SNP (Single Nucleotide Polymorphism) molecular marker related to capsicum fruit branch single clustered growth and application of SNP molecular marker

Through SNP molecular marking and KASP technology at Chr06 chromosome 9558960 of the pepper genome, the single or clustered types of pepper fruit branches were quickly identified, which solved the problems of long breeding cycles and large environmental interference in breeding, and improved breeding efficiency.

CN120249553AActive Publication Date: 2025-07-04HAINAN RES INST OF ZHEJIANG UNIV +1

Patent Information

Application Number
CN202510733445.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-04
Publication Date
2025-07-04
Estimated Expiration
2045-06-04

AI Technical Summary

Technical Problem

The prior art cannot quickly and accurately identify the phenotype of the pepper branch during the pepper seedling stage, resulting in long breeding cycles, low efficiency, and large interference from environmental factors.

Method used

Developed a SNP molecular marker based on KASP technology, located at Chr06 chromosome 9558960 of the pepper genome, with a polymorphism of T or C. It provides detection primers and kits to quickly identify single or clustered fruit branches through PCR amplification and fluorescence signal analysis.

Benefits of technology

It has achieved rapid and accurate identification of fruit branch types during the pepper seedling stage, shortened breeding cycle, improved selection efficiency, and reduced environmental interference. It is suitable for large-scale germplasm resource surveys and fruit branch type identification in breeding units.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249553A_ABST
    Figure CN120249553A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to capsicum fruit branch single cluster growth and application thereof, and belongs to the field of molecular marker-assisted breeding. The SNP molecular marker is located at a base 9558960 of a chromosome of a capsicum genome Chr06, and the polymorphism is T or C. The invention further provides a primer for detecting the SNP molecular marker and a kit for detecting capsicum fruit branch single cluster growth, the SNP molecular marker and the kit can be used for screening capsicum varieties with fruit branch cluster growth, the plant fruit branch type can be rapidly and accurately identified in the capsicum seedling stage, and the application prospect is wide. The method does not need to wait for the plant to enter a flowering period for phenotypic observation, and has a good application prospect in large-scale pepper germplasm resource fruit branch type investigation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular marker-assisted breeding, and particularly relates to an SNP molecular marker related to the solitary or clustered fruit branches of peppers and its application. Background Art

[0002] The branching pattern of peppers (Capsicum annuum L.) directly affects the plant type structure, fruit yield and mechanized harvesting efficiency of the plant. The trait of shortening the fruit branches into clusters has important application value in increasing the planting density of peppers, optimizing light energy utilization and mechanized harvesting. At present, the screening of pepper branching traits mainly relies on the phenotypic observation in the middle and late stages of plant growth, which cannot be carried out in the seedling stage, resulting in a long phenotypic identification cycle; the pepper branching traits are greatly interfered by environmental factors, making it difficult to conduct accurate phenotypic identification. At present, due to the lack of efficient molecular markers for high-throughput detection of the pepper fruit branch branching phenotype, it is difficult for breeders to quickly and accurately identify the pepper fruit branch branching phenotype by identifying the genotype of pepper plants at the seedling stage of peppers, thus affecting the breeding efficiency of high-density planting varieties. Therefore, there is an urgent need to develop a gene molecular marker based on the KASP technology to achieve early and accurate identification of pepper fruit branch branching, shorten the breeding cycle, improve the selection efficiency, and reduce the interference of the environment on the phenotype. Summary of the Invention

[0003] The object of the present invention is to provide an SNP molecular marker related to the solitary or clustered fruit branches of peppers and its application for quickly, accurately and reliably distinguishing the development types of pepper fruit branches in view of the problems existing in traditional breeding.

[0004] To achieve the above object, the technical solution of the present invention is as follows: An SNP molecular marker related to the solitary or clustered fruit branches of peppers is provided, and the SNP molecular marker is located at the 9,558,960th base of chromosome Chr06 in the pepper genome CNA0036143 (The 3D architecture of the pepper genome and its relationship to function and evolution. Nat Commun, 2022 / 06 / 16; 13(1): 3479.), and the polymorphism is T or C; the phenotype corresponding to the TT genotype is the solitary fruit branch type; the phenotype corresponding to the CC genotype is the clustered fruit branch type.

