Primer group, probe and detection method for tomato fusarium oxysporum root rot pathogen detection
Through dual platform compatibility design primer sets and probes, combined with Taqman qPCR and microdroplet digital PCR technology, the sensitivity and specificity of specialized detection of Fusarium oxysporus tomatoes in the existing technology is solved, and efficient and accurate pathogen distinction and quantitative analysis is achieved, suitable for high-throughput screening and detection of complex samples.
Patent Information
- Application Number
- CN202510464153.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art is difficult to quickly and accurately distinguish and quantitatively detect different specialized types of Fusarium oxysporus tomato, especially FoL and FoRL, which makes it difficult to prevent and control, and the traditional methods have low sensitivity and poor specificity, which cannot meet the needs of high throughput and real-time monitoring.
The primer set and probe designed with dual platform compatibility is adopted, combined with Taqman qPCR and droplet digital PCR technology to achieve high sensitivity, rapid distinction and quantitative detection of FoL and FoRL, and improve specificity and accuracy through the dual fluorescence probe system.
It has achieved efficient and convenient detection of Fusarium oxysporus tomato, which can provide accurate pathogen detection results in the early stages of the disease, reduce economic losses, and is suitable for high-throughput screening and accurate quantitative analysis of complex samples.
Smart Images

Figure CN120249547A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of agricultural biotechnology, and in particular relates to a primer set, a probe and a detection method for detecting the pathogen of tomato Fusarium oxysporum root rot. Background Art
[0002] Tomato (Solanum lycopersicum), as one of the important vegetable crops widely cultivated globally, is not only favored by consumers for its rich nutritional value but also occupies an important position in agricultural production. Continuous cropping in protected cultivation has led to an increasing occurrence of soil-borne diseases such as root rot. Among them, the root rot caused by Fusarium oxysporum has a high occurrence frequency, a fast transmission speed, and is difficult to control, and has become one of the important factors restricting the development of the tomato industry. Fusarium oxysporum overwinters in the soil in the form of mycelium and chlamydospores. The pathogen can attach to diseased residues, such as the roots and stems of tomatoes, and remain in the soil with the diseased residues. When conditions are suitable, Fusarium oxysporum multiplies in large numbers and spreads with water or wind. Therefore, the detection of the pathogen content of Fusarium oxysporum in the soil is crucial for disease prediction.
[0003] Fusarium oxysporum can be divided into multiple special forms according to its pathogenicity and different host plants. Among them, the two most common special forms that infect tomatoes are Fusarium oxysporum f. sp. lycopersici (FoL) and Fusarium oxysporum f. sp. radicis-lycopersici (FoRL). Both of these pathogens can cause wilting, decline, and even death of tomato plants, and the disease incubation period is long. Once the symptoms appear, the disease spreads and develops rapidly. If not detected and treated in time, it may cause huge economic losses. The disease symptoms of FoRL include dead plants and rotten seedlings, etc. Once it occurs, it will be difficult to control, and in severe cases, the tomato yield loss can reach more than 60%, becoming one of the main obstacles restricting the sustainable development of protected tomatoes. At present, the prevention and control system for FoL has been relatively perfect: in terms of disease-resistant breeding, through technologies such as molecular marker-assisted selection, a number of commercial varieties carrying resistance genes such as I, I-2, and I-3 have been successfully cultivated, which can effectively resist FoL infection; in terms of chemical control, fungicides such as benzimidazoles and methoxyacrylates have been proven to have good control effects on FoL. However, compared with its closely related species FoL, the prevention and control of FoRL still faces severe challenges: on the one hand, due to the unique pathogenic mechanism of FoRL, the existing FoL-resistant varieties are susceptible to it; on the other hand, the conventional fungicides have poor control effects on FoRL and there is a risk of drug resistance.
[0004] Quickly and accurately identifying potential pathogenic species in the field is the basis for effective disease control. Currently, the detection methods for Fusarium oxysporum f. sp. lycopersici generally include Koch's postulates and molecular biology identification methods. Koch's method is time-consuming, including pathogen isolation and identification, purification and re-inoculation, as well as re-isolation and re-identification. In molecular biology methods, conventional PCR identification can generally only identify to the species level, lacking specific sequences for different special forms, unable to accurately identify each special form, and unable to perform quantitative analysis. Therefore, there is an urgent need for a rapid, highly sensitive and quantitative detection method that can accurately distinguish different special forms of Fusarium oxysporum, in order to achieve accurate quantitative detection of pathogens and take corresponding control measures in a timely manner.
[0005] The Hirano team established a method based on polymerase chain reaction (PCR) to identify FoL and FoRL (Hirano, Y.; Arie, T., PCR-based differentiation of Fusarium oxysporum ff.sp. lycopersici and radicis-lycopersici and races of F. oxysporum f.sp. lycopersici. Journal of General Plant Pathology 2006, 72(5), 273-283.). Patent CN106868138A proposed a PCR detection technique for identifying the pathogens of tomato cervical rot root rot and fusarium wilt in primers and kits. Patent CN112176090B proposed a PCR detection technique for identifying the molecular markers of Fusarium oxysporum tomato cervical rot root rot and its application. The above methods all belong to the detection methods based on traditional PCR technology and have the following deficiencies: (1) Poor sensitivity: Traditional PCR technology needs to rely on electrophoresis for subsequent analysis, and its sensitivity and accuracy are affected by operation and visual judgment. If the concentration of the target DNA is low, it may not be accurately detected, especially in complex matrices such as soil, where there is inhibitor interference; (2) Specificity problem: Traditional PCR relies on primer design. If the primer design is not specific enough, non-specific amplification or cross-reaction may occur, especially when the target gene sequences are similar (such as between FoL and FoRL); (3) Complicated operation: After the PCR reaction is completed, further product analysis (such as gel electrophoresis) is required. This process is time-consuming and error-prone, and the interpretation of the results requires manual intervention, increasing the complexity of the operation and the possibility of errors; (4) Unable to detect multiple targets simultaneously: Traditional PCR technology usually needs to design different primers and reaction systems to detect multiple pathogens. If FoL and FoRL are to be identified simultaneously, two reactions must be carried out separately, with low efficiency; (5) Insufficient quantification ability: Traditional PCR technology is mainly used to detect the presence of target DNA and does not provide quantitative information. Although the amount of DNA can be estimated by subsequent analysis of the reaction products (such as gel electrophoresis), this method cannot accurately provide the copy number of the target gene; (6) Unable to monitor the reaction process in real time: During the PCR amplification process, the accumulation of products cannot be monitored in real time, and the efficiency and results of the reaction cannot be immediately known, which is a limitation for the accurate detection of pathogens in complex samples.
[0006] The Attitalla team established a technique for identifying FoL and FoRL based on the Restriction Fragment Length Polymorphism (RFLP) technique (Attitalla, I.H.; Fatehi, J.; Levenfors, J.; Brishammar, S.J.M.r., A rapid molecular method for differentiating two special forms (lycopersici and radicis-lycopersici) of Fusarium oxysporum. 2004, 108(7), 787-794.), but it has the following deficiencies: (1) Sensitivity issue: The sensitivity of RFLP is relatively low and it cannot detect very small amounts of target DNA, which is particularly problematic in some environmental samples (such as soil); (2) Complex and time-consuming operation: RFLP requires multiple experimental steps, such as DNA extraction, restriction enzyme digestion, electrophoresis analysis, etc. Each step requires a large amount of manual operation, increasing the operation difficulty and time consumption; (3) Low throughput: Since RFLP requires separation and analysis on a sample-by-sample basis, the throughput is low and it is not suitable for large-scale and efficient monitoring. For large-scale soil samples or real-time monitoring of multiple samples, the efficiency is low; (4) Insufficient quantification ability: Relying on the analysis of the electrophoresis pattern of the fragments after enzyme digestion, it is difficult to accurately measure the copy number or relative abundance of the target DNA; (5) Unable to monitor the reaction process in real time: The RFLP technique relies on electrophoresis analysis after the reaction is completed to determine the results and cannot monitor the DNA accumulation during the amplification process in real time. This makes the evaluation of its reaction efficiency, sensitivity, etc. relatively lagged, and it is difficult to timely detect problems in the reaction (such as inhibitory effects or non-specific amplification), thus reducing the accuracy and reliability of the overall analysis.
