Zmwox9b gene mutation detection primer and application thereof in screening corn inbred lines with strong somatic cell regeneration ability

By designing primers for detecting ZmWOX9B gene mutations and CRISPR/Cas9 gene editing vectors, the problem of insufficient somatic cell regeneration capacity of maize inbred lines was solved, enabling rapid screening of high-frequency regenerated inbred lines, saving resources and accelerating the breeding process.

CN120249546BActive Publication Date: 2026-04-24JILIN AGRI SCI & TECH COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JILIN AGRI SCI & TECH COLLEGE
Filing Date
2025-04-14
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

In existing technologies, the somatic cell regeneration capacity of maize inbred lines depends on core genes that have not been fully explored, which makes maize gene editing or transgenic improvement difficult, prolongs the breeding cycle, and may introduce redundant genes, thus reducing its application value.

Method used

Primers for detecting ZmWOX9B gene mutations were designed. By amplifying and comparing the target region of the ZmWOX9B gene in maize inbred lines, frameshift mutations or large-fragment base insertions and deletions were screened to determine somatic cell regeneration capacity. In combination with CRISPR/Cas9 gene editing vectors to knock out the ZmWOX9B gene, inbred lines with high-frequency somatic cell regeneration were screened.

Benefits of technology

This technology enables rapid screening of maize inbred lines with strong somatic cell regeneration capabilities at the gene level, avoiding the cumbersome tissue culture process and resource waste, significantly saving costs, and promoting the progress of maize bio-breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249546B_ABST
    Figure CN120249546B_ABST
Patent Text Reader

Abstract

The application discloses a ZmWOX9B gene mutation detection primer and application thereof in screening corn inbred lines with strong somatic cell regeneration capacity, and belongs to the technical field of corn biological breeding. The ZmWOX9B gene mutation detection primer comprises a forward primer shown in SEQ ID NO. 4 and a reverse primer shown in SEQ ID NO. 5. The ZmWOX9B gene mutation detection primer is a specific primer designed according to double target points of the nucleotide sequence of the ZmWOX9B gene, and the sequence of the double target points is shown in SEQ ID NO. 2 and SEQ ID NO. 3. The method provided by the application can directly and quickly predict the somatic cell regeneration capacity of a core inbred line from a gene level, and has important practical significance in accelerating breeding of excellent inbred line receptors with excellent comprehensive traits and being applicable to genetic transformation and promoting the research and development process of corn biological breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of maize biobreeding technology, and in particular to a ZmWOX9B gene mutation detection primer and its application in screening maize inbred lines with strong somatic cell regeneration ability. Background Technology

[0002] The genotype dependence of somatic cell regeneration in maize inbred lines is essentially due to the presence of core endogenous genes that determine somatic cell regeneration. However, such genes are rarely reported, becoming a bottleneck factor restricting the improvement of maize through gene editing or transgenic technologies. Since Green and Philips first used maize embryonic embryos to induce callus and obtain regenerated plants in 1975, extensive practice has shown that embryogenic callus induction is difficult for most maize materials, resulting in almost no somatic cell regeneration and making them unsuitable as direct recipients of exogenous genes. Therefore, for many years, domestic genetic transformation of maize has been limited to a few inbred lines with unsatisfactory agronomical traits. If these materials are transformed for production, they must undergo multiple generations of backcrossing, which not only prolongs the breeding cycle but also often introduces redundant genes, greatly reducing their application value.

[0003] Therefore, it is urgent to discover the genes and molecular markers that control maize somatic cell regeneration and to analyze the molecular network that determines maize cell fate. This is crucial for promoting molecular breeding of high-frequency somatic cell regeneration inbred lines and ultimately breaking the genotypic limitations of transforming recalcitrant maize. Summary of the Invention

[0004] The purpose of this invention is to provide a ZmWOX9B gene mutation detection primer and its application in screening maize inbred lines with strong somatic cell regeneration capacity, thereby addressing the problems existing in the prior art. The method provided by this invention can directly and rapidly predict the somatic cell regeneration capacity of core inbred lines at the gene level.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] Technical Solution 1: A primer for detecting ZmWOX9B gene mutation, wherein the primer for detecting ZmWOX9B gene mutation includes the forward primer shown in SEQ ID NO.4 and the reverse primer shown in SEQ ID NO.5.

