the oligonucleotide primers to anneal to the two single-stranded template DNAs. Extension: The temperature of the reaction mixture was raised to about 72°C and incubated for 1 minute. Under the action of DNA polymerase, deoxynucleoside triphosphates were added to the 3'-end of the primer and extended along the template molecule in the 5'→3' direction to synthesize a new DNA complementary strand. Cycle: Repeat the above denaturation, annealing, and extension steps, usually for 25 - 35 cycles.

[0081] 3. Recovery, cloning and sequencing

[0082] (1) Cut the molecular marker amplification fragment from the polyacrylamide gel, place it in a centrifuge tube, crush it with a pipette tip, rinse it three times with ultrapure water, then add 10 μL of ultrapure water and incubate in a 95°C water bath for 15 min, and quickly centrifuge to take the supernatant.

[0083] (2) Using the recovered supernatant as a template, PCR amplification was carried out with the upstream primer (SEQ ID NO: 3) and the downstream primer (SEQ ID NO: 4); the reaction system for 50 μL of PCR amplification was: 5 μL of the recovered supernatant (containing DNA), 5 μL of 10× Taq DNA polymerase buffer, 3 μL of 25 mM MgCl2, 1.2 μL of the upstream primer (10 μM), 1.2 μL of the downstream primer (10 μM), 4 μL of 2.5 mM dNTP, 0.4 μL of 5 U / μL Taq enzyme, and ddH2O was added to make up to 50 μL; the PCR amplification program was: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, for 30 cycles; final extension at 72 °C for 5 min. 20 μL of each PCR product was taken and separated by 2% agarose gel electrophoresis. The target fragment was cut off under an ultraviolet light instrument and placed into a 1.5 mL centrifuge tube. The DNA was recovered according to the instructions of the DNA Gel Extraction Kit (Beijing Quanshijin Company). The recovered PCR product was ligated with the pMD19-T Simple vector (Takara Company) and transformed into Escherichia coli DH5α competent cells by heat shock method. White colonies containing recombinants were selected from the LB plates coated with Amp (100 μg·mL -1 ), X-gal (20 μg·mL -1 ), and IPTG ((40 μg·mL -1 ). Using RV-M (5'-GAGCGGATAACAATTTCACACAGG-3', SEQ ID NO: 5) and M13-47 (5'-CGCCAGGGTTTTCCCAGTCACGAC-3', SEQ ID NO: 6) as primers, PCR amplification was carried out, and the PCR products were detected by 1.2% agarose gel electrophoresis to verify positive clones; among them, the 25 μL PCR reaction system was 2.5 μL of 10× Taq DNA polymerase buffer, 1.5 μL of 25 mM MgCl2, 0.5 μL each of the primers RV-M (10 μM) and M13-47 (10 μM), 2 μL of 2.5 mM dNTP, 0.2 μL of 5 U / μL Taq enzyme, with a single colony of Escherichia coli as the template, and ddH2O was added to make up to 25 μL; the PCR reaction conditions were: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min, for 30 cycles; final extension at 72 °C for 5 min.

[0084] (3) Pick positive clones and send them to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results show that the nucleotide sequence of the molecular marker corresponding to the weak light-tolerant DNA pool is as shown in SEQ ID NO:7, specifically: 5'-TTGTGTCTTTTGCTGAATGTAATAGATCCAAAGATTGGAGGCGTGATGATTATGGGTGATAGAGGAACTGGGAAGTCCACCACGGTTAGGTCTTTGGTGGATTACTTCCAGAAATAAAAGTTATTTCTGGTGATCCATTTAATTCAGATCCAGATGACCAAGAAGTAATGAGCGCTGAAGTCCGTGACAAATTGAGGAAGG-3';

[0085] The nucleotide sequence of the molecular marker corresponding to the weak light-sensitive DNA pool is as shown in SEQ ID NO:8, specifically: 5'-TTGTGTCTTTTGCTGAATGTAATAGATCCAAAGATTGGAGGCGTGATGATTATGGGTGATAGAGGAACTGGGAAGTCCACCACGGTTAGGTCTTTGGTGGAGTACTTCCAGAAATAAAAGTTATTTCTGGTGATCCATTTAATTCAGATCCAGATGACCAAGAAGTAATGAGCGCTGAAGTCCGTGACAAATTGAGGAAGG-3'.