[0007] Patent CN111286555A proposes a Kompetitive Allele Specific PCR (KASP) for identifying physiological races 1, 2, 3 of FoL and FoRL based on SNP molecular markers of the pgx4 gene, its application in the detection of Fusarium oxysporum, detection methods and kits. The KASP technology has the following technical limitations in the application of pathogen detection and early warning: (1) It is suitable for qualitative typing and difficult to achieve absolute quantitative analysis of pathogens; (2) The detection dynamic range is relatively narrow, usually only 2 - 3 orders of magnitude, and it cannot meet the accurate detection requirements of samples with a wide range of concentrations; (3) The detection sensitivity is limited, and the lowest detection limit is usually higher than 1%, making it difficult to meet the early warning requirements; (4) The detection throughput is limited, the reaction system optimization is complex, and it is not conducive to large-scale sample screening; (5) The data analysis complexity is high, requiring specialized analysis software and complex cluster analysis, which affects the detection efficiency. These technical limitations limit the application effect of KASP in the synchronous detection and early warning of pathogens. Summary of the Invention
[0008] In view of the many limitations of the prior art in aspects such as the differentiation between FoL and FoRL, quantitative ability, and detection standardization, the present invention provides a primer set, a probe, and a detection method for the detection of the pathogen of tomato Fusarium root rot, which have the advantages of high specificity, short detection time, high throughput, rapidity, high sensitivity, high accuracy, quantification, good versatility, and the ability to perform multiplex detection.
[0009] The present invention provides a primer set for the detection of the pathogen of tomato Fusarium root rot, including primer set 1 or primer set 2;
[0010] Primer set 1 includes an upstream primer Fo-F and a downstream primer Fo-R1; the upstream primer Fo-F includes the nucleotide sequence shown in SEQ ID NO.1; the downstream primer Fo-R1 includes the nucleotide sequence shown in SEQ ID NO.2;
[0011] Primer set 2 includes an upstream primer Fo-F and a downstream primer Fo-R2; the upstream primer Fo-F includes the nucleotide sequence shown in SEQ ID NO.1; the downstream primer Fo-R2 includes the nucleotide sequence shown in SEQ ID NO.3.
[0012] The present invention provides an allele-specific probe for differentiating FoRL and FoL, including probe FoRL-FAM and / or probe FoL-HEX; probe FoRL-FAM includes the nucleotide sequence shown in SEQ ID NO.7; probe FoL-HEX includes the nucleotide sequence shown in SEQ ID NO.9, wherein the 12th and 13th bases from the 5' to 3' ends are locked nucleic acids.
[0013] Furthermore, the probe FoRL-FAM is labeled with the FAM fluorescent group and the BHQ1 fluorescence quenching group, and the probe FoL-HEX is labeled with the HEX fluorescent group and the BHQ1 fluorescence quenching group.
[0014] The present invention innovatively proposes a primer set and a probe that can be simultaneously applied to Taqman qPCR technology and droplet digital PCR (ddPCR). The above primer set and probe can be used for the detection and early warning of Fusarium oxysporum f. sp. radicis-lycopersici in tomatoes. The present invention adopts a unique dual-platform compatibility design, which can not only achieve efficient and convenient detection in a conventional fluorescence quantitative PCR system, but also complete ultra-high-sensitivity absolute quantitative analysis on the ddPCR platform. Relying on the optimized Taqman probe and reaction system, this platform can sensitively and quickly distinguish Fusarium oxysporum f. sp. lycopersici (FoL) from Fusarium oxysporum f. sp. radicis-lycopersici (FoRL) in a single-probe reaction system and a dual-probe reaction system. Through this detection technology, tomato growers can quickly obtain accurate pathogen detection results in the early stage of the disease, carry out precise prevention and control in a timely manner, and significantly reduce the economic losses caused by the disease. At the same time, this platform provides a technically advanced and widely applicable solution for plant disease monitoring and pathogen biology research, and has important application value and promotion prospects.
[0015] In the present invention, the dual-probe has two independent probes binding to the target sequence, and each probe carries a specific fluorescent group and a quenching group. This dual recognition mechanism enhances the specificity of the detection, reduces the fluorescent signal generated by non-specific amplification, thereby improving the accuracy of the detection, can effectively reduce the false positive rate, and makes the experimental results more reliable. The dual-probe system usually performs more stably in multiple experiments, which improves the repeatability of the experimental results.
[0016] The present invention provides a kit for detecting the pathogen of Fusarium oxysporum root rot in tomatoes, comprising the above primer set and / or probe.
[0017] The kit provided by the present invention has the advantages of high specificity, short detection time, high throughput, rapidity, high sensitivity, high accuracy, quantification, good universality, and the ability to perform multiplex detection.
[0018] The present invention provides a method for detecting the pathogen of Fusarium oxysporum root rot in tomatoes, comprising the following steps: detecting by using the above primer set, probe or kit.
[0019] Furthermore, fluorescence quantitative PCR or droplet digital PCR methods can be used for detection.
[0020] The detection method provided by the present invention is a dual-platform nucleic acid detection technology based on probe-based qPCR and ddPCR. Compared with traditional methods, the present invention has significant advantages. Probe-based qPCR achieves high sensitivity and high specificity detection through specific fluorescent probes, supports real-time quantification and multiplex detection, and is suitable for high-throughput screening and rapid diagnosis; ddPCR can achieve absolute quantification through droplet partitioning technology, accurately detect target molecules at the single-copy level without a standard curve, has ultra-high sensitivity and anti-interference ability, and is particularly suitable for the detection of trace nucleic acids in complex samples. Both detection methods provided by the present invention conform to the standardized process, can be widely applied to fields such as soil microorganism detection and plant disease detection, and have high precision, high reliability and good industrialization promotion prospects.
[0021] Furthermore, the reaction system for detection further includes one or several of enzyme, enzyme reaction solution, DNA template, and water.
[0022] The Taqman qPCR reaction system and probe provided by the present invention have dual-detection platform compatibility. They can be adapted to both conventional fluorescence quantitative PCR instruments and the ddPCR platform, realizing the complementary advantages of the two detection technologies. In the application of the fluorescence quantitative PCR platform, it can play the advantages of simple operation, rapid detection, and relatively low cost, and is suitable for the screening of conventional samples and large-scale detection; in the application of the ddPCR platform, it can utilize its characteristics of absolute quantification, ultra-high sensitivity, and wide dynamic range to meet the detection and accurate quantification requirements of trace samples. This dual-platform compatibility design enables the present invention to not only meet the convenience requirements of conventional detection but also cope with the special requirements of high-sensitivity detection, significantly improving the applicability and application value of the detection method, and providing a flexible and reliable solution for accurate detection in different application scenarios.
[0023] Furthermore, after detection, the infection situation of the pathogenic bacteria is determined according to the fluorescence signal: if only the FAM signal is on, it indicates that the pathogenic bacteria in the sample are FoRL; if only the HEX signal is on, it indicates that the pathogenic bacteria in the sample are FoL; if both the FAM and HEX signals are on, it indicates that the pathogenic bacteria in the sample are FoRL and FoL.
[0024] Furthermore, each 20 μL single-probe reaction system may include: 10 μL of 2×DNA polymerase premix, 0.8 μL of upstream primer (concentration 5 μM), 0.8 μL of downstream primer (concentration 5 μM), 0.4 μL of probe (concentration 5 μM), 1 μL of template, and ddH2O is added to make up to 20 μL.