[0007] Furthermore, the ZmWOX9B gene mutation detection primers are specific primers designed with dual targets based on the nucleotide sequence of the ZmWOX9B gene; the sequences of the dual targets are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0008] Furthermore, the nucleotide sequence of the ZmWOX9B gene is shown in SEQ ID NO.1.

[0009] Technical Solution 2: Application of the ZmWOX9B gene mutation detection primer described above in screening maize inbred lines with strong somatic cell regeneration ability.

[0010] Technical Solution 3: A method for screening maize inbred lines with strong somatic cell regeneration ability, comprising the following steps:

[0011] Using the aforementioned ZmWOX9B gene mutation detection primers, the target region of the ZmWOX9B gene in the maize inbred line to be tested was amplified; the amplified product was compared with the wild-type ZmWOX9B gene sequence. If a frameshift mutation or a large-fragment base insertion or deletion exists in the target region, the inbred line is determined to have poor somatic cell regeneration ability; the nucleotide sequence of the ZmWOX9B gene is shown in SEQ ID NO.1.

[0012] The three homozygous mutants exemplified in the embodiments of this invention, namely the deletion of bases 43 or 58 or the insertion of TG, merely describe the fact that this frameshift mutation leads to a decrease in somatic cell regeneration capacity. Therefore, the embodiments protected by this invention are not limited to frameshift mutations caused by the deletion of bases 43 or 58 or the insertion of TG.

[0013] Furthermore, the frameshift mutation includes a deletion mutation or an insertion mutation between target 1 and target 2; the sequence of target 1 is shown in SEQ ID NO.2; the sequence of target 2 is shown in SEQ ID NO.3.

[0014] Furthermore, the somatic cell regeneration capacity was determined by evaluating four somatic cell regeneration traits: embryogenic callus induction rate, greening callus rate, green seedling redifferentiation rate, and the average number of green seedlings differentiated from each immature embryo.

[0015] Technical Solution 4: A CRISPR / Cas9 gene editing vector containing an sgRNA sequence targeting the ZmWOX9B gene, wherein the sgRNA sequence includes SEQ ID NO.2 or SEQ ID NO.3.

[0016] Technical Solution 5: The application of the ZmWOX9B gene mutation detection primer or the CRISPR / Cas9 gene editing vector in maize transgenic breeding.

[0017] The present invention discloses the following technical effects:

[0018] Compared with existing technologies, this invention utilizes specific primers to amplify the target region of the maize ZmWOX9B gene. If the amplified nucleic acid sequence shows corresponding frameshift mutations or large-fragment base insertions / deletions compared to the wild-type control, it is inferred that the somatic cell regeneration capacity of this inbred line is poor and cannot be used as a direct recipient of maize transgenic materials. The method provided by this invention can directly and rapidly predict the somatic cell regeneration capacity of core inbred lines at the gene level. Compared with tissue culture of each material to identify somatic cell regeneration traits, this method not only avoids the heavy manpower and financial investment in the experimental process, but also overcomes the technical bottleneck of maize embryo extraction being constrained by its growth cycle, significantly saving various resource costs.

[0019] This invention utilizes gene editing technology to knock out the ZmWOX9B gene in the somatic cell high-frequency regeneration maize inbred line KN5585. By analyzing the somatic cell regeneration traits of the resulting mutant and its wild type, the aim is to ultimately clarify the function of the homeobox gene ZmWOX9B in the restoration of maize somatic cell totipotency and identify molecular markers that can be used to screen for somatic cell high-frequency regeneration. The practical application of this invention has significant practical implications for accelerating the selection of superior inbred lines with excellent comprehensive traits that can be used for genetic transformation, and for promoting the research and development of maize biobreeding. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 The nucleic acid sequence alignment results of wild-type inbred line KN5585 and its mutants Zmwox9b-1, Zmwox9b-2 and Zmwox9b-3 at the ZmWOX9B gene editing target site;