[0086] 4. Development of KASP molecular marker primers

[0087] According to the SNP site variation sites recorded in step 1 and the sequencing results in step 3, and in accordance with the KASP design principle, Zhongyu Jinbiaoqi (Beijing) Biotechnology Co., Ltd. (http: / / www.cgmb.com.cn / index.php / Home / Index / ke_suc_case_xiangqing?id=45) was commissioned to design KASP primers. Two forward primers, WTS-1-F1 and WTS-1-F2, and a reverse primer, WTS-1-R, were designed, and their nucleotide sequences are as follows:

[0088] WTS-1-F1: 5'-CACGGTTAGGTCTTTGGTGGAT-3', SEQ ID NO:9;

[0089] WTS-1-F2: 5'-CACGGTTAGGTCTTTGGTGGAG-3', SEQ ID NO:10;

[0090] WTS-1-R: 5'-TCAGCGCTCATTACTTCTTGGTC-3', SEQ ID NO:11;

[0091] At the 5' end of the WTS-1-F1 primer, a FAM fluorescent linker sequence was ligated, and at the 5'-end of the WTS-1-F2 primer, a HEX fluorescent linker sequence was ligated to obtain forward primer 1 and forward primer 2. The primer sequences after ligation of the fluorescent linkers are as follows:

[0092] Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCT CACGGTTAGGTCTTTGG TGGAT-3' (SEQ ID NO:12, where the underlined part is the FAM fluorescent tag sequence);

[0093] Forward primer 2: 5'- GAAGGTGAAACGGATCATGCT CACGGTTAGGTCTTTGG TGGG-3' (SEQ ID NO:13, where the underlined part is the HEX fluorescent tag sequence);

[0094] The above forward primer 1, forward primer 2 and the universal reverse primer WTS-1-R were used as the KASP primer pair for molecular marker detection

[0095] Example 3

[0096] Genotyping and identification of low light tolerance in tomatoes

[0097] 1. Using the existing tomato variety (published in Xu Weijie, Gong C, Mai PT, Li ZX, Sun BJ & Li T. (2024). Genetic diversity and population structure analysis of 418 tomato cultivars based on single nucleotide polymorphism markers [J]. Frontiers in Plant Science, 2024, 11: 484. (IF: 6.627; Biology, Q2)) as the experimental material, first soak the seeds in warm water at 55 °C, then germinate the tomato seeds at a constant temperature of 27 °C. Sow the tomato seeds in a 50-hole plug tray containing a substrate (the mass ratio of vermiculite to peat is 1:2) for seedling raising, and irrigate with the special nutrient solution for tomatoes developed by Yamazaki (purchased from Qiyue (Shanghai) Biotechnology Co., Ltd.) every 3 days. During this period, the management of each material is the same. When the seedlings have two true leaves and one heart leaf, transplant them into flower pots (upper diameter 18 cm, lower diameter 13 cm, width 103 cm, height 15 cm). After 1 week, transfer them into an artificial climate chamber, set the environmental temperature at 28 °C, the outlet air temperature at 18 °C, the relative humidity at 70 - 80%, and the photoperiod at 12 / 12 h for cultivation. After 15 days, measure the phenotypes, extract the DNA of each individual plant by the conventional CTAB method, detect the DNA concentration with Thermo nanodrop 2000, and detect the DNA purity and integrity by 1% agarose gel electrophoresis. After passing the detection, use it as a template for subsequent determination.

[0098] 2. Using the genomic DNA in step 1 as a template respectively, perform PCR amplification with the KASP primer pairs obtained in Example 2 to obtain amplification products; among them,

[0099] The PCR amplification system is calculated based on 10 μL and includes: 8 μL of 10 μmol / L SNP PrimerMix solution, 2 ng of genomic DNA, and the remaining sterile water; the concentration ratio of forward primer 1, forward primer 2, and reverse primer in the SNP PrimerMix solution is 1:1:1;

[0100] The procedure of the PCR amplification is as follows: Denaturation: First, place the reaction mixture containing the DNA sample to be amplified in a high-temperature environment (>91°C) and heat it for 1 minute to denature the double-stranded DNA; Annealing: Then lower the reaction temperature (about 55°C) to allow the oligonucleotide primers to anneal with the two single-stranded template DNAs; Extension: Raise the temperature of the reaction mixture to about 72°C and incubate for 1 minute. Under the action of DNA polymerase, deoxynucleoside triphosphates are added to the 3'-end of the primer and extended along the template molecule in the 5'→3' direction to synthesize a new complementary DNA strand; Cycle: Repeat the above denaturation, annealing, and extension steps, usually for 25 to 35 cycles.

[0101] 3. After the amplification is completed, KASP detection is carried out. According to the relative fluorescence values, the samples are typed, classified, and statistically analyzed. The results are as Figure 5 shown, and the detailed genotyping results of some varieties are shown in Table 2.

[0102] Table 2 Genotyping results of some varieties

[0103]

[0104]

[0105] According to Table 2 and Figure 5 it can be seen that if only the fluorescence signal corresponding to the forward primer 1 connected with the fluorescent linker sequence is detected in the PCR product of the sample, the genotype of the detection site is TT, and it is determined as a single plant tolerant to low light; if only the fluorescence signal corresponding to the forward primer 2 connected with the fluorescent linker sequence is detected in the PCR product of the sample, the genotype of the detection site is GG, and it is determined as a single plant sensitive to low light; if the fluorescence signals corresponding to the forward primer 1 and the forward primer 2 connected with the fluorescent linker sequence are detected in the PCR product of the sample, the genotype of the detection site is TG, and it is determined as a normal single plant, and the low-light sensitivity is between that of low-light-tolerant tomatoes and low-light-sensitive tomatoes.