[0025] Further, each 20 μL dual-probe reaction system may include: 10 μL of 2×DNA polymerase premix, 0.8 μL of upstream primer (concentration: 5 μM), 0.8 μL of downstream primer (concentration: 5 μM), 0.4 μL of probe FoRL-FAM (concentration: 5 μM), 0.4 μL of probe FoL-HEX (concentration: 5 μM), 1 μL of template, and ddH2O is added to make up to 20 μL.
[0026] Further, the concentration ratio of the primer to the probe is 200 nM / 100 nM. Using the above primer and probe concentration ratio is beneficial to further improve the specific detection efficiency.
[0027] Further, the reaction program of the fluorescence quantitative PCR may include: pre-denaturation at 94 °C for 10 min; (denaturation at 94 °C for 10 s, annealing / extension / data collection at 60 - 68 °C for 35 s) × 40 cycles. Preferably, the annealing temperature is 63 °C. Adopting the above annealing temperature is beneficial to further improve the amplification effect.
[0028] The reaction program can also be adjusted according to the instrument. For example, the reaction program includes: 95 °C for 5 min, 95 °C for 20 s, 63 °C for 1 min, (95 °C for 20 s, 63 °C for 1 min) × 45 cycles.
[0029] Further, the reaction program of the droplet digital PCR may include: 58 °C for 2 min, 95 °C for 5 min, (95 °C for 20 s, 63 °C for 1 min) × 45 cycles.
[0030] Further, it also includes the step of extracting the genomic DNA of the sample. For example: when the sample to be detected is a plant or soil, it also includes the step of extracting the genomic DNA of the plant or soil.
[0031] The above detection method provided by the present invention is applicable to FoL and FoRL in plant and soil samples, and has the advantages of high specificity, short detection time, high throughput, rapidity, high sensitivity, high accuracy, quantification, good universality, and multiplex detection.
[0032] The present invention provides the application of the above primer set, probe or kit in the monitoring or early warning of diseases caused by the pathogen of Fusarium oxysporum f. sp. radicis-lycopersici in tomatoes.
[0033] The primer set, probe and kit provided by the present invention have the following advantages when applied:
[0034] (1) High specificity: Based on the fluorescence probe, cross-reaction can be reduced;
[0035] (2) Short time: The result analysis can be carried out in real time without steps such as electrophoresis;
[0036] (3) High throughput and rapidity: It can process a large number of samples simultaneously, and the reaction time for each sample is short (usually 1 - 2 hours), greatly improving the detection efficiency.
[0037] (4) High sensitivity and high accuracy: It can accurately quantify the DNA of the target pathogen at a low-copy level of DNA concentration. Therefore, it has good detection ability for trace pathogens in complex matrices such as soil.
[0038] (5) Quantification function: It can not only identify the target strain, but also perform absolute quantification, accurately measuring the copy number or relative abundance of the pathogen in the sample and providing quantitative information.
[0039] (6) Multiplex detection: It can identify FoL and FoRL simultaneously in the same reaction tube, improving the flexibility and efficiency of detection.
[0040] (7) Good universality: The primers and probes provided by the present invention are universal for both Taqman qPCR and ddPCR technologies. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] Figure 1 It is the electrophoresis diagram of primer amplification in Example 1 of the present invention.
[0042] Figure 2 It is the experimental result of screening probes in Example 2 of the present invention.
[0043] Figure 3 It is the experimental result of optimizing the annealing temperature in Example 3 of the present invention.
[0044] Figure 4 It is the experimental result of optimizing the concentration ratio of primers and probes in Example 4 of the present invention.
[0045] Figure 5 It is the experimental result of single-probe detection and dual-probe detection in Example 5.1 of the present invention.
[0046] Figure 6 It is the experimental result of detecting phylogenetically related fungi using dual-probe detection in Example 5.3 of the present invention.
[0047] Figure 7 It is the standard curve graph of detection using probe FoRL-FAM in Example 6.
[0048] Figure 8 It is the standard curve graph of detection using probe FoL-HEX in Example 6.
[0049] Figure 9 It is the experimental result of ddPCR detection of FoRL based on Taqman probe in Example 7.
[0050] Figure 10 Experimental results of ddPCR detection of FoL based on Taqman probe in Example 7.
[0051] Figure 11 Taqman primer probe and system suitability evaluation in Example 8.
[0052] Figure 12 Evaluation of the sensitivity and interference of Taqman qPCR detection technology based on target nucleic acid ratio in Example 9.
[0053] Figure 13 Evaluation of the sensitivity and interference of ddPCR detection technology based on target nucleic acid ratio in Example 9.
[0054] Figure 14 Experimental results of detecting soil blind samples based on traditional PCR technology in Example 10.
[0055] Figure 15 Experimental results of detecting soil blind samples by the method provided by the present invention in Example 10.
[0056] Figure 16 Research on the disease process of plants infected with FoRL spore solution in Example 11 and verification of the detection technology of the present invention in disease process monitoring and early warning. Detailed implementation manners
[0057] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other implementation manners obtained by those of ordinary skill in the art without creative efforts shall fall within the scope protected by the present invention.
[0058] The present invention provides a primer set, a probe and a detection method for detecting the pathogen of tomato Fusarium oxysporum root rot, which can be used to accurately and sensitively distinguish Fusarium oxysporum f. sp. lycopersici (FoL) and Fusarium oxysporum f. sp. radicis-lycopersici (FoRL). The present invention adopts a unique dual-platform compatibility design, which can not only achieve efficient and convenient detection in a fluorescence quantitative PCR system, but also complete ultra-high-sensitivity absolute quantitative analysis on a ddPCR platform. Relying on the optimized Taqman probe and reaction system, this platform can sensitively and quickly distinguish FoL and FoRL in a single reaction system. The present invention can give an early warning before the occurrence of the disease, providing a scientific basis for timely taking effective prevention and control measures. The present invention is applicable to the disease monitoring and early warning in tomato planting areas, helping to ensure the stability and sustainability of tomato production and promoting the healthy development of the tomato planting industry.
[0059] The test strains in the examples are shown in Table 1, which were isolated, identified and preserved by the Institute of Plant Protection, Tianjin Academy of Agricultural Sciences. They can be obtained by the public and used only for non-commercial purposes to repeat the examples described in the present invention.
[0060] Table 1 Test Strains
[0061]
[0062]
[0063] The fungal genomic DNA extraction kit used in the present invention (EC102, TransGen Biotech, Beijing); the soil fungal genomic DNA extraction kit (EC802, TransGen Biotech, Beijing); PCR reagents: 2×PCR Mix (AS111, TransGen Biotech, Beijing), 2×TaqPCR Mix (MK3.0, Mike, Beijing).
[0064] The primers and probes of the present invention are shown in Table 2 and were all synthesized by Beijing Tsingke Biotechnology Co., Ltd.
[0065] Table 2 Primers and Probes
[0066] Primer Name Sequence (5′-3′) Sequence ID No. Fo-F GCAAGGATGCTGTCTGTGAGAA SEQ ID NO.1 Fo-R1 GCAACACACTTATTCGCCAAA SEQ ID NO.2 Fo-R2 ACTTATTCGCCAAAGCAGCC SEQ ID NO.3 FoRL-FAM1 FAM-TGTGGTGGAGAT(+)C(+)CTGTG-MGB SEQ ID NO.4 FoRL-FAM2 FAM-TGTGGTGGAGAT(+)C(+)CTGTG-BHQ1 SEQ ID NO.5 FoRL-FAM3 FAM-TGTGGTGGAGAT(+)CCTGTG-BHQ1 SEQ ID NO.6 FoRL-FAM FAM-TGTGGTGGAGATCCTGTG-BHQ1 SEQ ID NO.7 FoL-HEX1 HEX-TGTGGTGGAGAC(+)CCTGTG-BHQ1 SEQ ID NO.8 FoL-HEX HEX-TGTGGTGGAGAC(+)C(+)CTGTG-BHQ1 SEQ ID NO.9 EF1α-F ATGGGTAAGGARGACAAGAC SEQ ID NO.10 EF2α-R GGAAGTACCAGTSATCATGTT SEQ ID NO.11 uni-F ATCATCTTGTGCCAACTTCAG SEQ ID NO.12 uni-R GTTTGTGATCTTTGAGTTGCCA SEQ ID NO.13 sprl-F GATGGTGGAACGGTATGACC SEQ ID NO.14 sprl-R CCATCACACAAGAACACAGGA SEQ ID NO.15
[0067] Note: In Table 2, “(+)” represents that the base in front is a locked nucleic acid (LNA), that is, the 2'-O and 4'-C positions of the ribose ring of the base are connected by a methylene bridge to form a rigid structure.