[0022] Figure 2 Phenotypic comparison of Zmwox9b homozygous mutant and its wild type after four weeks of callus induction culture: where a is the wild-type control; b is the Zmwox9b homozygous mutant;

[0023] Figure 3 The phenotypes of the Zmwox9b homozygous mutant and its wild-type at two weeks of embryonic callus redifferentiation are compared; where a is the wild-type control and b is the Zmwox9b homozygous mutant.

[0024] Figure 4 This study describes the dynamic developmental process of embryogenic callus redifferentiation in the Zmwox9b homozygous mutant and its wild-type KN5585. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] This invention uses core inbred lines commonly used in maize breeding in northern China and constructed segregating populations as research materials. It employs whole-genome resequencing and liquid-phase microarray methods, combined with GWAS and QTL mapping, to screen 14 homogeneous and stable candidate genes with major effects. These genes are widely involved in signal transduction, stress response, redox pathways, and gluconeogenesis, explaining phenotypic contributions ranging from 5.7% to 24.39%. Among them, the homeobox gene ZmWOX9B is a novel candidate gene that encodes a WUSCHEL-related homeobox 9b transcription factor, which has never been reported in previous studies. This gene was discovered in the somatic cell regeneration trait of callus rate in greening, explaining 24.17% of the phenotypic variation, indicating that ZmWOX9B may play a role in the early stages of plant somatic cell differentiation. This invention further utilizes qPCR technology to analyze the expression pattern of ZmWOX9B. The results show that the expression of this gene in inbred lines with strong somatic cell regeneration capacity initially shows a downregulation trend during callus induction, then upregulates to its highest level at 12 days of induction, and returns to its initial expression level at 16 days of induction. However, its expression level in inbred lines with poor regeneration capacity is lower than that in inbred lines, and it is almost not expressed in cultures at 16 days of induction, indicating a significant difference in the response of the ZmWOX9B gene to callus induction culture. A search on the MaizeGDB website reveals that this gene is only highly expressed in the early stages of zygotic embryo development, and is not expressed in other tissues and organs. This further suggests that the encoded product of ZmWOX9B may play a function in determining maize somatic cell fate.

[0031] Example 1

[0032] The maize inbred line KN5585, known for its strong somatic cell regeneration capacity and widespread use in genetic transformation, was selected as the recipient. A dual-target design (single-gene dual-target) was developed based on the nucleotide sequence (SEQ ID NO.1) of the ZmWOX9B gene in its genome. The target sequence information is as follows:

[0033] Target 1: CGTCGTCTGACACGGCTCGGCGG (SEQ ID NO.2);

[0034] Target 2: CCGTCCCTCCTCTCAGCTGGCGG (SEQ ID NO.3);

[0035] The full-length nucleotide sequence of the ZmWOX9B gene is 5286 bp, as shown below (the underlined parts in the sequence represent target 1 (pre-) and target 2 (post-) respectively):

[0036] The nucleotide sequence of the ZmWOX9B gene:

[0037] AAAAAAGAGACATCCTGTTCCTCGCAAGAAGCAGCTCACCCGACCATGCAATGCATGCACGGTCAAAATTGCCGCCCCATCGCCCTGTGACGCGGCTGCAGTTCTCATTCCTTCCGGCAAATGGGATCGGAAAGGCGAGGCGACGCCCGGAGGTCGCCATCACGCCCCGAAAGGCACCGTCAGAAATGGCAGGACACGGCATCGGGGACGCTTCGGTTTTTCGTGTCTACCTTGCTTGGCAGTGGCAGCAGCAGGCGTATATATGCTACTGCTACTGTAGCAGCCAGCTCGCCCGCCCGTACCTTCGCACGTTGCAGTACCCATCCGGCATGGTACAGCGAGTTCCCTCCCGATGCAACGCCACGCGACCGGGTCTCGCGAGCACGCATCTCCAAGCAGGGCGAGACTGGACTGGAGAGACTGGCCTCGCTCGGCCAGTAGTGTAGAACTGGGAGACCGACCATTCATTGCGTGGCAACGCTGCGCGAGCGCGAGACGACCGAGGGTAGGTGCTGCCATTATAAGAGGCAGCCAGCAGCAGTGTGCGAGCGTTCTCAGCCTAGCCGAGCCCCGTAGCGTGTAGCGAGAAGGTGCGACAGCAGGGTAGGGAGCTCACTGTTAGTCGTTCCTCCGATCCACAGATGAATCAGTGGTAGACTGCTGGTAGTAGTATATATACAATCTCTAGCTGTGCCGCTGTTTTAGAGTATCGTCGTGAGAGCTCACAAGGAGAAGATCTGGTGCTGCGAAAGGGAGAAGAAAAGAAGAAGAAGAAATCAGCTCAGCTCAGCATGGCTTCCTCGTCCTTCAACAACAGTCACTGGCCGAGCATGTTCAGGTCCAAGCACGCCGCCGAGCCGTGTCAGACGACGCAGCCTGACATCAGCAGCTCACCG CCGTCCCT CCTCTCAGCTGGCGG

[0038] Based on the above dual-target sequence information, a CRISPR / Cas9 expression vector for the target gene was constructed. Specific primers for amplifying the target region were designed as follows:

[0039] ZmWOX9B-F: AGCTGCCGCTGTTTTAGAGT (SEQ ID NO.4);

[0040] ZmWOX9B-R: GGAGTCAGCTTCACCTCTCG (SEQ ID NO. 5).

[0041] Using Agrobacterium-mediated transformation, the constructed editing vector was transferred into the recipient inbred line KN5585 to obtain homozygous mutants of the ZmWOX9B gene, named Zmwox9b-1, Zmwox9b-2, and Zmwox9b-3, respectively. Specific primers were used to amplify and sequence the editing target regions of the three mutants and their wild-type counterparts. The results showed that mutant Zmwox9b-1 deleted 58 bases between target sites 1 and 2 compared to the recipient control; mutant Zmwox9b-2 deleted 43 bases between target sites 1 and 2; and mutant Zmwox9b-3 inserted two TG bases at target site 1. (Details follow...) Figure 1 As shown.

[0042] The mutants Zmwox9b-1, Zmwox9b-2, Zmwox9b-3, and their wild type were further planted in a greenhouse. When the maize reached the flowering stage, self-pollination was performed. About 12-13 days after pollination, 20 ears were randomly selected from each material, and 50 immature embryos were extracted from each ear on a sterile operating table for tissue culture. Four somatic cell regeneration-related traits were identified: embryogenic callus induction rate, green callus rate, green seedling redifferentiation rate, and the average number of green seedlings differentiated from each immature embryo. The phenotypic data of each material are shown in Table 1.

[0043] Table 1

[0044]

[0045]

[0046] Table 1 shows that the embryogenic callus induction rate, green callus rate, green seedling redifferentiation rate, and average number of green seedlings differentiated per embryo were significantly lower in mutants Zmwox9b-1, Zmwox9b-2, and Zmwox9b-3 than in the wild-type control (P<0.01). The green seedling redifferentiation rate of the mutants was the lowest, at only 5.88%, significantly lower than the 73.02% of the recipient inbred line, indicating that the loss of function of the ZmWOX9B gene inhibited somatic cell regeneration in maize.

[0047] Figure 2 This is a phenotypic comparison of the homozygous mutant Zmwox9b and its wild type after four weeks of callus induction culture. It is evident that the mutant callus volume is significantly smaller than that of the wild type KN5585, with a more compact morphology and a significantly reduced number of surface particles. Further culture of these embryogenic calluses under light for two weeks revealed that while the cultures of each mutant showed some growth, the rate of green spots on their surface decreased (53.86%-64.07%), and only a few calluses differentiated into regenerated green shoots. In contrast, the wild type achieved a green callus rate of 93.67%, and the embryogenic callus grew vigorously, producing a larger number of regenerated green shoots. Figure 3 The dynamic developmental process of embryogenic callus redifferentiation in mutant Zmwox9b and its wild-type form is described in [reference needed]. Figure 4 .