[0106] It can be seen from the above content that the technical solution provided by the present invention can distinguish low-light-tolerant tomato and low-light-sensitive tomato strains or varieties without large-scale low-light stress experiments, accurately screen low-light-tolerant tomatoes at an early stage, promote the breeding process of new low-light-tolerant tomato varieties, obtain tomato varieties with low-light tolerance characteristics, and increase the yield of low-light-tolerant varieties under low-light conditions.

[0107] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A molecular marker closely linked to the low light tolerance trait of tomatoes, characterized in that, The molecular marker is the WTS-1 marker, which is located at the 2361bp of the nucleotide sequence of the tomato SlMCS1 gene, and the single nucleotide polymorphism is T / G.

2. The molecular marker according to claim 1, wherein The nucleotide sequence of the tomato SlMCS1 gene is shown in SEQ ID NO:

14.

3. A DNA fragment closely linked to the low light tolerance trait of tomatoes, characterized in that, The nucleotide sequence of the DNA fragment is shown in SEQ ID NO:1 or SEQ ID NO:2; Wherein, Y in the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is the base T / G.

4. A KASP primer pair for identifying the molecular marker according to claim 1 or 2 or the DNA fragment according to claim 3, characterized in that, It includes forward primer 1, forward primer 2 and reverse primer; The forward primer 1 includes the nucleotide sequence shown in SEQ ID NO:9; the 5' end of the nucleotide sequence shown in SEQ ID NO:9 contains fluorescent label 1; The forward primer 2 includes the nucleotide sequence shown in SEQ ID NO:10; the 5' end of the nucleotide sequence shown in SEQ ID NO:10 contains fluorescent label 2; The reverse primer includes the nucleotide sequence shown in SEQ ID NO:11; The colors produced by the fluorescent label 1 and the fluorescent label 2 are different.

5. The KASP primer pair according to claim 4, characterized in that, The fluorescent label 1 is the FAM label; the fluorescent label 2 is the HEX label.

6. A kit for identifying the molecular marker according to claim 1 or 2 or the DNA fragment according to claim 3, characterized in that, The kit contains the KASP primer pair according to claim 4 or 5.

7. Use of the molecular marker according to claim 1 or 2, or the DNA fragment according to claim 3, or the KASP primer pair according to claim 4 or 5, or the kit according to claim 6 in one or more of the following: (1) Identifying or assisting in identifying low-light tolerant tomato lines or varieties; (2) Distinguishing low-light tolerant tomatoes from low-light sensitive tomato lines or varieties; (3) Cultivating or assisting in cultivating low-light tolerant tomato plants, lines, lines or varieties; (4) Screening or assisting in screening low-light tolerant tomato plants, lines, lines or varieties.

8. A method for identifying low-light tolerant tomatoes, characterized in that, It includes the following steps: Using the genomic DNA of the tomato to be identified as a template, performing PCR amplification with the KASP primer pair according to claim 4 or 5 to obtain an amplification product; Performing fluorescence detection on the amplification product and making a determination according to the fluorescence signal: If only the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result of the tomato to be identified is TT, and the tomato to be identified is a low-light tolerant tomato; If only the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result of the tomato to be identified is GG, and the tomato to be identified is a low-light sensitive tomato; If the fluorescence signals corresponding to the forward primer F1 and the forward primer F2 are detected simultaneously, the genotyping result of the tomato to be identified is TG, and the tomato to be identified is a common tomato, and the low-light sensitivity is between that of the low-light tolerant tomato and the low-light sensitive tomato.

9. The method according to claim 8, wherein The system of the PCR amplification is calculated based on 10 μL and includes: 8 μL of 10 μmol / L SNPPrimerMix solution, 2 ng of genomic DNA and the remaining sterile water; In the SNP PrimerMix solution, the concentration ratio of the forward primer 1, the forward primer 2 and the reverse primer is 1:1:

1.

10. The method according to claim 9, characterized in that The procedure for PCR amplification is as follows: denaturation at >91°C for 1 min, annealing at 55°C for 60 s, extension at 72°C for 1 min, with 25 - 35 cycles.

Citation Information

Patent Citations

  • Method for identifying anti-late blight character of tomato and used molecular marker and primer thereof

    CN105087802A

  • Method for increasing tomato fruit yield and tomato fruit lycopene content under weak light condition

    CN115991756A

  • KASP molecular marker closely linked with width of tomato fruit and application of KASP molecular marker

    CN117683938A

  • Tomato SlHXK1 gene and application thereof in improving weak light tolerance of tomato seedlings

    CN119639778A

  • Method for promoting the growth of tomato under low light condition

    TWI856897B