[0068] For those not specifically noted in the examples in terms of specific techniques or conditions, they are all conventional methods or carried out according to the techniques or conditions described in the literature in this field, or according to the product instructions. For those reagents and instruments etc. without indicating the manufacturer, they are all conventional products that can be obtained through regular channels.
[0069] The following is introduced through specific examples.
[0070] Example 1
[0071] The genomic DNA of FoL (FoL TJ001) and the genomic DNA of FoRL (FoRL TJ-03) were respectively selected as templates, and PCR amplification was carried out using primer set 1 and primer set 2 respectively.
[0072] Primer set 1 includes the upstream primer Fo-F and the downstream primer Fo-R1; primer set 2 includes the upstream primer Fo-F and the downstream primer Fo-R2.
[0073] The PCR amplification reaction system includes: 10 μL of 2×PCR Mix, 1 μL of upstream primer (concentration 10 μM), 1 μL of downstream primer (concentration 10 μM), 1 μL of DNA template (concentration 20 ng / μL), and ddH2O is added to make up to 20 μL.
[0074] The PCR reaction conditions include: pre-denaturation at 94°C for 5 min; (denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min) × 30 cycles.
[0075] The PCR amplification products were subjected to electrophoresis detection in 1% agarose gel electrophoresis, and the experimental results are as Figure 1 shown. Figure 1 In the figure, M is DNA Maker (2K plus, Tiangen, Beijing), Fo-F / Fo-R1 FoRL represents the amplification of FoRL using primer set 1, Fo-F / Fo-R1 FoL represents the amplification of FoL using primer set 1, Fo-F / Fo-R2 FoRL represents the amplification of FoRL using primer set 2, and Fo-F / Fo-R2 FoL represents the amplification of FoL using primer set 2. According to Figure 1 it can be seen that both primer set 1 and primer set 2 can achieve the purpose of efficiently amplifying a single target band. The primers with high specificity and efficient amplification provided by the present invention help to ensure the sensitivity of the monitoring and early warning platform.
[0076] Example 2 Screening of Probes
[0077] Fluorescence quantitative PCR was used for detection according to the following reaction system and procedure.
[0078] Genomic DNA of FoL (FoL TJ001) and genomic DNA of FoRL (FoRL TJ-03) were selected as templates. The reaction system includes: 10 μL of 2×TaqPCR Mix, 0.4 μL of upstream primer of primer set 1 (concentration 10 μM), 0.4 μL of downstream primer of primer set 1 (concentration 10 μM), 0.4 μL of probe (concentration 2.5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and ddH2O is added to make up to 20 μL.
[0079] The BIO-RAD CFX Maestro amplification program includes: pre-denaturation at 94°C for 10 min; (denaturation at 94°C for 10 s, annealing / extension / data collection at 60°C for 35 s) × 40 cycles.
[0080] The negative control was amplified using ddH2O as the template.
[0081] The experimental results are as Figure 2 shown.
[0082] Figure 2 A is the result of detecting FoRL and FoL respectively using the probe FoRL-FAM1; Figure 2 B is the result of detecting FoRL and FoL respectively using the probe FoRL-FAM2; Figure 2 C is the result of detecting FoRL and FoL respectively using the probe FoRL-FAM3; Figure 2 D is the result of detecting FoRL and FoL respectively using the probe FoRL-FAM. From Figure 2 A to Figure 2 D, it can be seen that the probe FoRL-FAM can achieve detecting only FoRL without detecting FoL (i.e., no FAM signal is generated for FoL). Therefore, the probe FoRL-FAM is used in subsequent experiments.
[0083] Figure 2 E is the result of detecting FoRL and FoL respectively using the probe FoL-HEX1; Figure 2 F is the result of detecting FoRL and FoL respectively using the probe FoL-HEX. It can be seen that both the probe FoL-HEX1 and FoL-HEX can achieve detecting only FoL without detecting FoRL, but the probe FoL-HEX has a higher fluorescence signal. Therefore, the probe FoL-HEX is used in subsequent experiments.
[0084] Example 3 Optimize the annealing temperature
[0085] Using primer set 1, genomic DNA of FoL (FoL TJ001) and genomic DNA of FoRL (FoRL TJ-03) as templates, detection is carried out using the probe FoRL-FAM according to the following reaction system and procedure.
[0086] The reaction system includes: 10 μL of 2×TaqPCR Mix, 0.4 μL of the upstream primer of primer set 1 (concentration 10 μM), 0.4 μL of the downstream primer of primer set 1 (concentration 10 μM), 0.4 μL of the probe (concentration 2.5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and supplemented with ddH2O to 20 μL.
[0087] The BIO-RAD CFX Maestro amplification program includes: pre-denaturation at 94°C for 10 min; (denaturation at 94°C for 10 s, annealing / extension / data collection at 60 - 68°C for 35 s) × 40 cycles.
[0088] The negative control is amplified using ddH2O as the template.
[0089] The experimental results are as Figure 3 shown. When the annealing temperature is 63°C, the amplification effect is the best.
[0090] Example 4 Optimizing the Concentration Ratio of Primers and Probes
[0091] Using primer set 1, genomic DNA of FoL (FoL TJ001), and genomic DNA of FoRL (FoRL TJ-03) as templates, detection was carried out using probe FoRL-FAM according to the following reaction system and procedure.
[0092] The reaction system includes: 10 μL of 2×TaqPCR Mix, upstream primer of primer set 1 (concentration 10 μM), downstream primer of primer set 1 (concentration 10 μM), probe (concentration 2.5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and ddH2O was added to make up to 20 μL.
[0093] The BIO-RAD CFX Maestro amplification program was used, including: pre-denaturation at 94°C for 10 min; (denaturation at 94°C for 10 s, annealing / extension / data collection at 63°C for 35 s) × 40 cycles.
[0094] The negative control was amplified using ddH2O as the template.
[0095] The experimental results are as Figure 4 shown.
[0096] Figure 4 In a, the primer / probe concentration ratio is 400 nM / 100 nM, that is, the final concentration of the upstream primer in the reaction system is 400 nM, the final concentration of the downstream primer in the reaction system is 400 nM, and the final concentration of the probe in the reaction system is 100 nM. FoRL and FoL were detected using the above concentrations respectively.
[0097] Figure 4 In b, the primer / probe concentration ratio is 200 nM / 100 nM, that is, the final concentration of the upstream primer in the reaction system is 200 nM, the final concentration of the downstream primer in the reaction system is 200 nM, and the final concentration of the probe in the reaction system is 100 nM. FoRL and FoL were detected using the above concentrations respectively.
[0098] Figure 4 In c, the primer / probe concentration ratio is 200 nM / 50 nM, that is, the final concentration of the upstream primer in the reaction system is 200 nM, the final concentration of the downstream primer in the reaction system is 200 nM, and the final concentration of the probe in the reaction system is 50 nM. FoRL and FoL were detected using the above concentrations respectively.
[0099] From Figure 4 a to Figure 4As can be seen from , when the primer / probe concentration ratio is 200 nM / 100 nM, the system exhibits high and stable fluorescence signals. By optimizing the primer / probe concentration ratio of the FAM probe, the specific detection efficiency of FoRL is significantly improved, providing a reliable technical guarantee for the accurate detection of FoRL. The optimized FAM probe can amplify the target sequence of FoRL more efficiently.