[0048] Depend on Figure 2 and Figure 4 It can be seen that when maize embryos are induced and cultured for 4 weeks, the callus volume of the mutant Zmwox9b is significantly smaller than that of the wild type KN5585, and the morphology and structure are more compact with a significant reduction in the number of surface particles.

[0049] Depend on Figure 3 and Figure 4 It was found that after further differentiation and culture of the above-mentioned embryogenic callus for 2 weeks, although the culture of the homozygous mutant Zmwox9b showed some growth, the proportion of green spots on its surface decreased, and only a few calluses differentiated into regenerated green seedlings; while the wild-type green callus rate reached over 90%, and the embryogenic callus grew vigorously, with a large number of regenerated green seedlings. This indicates that the loss of function of the ZmWOX9B gene inhibits somatic cell regeneration in maize inbred lines.

[0050] The above experiments confirmed that after a frameshift mutation occurs in the editing target region of the homeobox gene ZmWOX9B, the potential for maize somatic cells to regain totipotency is suppressed, resulting in a significant decrease in their regeneration capacity. Therefore, based on this finding, the aforementioned specific detection primers can be used to amplify and sequence the target region of the ZmWOX9B gene in maize with unknown phenotypes. By comparing the sequence with the wild-type ZmWOX9B gene, maize inbred lines with high-frequency somatic cell regeneration can be screened in batches and rapidly, providing recipient materials for maize transgenic breeding.

[0051] The application of this invention not only avoids the heavy manpower and financial investment in plant tissue culture, but also overcomes the technical bottleneck of corn embryo extraction being constrained by its growth cycle, significantly saving various resource costs.

[0052] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a ZmWOX9B gene mutation detection primer in screening maize inbred lines with strong somatic cell regeneration ability, characterized in that, The ZmWOX9B gene mutation detection primers include the forward primer shown in SEQ ID NO.4 and the reverse primer shown in SEQ ID NO.5; the ZmWOX9B gene mutation detection primers are specific primers designed based on the nucleotide sequence of the ZmWOX9B gene with two targets; the sequences of the two targets are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the ZmWOX9B gene is shown in SEQ ID NO.

1.

2. A method for screening maize inbred lines with strong somatic cell regeneration ability, characterized in that, Includes the following steps: Using the ZmWOX9B gene mutation detection primers described in claim 1, the target region of the ZmWOX9B gene in the maize inbred line to be tested was amplified; the amplified product was compared with the wild-type ZmWOX9B gene sequence. If a frameshift mutation or a large-fragment base insertion or deletion exists in the target region, the inbred line is determined to have poor somatic cell regeneration ability; the nucleotide sequence of the ZmWOX9B gene is shown in SEQ ID NO.

1.

3. The method according to claim 2, characterized in that, The frameshift mutation includes a deletion mutation or an insertion mutation between target 1 and target 2; the sequence of target 1 is shown in SEQ ID NO.2; the sequence of target 2 is shown in SEQ ID NO.

3.

4. The method according to claim 2, characterized in that, The somatic cell regeneration capacity was assessed by evaluating four somatic cell regeneration traits: embryogenic callus induction rate, greening callus rate, green seedling redifferentiation rate, and the average number of green seedlings differentiated from each embryo.

5. The application of a ZmWOX9B gene mutation detection primer in maize transgenic breeding, characterized in that, The ZmWOX9B gene mutation detection primers include the forward primer shown in SEQ ID NO.4 and the reverse primer shown in SEQ ID NO.5; the ZmWOX9B gene mutation detection primers are specific primers designed with dual targets based on the nucleotide sequence of the ZmWOX9B gene; the sequences of the dual targets are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the ZmWOX9B gene is shown in SEQ ID NO.1.