[0100] Example 5 Specificity
[0101] 5.1 Single-probe detection and dual-probe detection
[0102] Using FoRL and FoL as targets respectively, single-probe FoRL-FAM, single-probe FoL-HEX and dual-probes were used for detection respectively.
[0103] The reaction system for single-probe detection includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of the upstream primer of primer set 1 (concentration 5 μM), 0.8 μL of the downstream primer of primer set 1 (concentration 5 μM), 0.4 μL of probe FoRL-FAM or probe FoL-HEX (concentration 5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and supplemented with ddH2O to 20 μL.
[0104] The reaction system for dual-probe detection includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of the upstream primer of primer set 1 (concentration 5 μM), 0.8 μL of the downstream primer of primer set 1 (concentration 5 μM), 0.4 μL of probe FoRL-FAM (concentration 5 μM), 0.4 μL of probe FoL-HEX (concentration 5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and supplemented with ddH2O to 20 μL.
[0105] Using the BIO-RAD CFX Maestro amplification program, including: pre-denaturation at 94°C for 10 min; (denaturation at 94°C for 10 s, annealing / extension / data acquisition at 63°C for 35 s) × 40 cycles.
[0106] The negative control was amplified using ddH2O as the template.
[0107] The experimental results are as Figure 5 shown, Figure 5 a shows the detection results of the single-probe FoRL-FAM. It can be seen that the FAM fluorescence signal appears only when FoRL is detected and no fluorescence signal is detected for FoL, indicating that the probe FoRL-FAM has good specificity for FoRL.
[0108] Figure 5b is the detection result of the single probe FoL-HEX. It can be seen that the HEX fluorescence signal only appears when FoL is detected, and no fluorescence signal is detected for FoRL, indicating that the probe FoL-HEX has specific recognition ability for FoL.
[0109] Figure 5 c is the detection result of the dual probe. It can be seen that when the probe FoRL-FAM and the probe FoL-HEX are used simultaneously in the same reaction system, the probe FoRL-FAM can specifically detect FoRL, and the probe FoL-HEX can specifically detect FoL. The signals of the two do not interfere with each other, and no cross-reaction or false positive appears, proving that the dual-probe system has good detection specificity and stability.
[0110] 5.2 Select fungi with similar species for single-probe specific detection
[0111] The test strains are shown in Table 1, including: Fusarium oxysporum f. sp. lycopersici (FoL), Fusarium oxysporum f. sp. radicis-lycopersici (FoRL), Fusarium graminearum, Fusarium equiseti, Fusarium proliferatum, Fusarium solani, Alternaria solani Sorauer, Corynespora cassiicola, Phytophthora infestans, Rhizoctonia solani, Verticillium dahliae, Pythium aphanidermatum.
[0112] Use the T5 Direct PCR Kit gene extraction kit (Qingke, Beijing) to extract DNA from the activated mycelium, dilute the concentration of the strain DNA to 0.1 pg / μL, and the diluted sample can be stored in a -20°C refrigerator.
[0113] Using the diluted strain DNA as a template, detect it according to the following reaction system and procedure with primer set 1.
[0114] The reaction system includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of the upstream primer of primer set 1 (concentration 5 μM), 0.8 μL of the downstream primer of primer set 1 (concentration 5 μM), 0.4 μL of FoL-HEX probe or FoRL-FAM probe (both concentrations are 5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and ddH2O is added to make up to 20 μL.
[0115] The BIO-RAD CFX Maestro amplification program used includes: pre-denaturation at 94°C for 10 min; (denaturation at 94°C for 10 s, annealing / extension / data acquisition at 63°C for 35 s) × 40 cycles.
[0116] The Ct value was recorded. The Ct value is the cycle number corresponding to when the fluorescence signal intensity first exceeds the threshold.
[0117] The detection results using the single probe FoL-HEX are shown in Table 3. The primer set 1 and FoL-HEX provided by the present invention showed fluorescence signals only for the FoL target, and no signals for other related species, indicating that the primers and probes of the present invention have good specificity for FoL. This specific binding ability fully reflects the high selectivity and precise recognition ability of the probe FoL-HEX. Through the specific detection of the single probe FoL-HEX, FoL can be effectively distinguished from other soil-borne pathogens, significantly improving the specificity and accuracy of the detection platform, and providing reliable technical support for the precise monitoring of pathogens.
[0118] Table 3 Results of detection using primer set 1 and probe FoL-HEX
[0119]
[0120]
[0121] Note: In Table 3, NA indicates no signal, that is, Ct value ≥ 35 or undetected (Undetermined), and the amplification curve has no typical S shape, indicating that the target nucleic acid concentration is lower than the detection limit or does not exist.
[0122] The detection results using the single probe FoRL-FAM are shown in Table 4. When using primer set 1 and probe FoRL-FAM for detection, fluorescence signals were shown only for the FoRL target, and no signals for other related species, indicating that the primers and probes provided by the present invention have good specificity for FoRL. This specific binding ability fully reflects the high selectivity and precise recognition ability of the probe FoRL-FAM. Through the specific detection of the single probe FoRL-FAM, FoRL can be effectively distinguished from other soil-borne pathogens, significantly improving the specificity and accuracy, and providing reliable technical support for the precise monitoring of pathogens.
[0123] Table 4 Results of detection using primer set 1 and probe FoRL-FAM
[0124]
[0125] Note: In Table 4, NA indicates no signal, that is, Ct value ≥ 35 or undetected (Undetermined), and the amplification curve has no typical S shape, indicating that the target nucleic acid concentration is lower than the detection limit or does not exist.
[0126] According to the above results, it can be shown that the reaction system using single-probe detection has good specificity for both FoL and FoRL.
[0127] 5.3 Select fungi with similar species for dual-probe specificity detection
[0128] Select the genomic DNA of the FoL (FoL TJ001) target and the genomic DNA of the FoRL (FoRL TJ-03) target as templates respectively, and perform detection according to the following reaction system and procedure.
[0129] The reaction system for dual-probe detection includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of the upstream primer of primer set 1 (concentration 5 μM), 0.8 μL of the downstream primer of primer set 1 (concentration 5 μM), 0.4 μL of probe FoRL-FAM (concentration 5 μM), 0.4 μL of probe FoL-HEX (concentration 5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and make up to 20 μL with ddH2O.
[0130] The BIO-RAD CFX Maestro amplification program includes: pre-denaturation at 94 °C for 10 min; (denaturation at 94 °C for 10 s, annealing / extension / data collection at 63 °C for 35 s) × 40 cycles.
[0131] The negative control is amplified using ddH2O as the template, and the amplification method refers to 5.2 above. Other strains are the strains in Table 1 except for FoL and FoRL. After extracting the genomic DNA of other strains, perform amplification, and the amplification method refers to 5.2 above.
[0132] The experimental results are as Figure 6 shown. It can be seen that when probe FoRL-FAM and probe FoL-HEX are detected in the same reaction, probe FoRL-FAM can detect FoRL but not FoL, probe FoL-HEX can detect FoL but not FoRL, and the negative control and other strains cannot be detected. This shows that dual-probe detection has good specificity for FoL and FoRL.
[0133] The provided probes FoRL-FAM and FoL-HEX of the present invention use FAM and HEX as different fluorescent labels, and each has a unique sequence and recognition ability. This specificity ensures that they can accurately match with the target sequences (FoRL and FoL) respectively, thus avoiding cross-reactions. When using the dual-probe system, if both probes detect the target signal, the result is more reliable. If FoRL exists in the sample, the FAM probe will emit a fluorescent signal; if FoL exists, the HEX probe will emit a fluorescent signal. This dual detection improves the accuracy and reliability of the result. According to the detection results of the FAM and HEX probes, it can be determined whether FoRL and / or FoL exist in the sample. If only the FAM probe emits a fluorescent signal, it indicates that FoRL exists in the sample; if only the HEX probe emits a fluorescent signal, it indicates that FoL exists in the sample; if both probes emit fluorescent signals, it may indicate that both FoRL and FoL exist in the sample. The single-probe detection and dual-probe detection provided by the present invention can avoid the occurrence of false positives in the monitoring and warning platform.
[0134] The above experimental results show that: when only FoL or FoRL exists in the sample, both the single probe and the dual probe can be used for detection, and no false positives will occur.
[0135] Example 6 Sensitivity
[0136] The genomic DNAs (gDNAs) of FoRL (FoRL TJ-03) and FoL (FoL TJ001) were respectively quantified to 10 ng / μL, and then serially diluted to 1000 pg / μL, 500 pg / μL, 100 pg / μL, 50 pg / μL, 10 pg / μL, 5 pg / μL, 1 pg / μL, 0.5 pg / μL, 0.1 pg / μL. Take 1 μL of the DNA solution as a template for real-time fluorescence quantitative PCR reaction, and set 3 replicates for each gradient standard. The real-time fluorescence quantitative PCR reaction system and procedure were carried out according to the detection steps.
[0137] The reaction system for single-probe detection includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of upstream primer Fo-F (concentration 5 μM), 0.8 μL of downstream primer Fo-R1 (concentration 5 μM), 0.4 μL of probe FoRL-FAM or probe FoL-HEX (concentration 5 μM), 1 μL of DNA template, and supplemented with ddH2O to 20 μL.
[0138] The BIO-RAD CFX Maestro amplification program was used, including: pre-denaturation at 94°C for 10 min; (denaturation at 94°C for 10 s, annealing / extension / data collection at 63°C for 35 s) × 40 cycles.
[0139] Using the logarithm of the copy number of each gradient DNA as the abscissa and the cycle threshold Ct value as the ordinate, a standard curve is established.
[0140] The standard curve graph for detecting FoRL using the probe FoRL-FAM is as Figure 7 shown. The standard curve equation is y = -3.1257x + 30.067, and the correlation coefficient R 2 = 0.9993, and the amplification efficiency E is 109%. The detection sensitivity can reach 10 3 copies / μL DNA, and the quantification limit is 10 2 copies / μL DNA.
[0141] The standard curve graph for detecting FoL using the probe FoL-HEX is as Figure 8 shown. The standard curve equation is y = -3.1905x + 29.542, and the correlation coefficient R 2 = 0.9992, and the amplification efficiency E is 106%. The detection sensitivity can reach 10 3 copies / μL DNA, and the quantification limit is 10 2 copies / μL DNA.
[0142] As described above, the amplification efficiency (E) is calculated using the slope of the standard curve, and the formula is: E = 10 -1 / slope -1 .
[0143] Ideally, the amplification efficiency should be 90% - 110%, corresponding to a slope range of -3.1 to -3.6. If the amplification efficiency is lower than 90% or higher than 110%, it may be necessary to optimize the experimental conditions (such as primer design, reaction system, template quality, etc.).
[0144] The above results indicate that the standard curve established by the present invention meets the requirements.
[0145] Example 7 ddPCR Detection
[0146] Using the genomic DNA of FoL (FoL TJ001) and the genomic DNA of FoRL (FoRL TJ-03) as templates respectively, ddPCR is used for detection.
[0147] The single-probe reaction system includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of the upstream primer Fo-F (concentration 5 μM), 0.8 μL of the downstream primer Fo-R1 (concentration 5 μM), 0.4 μL of the probe FoRL-FAM or FoL-HEX probe (both concentrations are 5 μM), 1 μL of the DNA template (concentration 0.1 pg / μL), and supplemented with ddH2O to 20 μL.
[0148] The dual-probe reaction system includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of upstream primer Fo-F (concentration 5 μM), 0.8 μL of downstream primer Fo-R1 (concentration 5 μM), 0.4 μL of probe FoRL-FAM (concentration 5 μM), 0.4 μL of probe FoL-HEX (concentration 5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and ddH2O is added to make up to 20 μL.
[0149] Using a droplet digital PCR analysis system (D 600, Mike, Beijing), the reaction program includes: 58°C for 2 min, 95°C for 5 min, (95°C for 20 s, 63°C for 1 min) × 45 cycles.
[0150] The experimental results of detecting FoRL by ddPCR are as Figure 9 shown. It can be seen that the Taqman qPCR probes and system provided by the present invention are also applicable in ddPCR and still have good detection efficiency and stability. When the detection target is FoRL, no non-specific amplification signals are detected in both the single-probe FoRL-FAM and the dual-probe tests, indicating that the primers and probes have high specificity on the ddPCR platform. In addition, in the dual-probe reaction system, FoRL can only be detected by the FoRL-FAM probe, and no signal is shown in the HEX channel, further verifying the specificity of the FoRL-FAM probe.
[0151] The experimental results of detecting FoL by ddPCR are as Figure 10 shown. It can be seen that the Taqman qPCR probes and system provided by the present invention are also applicable in ddPCR and have good detection efficiency and stability. When the detection target is FoL, no non-specific amplification signals are detected in both the single-probe FoL-HEX and the dual-probe tests, indicating that the primers and probes have high specificity on the ddPCR platform. In addition, in the dual-probe reaction system, FoL can only be detected by the probe FoL-HEX, and no signal is shown in the FAM channel, further verifying the specificity of the probe FoL-HEX.
[0152] Example 8: Usage effects on different instruments
[0153] Using the genomic DNA of FoL (FoL TJ001) and the genomic DNA of FoRL (FoRL TJ-03) as templates respectively, the probes and primers provided by the present invention are used for detection on different instruments.
[0154] The single-probe reaction system includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of upstream primer Fo-F (concentration 5 μM), 0.8 μL of downstream primer Fo-R1 (concentration 5 μM), 0.4 μL of probe FoRL-FAM or probe FoL-HEX (both concentrations 5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and supplemented with ddH2O to 20 μL.
[0155] The dual-probe reaction system includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of upstream primer Fo-F (concentration 5 μM), 0.8 μL of downstream primer Fo-R1 (concentration 5 μM), 0.4 μL of probe FoRL-FAM (concentration 5 μM), 0.4 μL of probe FoL-HEX (concentration 5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and supplemented with ddH2O to 20 μL.
[0156] Detection was performed on the Dailong Accurate 96 fluorescence quantitative PCR instrument. The reaction program includes: 95°C for 5 min, 95°C for 20 s, 63°C for 1 min, (95°C for 20 s, 63°C for 1 min) × 45 cycles.
[0157] The experimental results are as Figure 11 shown.
[0158] Figure 11 a shows the result of single detection of FoRL with probe FoRL-FAM. It can be seen that in different instruments (Dailong Accurate 96 fluorescence quantitative PCR instrument, Beijing), the Taqman qPCR system established in the present invention is still applicable, indicating the universality and stability of this system. No matter which instrument is used, as long as the established experimental procedures and operation guides are followed, reliable results can be obtained.
[0159] Figure 11 b shows the result of single detection of FoL with probe FoL-HEX. It can be seen that in different instruments (Dailong Accurate 96 fluorescence quantitative PCR instrument, Beijing), the Taqman qPCR system established in the present invention is still applicable, indicating the universality and stability of this system. No matter which instrument is used, as long as the established experimental procedures and operation guides are followed, reliable results can be obtained.
[0160] Figure 11 c shows the result of dual-probe detection of FoRL. It can be seen that only probe FoRL-FAM has a fluorescence signal for detecting FoRL, while probe FoRL-FAM has no signal for FoL, indicating that probe FoRL-FAM has a highly specific binding to the FoRL target sequence, can accurately identify FoRL, avoid the occurrence of false positive results, and improve the reliability of the detection results.
[0161] Figure 11 d is the result of double-probe detection of FoL. It can be seen that only the probe FoL-HEX produces a fluorescent signal for FoL, while the probe FoL-HEX has no signal for FoRL, indicating that the probe FoL-HEX has a highly specific binding to the FoL target sequence, can accurately identify FoL, avoids the occurrence of false positive results, and improves the reliability of the detection results.
[0162] Example 9 Detection of nucleic acid mixed samples
[0163] Taqman qPCR and ddPCR were respectively used to detect nucleic acid mixed samples.
[0164] The concentration of FoRL (FoRL TJ-03) genomic DNA is 0.1 pg / μL, and the concentration of FoL (FoL TJ001) genomic DNA is 0.1 pg / μL.
[0165] The FoRL genomic DNA and FoL genomic DNA were mixed at different ratios to obtain mixed DNA. In the mixed DNA, the mixing ratios (volume percentages) of FoRL genomic DNA and FoL genomic DNA were respectively: 0%:0%, 50%:50%, 90%:10%, 10%:90%, 99%:1%, 1%:99%, 99.9%:0.1%, 0.1%:99.9%.
[0166] Using the mixed DNA as a template, Taqman qPCR and ddPCR were respectively used for detection. By comparing the Ct values and amplification efficiencies of DNA samples with different mixing ratios, the sensitivity of the detection technology to the target nucleic acid and the interference of non-target nucleic acids were evaluated. Amplification with ddH2O as a template was used as a negative control.
[0167] The reaction systems of Taqman qPCR and ddPCR are the same, both are double-probe reaction systems, including: 2×TaqPCR Mix 10 μL, upstream primer Fo-F (concentration 5 μM) 0.8 μL, downstream primer Fo-R1 (concentration 5 μM) 0.8 μL, probe FoRL-FAM (concentration 5 μM) 0.4 μL, probe FoL-HEX (concentration 5 μM) 0.4 μL, DNA template 1 μL, supplemented with ddH2O to 20 μL.
[0168] Taqman qPCR uses the BIO-RAD CFX Maestro amplification program, including: pre-denaturation at 94°C for 10 min; (denaturation at 94°C for 10 s, annealing / extension / data acquisition at 63°C for 35 s) × 40 cycles.
[0169] ddPCR was performed using a droplet digital PCR analysis system (D600, Mike, Beijing). The program included: 58°C for 2 min, 95°C for 5 min, and (95°C for 20 s, 63°C for 1 min) × 45 cycles. ddPCR calculates the copy number of the target DNA through droplet partitioning and Poisson distribution (unit: copies / reaction).
[0170] The experimental results are shown in Table 5 Figure 12 and Figure 13 as follows. Figure 12 The negative control (NTC) in was amplified using ddH2O as the template according to the above method.
[0171] When the sample concentration is as low as 100 copies and below (99%:1%, 1%:99%, 99.9%:0.1%, 0.1%:99.9%), qPCR cannot detect it, while digital PCR can successfully detect it, and the lowest can detect single-copy samples. ddPCR is more sensitive than TaqmnqPCR.
[0172] Table 5
[0173]
[0174]
[0175] Note: In Table 5, NA indicates no signal, that is, Ct value ≥ 35 or not detected (Undetermined), and the amplification curve has no typical S shape, indicating that the target nucleic acid concentration is lower than the detection limit or does not exist. "Copies / reaction" refers to the average copy number of the target DNA molecules detected in each reaction unit (droplet). FoRL:FoL = 0%:0%, and the concentrations of both are 0, which is the ddH2O control group.
[0176] The Taqman qPCR system has been widely used in real-time fluorescence quantitative PCR (qPCR) due to its high specificity and quantitative accuracy. The probe and Taqman qPCR system provided by the present invention are applicable to ddPCR, indicating that the probe and system have good generality and compatibility, enabling the same set of probe and system to be used on different PCR platforms, expanding the application range, and improving the experimental efficiency and flexibility. The probe and Taqman qPCR system of the present invention are applicable to ddPCR, further improving the detection sensitivity. The high specificity of the Taqman qPCR system reduces the possibility of non-specific amplification and false positive results. When combined with ddPCR, it can further improve the detection accuracy and ensure the reliability of the experimental results.
[0177] In the present invention, the probes FoRL-FAM and FoL-HEX specifically designed for FoRL and FoL, as well as their supporting primers, can also achieve efficient and stable amplification on the ddPCR platform, demonstrating that the reagent system has good platform compatibility. On the ddPCR platform, both the probe FoRL-FAM and the probe FoL-HEX exhibit amplification efficiency comparable to that of qPCR, and can accurately and sensitively detect the target pathogen, and reliable detection results can be obtained even in low-concentration samples. The probe-based reagent can be directly used on the ddPCR platform, providing a more flexible and accurate detection method, which can be applied to different application scenarios and requirements. The ddPCR platform itself has higher sensitivity and absolute quantification ability. Combined with the probe-based reagent with high amplification efficiency, it can achieve earlier and more accurate detection of Fusarium oxysporum f. sp. lycopersici, providing more reliable technical support for plant disease early warning. At the same time, the operation process is simplified during operation, and the detection efficiency is improved, which is conducive to the popularization and application of this technology.
[0178] Example 10
[0179] Seven soil samples with known infection status were prepared. The soil samples included those infected with FoRL alone, FoL alone, and FoRL+FoL simultaneously. Among them, the number of samples infected with FoRL+FoL simultaneously was 3. Then, the samples were re-numbered and shuffled to ensure that the testers were completely unaware of the sample information. Subsequently, the DNA in the soil was extracted using a soil DNA extraction kit (DP336, Tiangen, Beijing) and stored at -20°C for the following detections.
[0180] (1) Detection of soil samples using the traditional PCR method
[0181] The primer pairs EF1α-F / EF1α-R, uni-F / uni-R, and sprl-F / sprl-R were respectively used to detect the soil samples (the primer sequences are shown in Table 2). The PCR amplification reaction system included: 10 μL of 2×PCR Mix, 1 μL of upstream primer (concentration 10 μM), 1 μL of downstream primer (concentration 10 μM), 1 μL of DNA template (concentration 10 ng / μL), and ddH2O was added to make up to 20 μL.
[0182] The PCR reaction conditions included: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, for 30 cycles.
[0183] Amplification with ddH2O as the template was used as a negative control (NC).
[0184] The experimental results are as Figure 14 shown, Figure 14 a indicates that all 7 samples are infected with Fusarium oxysporumFigure 14 b indicates that 7 samples may be infected with FoL or FoRL, while Figure 14 c indicates that only the electrophoresis result of sample No. 7 shows a lighter band, indicating that sample No. 7 may contain FoRL.
[0185] When preparing the samples, 3 samples were simultaneously infected with FoRL + FoL. However, in the above PCR detection, only 1 sample was detected, and the other 2 samples were not detected. The PCR method cannot detect multiple targets simultaneously. Usually, different primers and reaction systems need to be designed to detect multiple pathogens. If FoL and FoRL are to be identified simultaneously, two reactions must be carried out separately, which is less efficient and vulnerable to environmental and operational interference, resulting in inaccurate results.
[0186] (2) Detecting soil samples using the real-time fluorescence quantitative PCR method provided by the present invention
[0187] The double-probe detection reaction system includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of upstream primer Fo-F (concentration 5 μM), 0.8 μL of downstream primer Fo-R1 (concentration 5 μM), 0.4 μL of probe FoRL-FAM (concentration 5 μM), 0.4 μL of probe FoL-HEX (concentration 5 μM), 1 μL of DNA template (concentration 0.1 pg / μL), and ddH2O is added to make up to 20 μL.
[0188] Using the BIO-RAD CFX Maestro amplification program: pre-denaturation at 94 °C for 10 min; (denaturation at 94 °C for 10 s, annealing / extension / data collection at 63 °C for 35 s) × 40 cycles.
[0189] Amplification is carried out with ddH2O as the template as a negative control.
[0190] The detection results are as Figure 15 shown, Figure 15 A to Figure 15 G are the detection results of samples No. 1 to No. 7 in sequence. In samples No. 1, No. 2, and No. 3, both FAM and HEX signals are bright ( Figure 15 A, B, C), indicating that the soil sample contains both FoL and FoRL; in samples No. 4, No. 5, and No. 6, only the HEX signal is bright ( Figure 15 D, E, F), indicating that the soil sample contains FoL; in sample No. 7, only the FAM signal is bright, indicating that there is FoRL in the soil sample ( Figure 15 G).
[0191] As can be seen from the above experimental results, the detection system of the present invention can be applied to the detection of soil samples. In this embodiment, 3 samples simultaneously infected with FoRL+FoL can be detected, showing good detection effects. Compared with the PCR detection method, the detection method provided by the present invention shows better accuracy and sensitivity, and is convenient, fast, and can complete the detection within 1-2 hours.
[0192] Example 11
[0193] Study on the disease process of plants infected with FoRL (FoRL TJ-03) spore suspension and verification of the detection technology of the present invention in disease process monitoring and early warning.
[0194] Simulated infection: The pathogen was inoculated by the soil mixing method. The FoRL TJ-03 strain was selected, and conidia were collected after culturing on a PDA plate, and a spore suspension with an initial concentration of 1×10 8 CFU / mL (corrected by a hemocytometer) was prepared with sterile water. Nutrient soil with 1×10 7 spores / gram of soil and 1×10 3 spores / gram of soil was configured, and tomato seedlings at the three-leaf and one-heart stage were transplanted into the soil with the bacteria. Mixing the soil with an equal amount of sterile water was used as a blank control (CK), with 4 plants in each treatment and 4 replicates.
[0195] The genomic DNA of the soil sample was extracted using the TIANamp Soil DNA Kit (centrifugal column type) (DP336, Tiangen, Beijing). The genomic DNA was stored in a -80°C refrigerator and then used for subsequent detection.
[0196] The double-probe reaction system includes: 10 μL of 2×TaqPCR Mix, 0.8 μL of the upstream primer Fo-F (concentration 5 μM), 0.8 μL of the downstream primer Fo-R1 (concentration 5 μM), 0.4 μL of the probe FoRL-FAM (concentration 5 μM), 0.4 μL of the probe FoL-HEX (concentration 5 μM), 1 μL of the DNA template (concentration 0.1 pg / μL), and ddH2O was added to make up to 20 μL.
[0197] The BIO-RAD CFX Maestro amplification program was used, including: pre-denaturation at 94°C for 10 min; (denaturation at 94°C for 10 s, annealing / extension / data collection at 63°C for 35 s) × 40 cycles.
[0198] Amplification was carried out using ddH2O as the template as a negative control.
[0199] The experimental results are as Figure 16 shown. On the 7th day, the treatment group with 1×10 3 spores / gram of soil did not show any symptoms, and 1×107 The leaves of the treatment group with 1×10 spores / g soil turned yellow. On the 15th day, slight symptoms appeared in the treatment group with 1×10 3 spores / g soil, only the leaves turned yellow, and the treatment group with 1×10 7 spores / g soil had the most severe disease, and almost all the plants wilted and died.
[0200] Using the Taqman qPCR method established by the present invention for detection, it was found that no signals of FAM and HEX were detected in the blank control (CK) on the 7th day and the 15th day.
[0201] On the 7th day, the FAM signal in the treatment group with 1×10 3 spores / g soil appeared after 35 Ct, and both the FAM and HEX signals in the treatment group with 1×10 7 spores / g soil appeared after 30 Ct.
[0202] On the 15th day, the FAM signal in the treatment group with 1×10 3 spores / g soil appeared after 30 Ct, indicating that there was Fusarium in the soil at this time but the content was small, while both the HEX signal and the FAM signal in the treatment group with 1×10 7 spores / g soil could be detected and the fluorescence signal appeared after 10 Ct, indicating that there was Fusarium in the soil at this time and the quantity was large. It shows that the Taqman qPCR detection method in the present invention can detect 1×10 3 spores / g soil, and can achieve the purpose of early monitoring and warning of diseases.
[0203] When the primer set 2 provided by the present invention was detected by the methods of the above-mentioned various embodiments, it was verified that the primer set 2 also had the beneficial effects of the primer set 1.
[0204] As described above, the above are only the specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention can easily think of changes or substitutions, which should all be covered within the protection scope of the present invention. Therefore, the protection scope of the present invention should be subject to the protection scope of the claims.
Claims
1. A primer set for detecting the pathogen of tomato Fusarium oxysporum root rot, characterized in that, Comprising primer set 1 or primer set 2; Primer set 1 comprises an upstream primer Fo-F and a downstream primer Fo-R1; the upstream primer Fo-F comprises the nucleotide sequence shown in SEQ ID NO.1; the downstream primer Fo-R1 comprises the nucleotide sequence shown in SEQ ID NO.2; Primer set 2 comprises an upstream primer Fo-F and a downstream primer Fo-R2; the upstream primer Fo-F comprises the nucleotide sequence shown in SEQ ID NO.1; the downstream primer Fo-R2 comprises the nucleotide sequence shown in SEQ ID NO.
3.
2. An allele-specific probe for differentiating FoRL and FoL, characterized in that, Comprising probe FoRL-FAM and / or probe FoL-HEX; probe FoRL-FAM comprises the nucleotide sequence shown in SEQ ID NO.7; probe FoL-HEX comprises the nucleotide sequence shown in SEQ ID NO.
9.
3. The probe according to claim 2, wherein Probe FoRL-FAM is labeled with a FAM fluorescent group and a BHQ1 fluorescence quenching group, and probe FoL-HEX is labeled with a HEX fluorescent group and a BHQ1 fluorescence quenching group.
4. A kit for detecting the pathogen of Fusarium oxysporum root rot of tomatoes, characterized in that, Comprising a primer set and a probe, the primer set is as described in claim 1, and the probe is as described in claim 2 or 3.
5. A method for detecting the pathogen of Fusarium oxysporum root rot of tomato, characterized in that, Comprising the following steps: Detecting using the primer set, the probe or the kit; the primer set is as described in claim 1, the probe is as described in claim 2 or 3, and the kit is as described in claim 4.
6. The method for detecting the pathogen of Fusarium oxysporum root rot of tomato according to claim 5, characterized in that, Detecting using a fluorescence quantitative PCR or droplet digital PCR method.
7. The method for detecting the pathogen of tomato Fusarium oxysporum root rot according to claim 5 or 6, characterized in that The reaction system for detection further comprises one or several of an enzyme, an enzyme reaction solution, a DNA template, and water.
8. The method for detecting the pathogen of Fusarium oxysporum f. sp. radicis-lycopersici according to claim 5 or 6, characterized in that, After detection, determine the infection situation of the pathogenic bacteria according to the fluorescence signal: if only the FAM signal is bright, it indicates that the pathogenic bacteria in the sample is FoRL; if only the HEX signal is bright, it indicates that the pathogenic bacteria in the sample is FoL; if both FAM and HEX are bright, it indicates that the pathogenic bacteria in the sample are FoRL and FoL.
9. The method for detecting the pathogen of Fusarium oxysporum root rot of tomato according to claim 5 or 6, characterized in that, Also includes the step of extracting the sample genome.
10. Use of the primer set, the probe or the kit in the monitoring and early warning of diseases caused by the pathogenic bacteria of Fusarium oxysporum root rot of tomato, the primer set is as described in claim 1, the probe is as described in claim 2 or 3, and the kit is as described in claim 4.
Citation Information
Patent Citations
Primers for identifying pathogenic bacteria of tomato neck-root rot and wilt and kit
CN106868138A
SNP molecular marker based on pgx4 gene, application of SNP molecular marker in fusarium oxysporum detection, detection method and kit
CN111286555A
Kit and method for same-tube detection and typing of monkey pox virus nucleic acid and application thereof
CN116064953A
Molecular marker for indirectly discriminating tomato wilting disease fungus
JP2006345844A