[0005] Further, the sequence of the TT genotype is as shown in SEQ ID NO.1, and the sequence of the CC genotype is as shown in SEQ ID NO.2.

[0006] The present invention also provides the application of the above SNP molecular marker in identifying the solitary or clustered fruit branches of peppers.

[0007] The present invention also provides a primer for detecting the SNP molecular marker, which comprises two forward primers and one reverse primer. The nucleotide sequences of the two forward primers are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.5.

[0008] The present invention also provides the application of the reagent for detecting the SNP molecular marker in identifying the solitary or clustered fruit branches of peppers.

[0009] Further, the reagent comprises two forward primers with nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4 and one reverse primer with nucleotide sequence shown in SEQ ID NO.5; the application comprises the following steps: performing PCR amplification on the genomic DNA of the to-be-detected pepper by using the reagent; if in the PCR amplification result, the color of the fluorescence signal is consistent with the color of the fluorescence linker of the forward primer shown in SEQ ID NO.3, the to-be-detected pepper is of the homozygous genotype TT and the phenotype is the solitary fruit branch type; if the color of the fluorescence signal is consistent with the color of the fluorescence linker of the forward primer shown in SEQ ID NO.4, the to-be-detected pepper is of the homozygous genotype CC and the phenotype is the clustered fruit branch type; if the color of the fluorescence signal is different from the colors of the fluorescence linkers of the forward primers shown in SEQ ID NO.3 or SEQ ID NO.4, the to-be-detected pepper is of the heterozygous genotype TC.

[0010] The present invention also provides a kit for detecting the solitary or clustered fruit branches of peppers, and the kit comprises the primer (SEQ ID NO.3 - 5) and a PCR amplification reagent.

[0011] The present invention also provides the application of the kit in identifying the solitary or clustered fruit branches of peppers.

[0012] The beneficial effects of the present invention are as follows: The KASP marker provided by the present invention can be used to screen pepper varieties with clustered fruit branches, can quickly and accurately identify the fruit branch types of plants at the seedling stage of peppers without waiting for the plants to enter the flowering stage for phenotype observation, can be used for large-scale investigation of the fruit branch types of pepper germplasm resources, provides a molecular tool for genetic diversity research and excellent gene mining, improves the breeding efficiency, and shortens the breeding cycle. Based on the KASP marker, a commercial detection kit can be developed, which is applicable to the identification requirements of the fruit branch types of seed companies, breeding units and scientific research institutions. Description of the Drawings

[0013] Figure 1 It is a fruit branch growth type diagram of the parental materials D60 (solitary fruit branch) and CT4 (clustered fruit branch) in Example 1; wherein, Figure 1 in (A) is the fruit branch growth type diagram of D60,Figure 1 In (B) is the diagram of the growth type of the fruit branches of CT4; Figure 2 is the QTL mapping diagram based on the BSA bulked segregant analysis method according to Example 1; Figure 3 is the schematic diagram of the QTL mapping results of Example 1; Figure 4 is the fluorescence scatter plot obtained by performing KASP genotyping on multiple pepper materials based on the SNP marker at position 9558960 on chromosome Chr06 in Example 2. Detailed implementation mode

[0014] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0015] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels. Example 1: Obtaining SNP molecular marker loci highly associated with the pepper fruit branch type.

[0016] (1) Construction of the F2 segregation population of single and clustered fruit branches of pepper.

[0017] Using the single fruit branch type D60 as the male parent and the clustered fruit branch type CT4 as the female parent, hybridize to obtain F1, and further self-cross F1 to construct the F2 population of single and clustered fruit branches of pepper. The fruit branch types of the parents are as Figure 1 shown. The statistical results of the F1 phenotype and F2 phenotype show that the clustered fruit branch is a recessive trait.

[0018] (2) QTL (Quantitative Trait Locus) mapping and molecular marker development.

[0019] Identify the fruit branch types of the F2 population, select 50 extreme single and 50 extreme clustered individual plants, extract high-quality DNA, construct two extreme bulked pools and perform library sequencing, and use BSA-Seq (Bulked Segregant Analysis - Sequencing) for QTL mapping. Specifically, use the delta-SNPindex algorithm to map the QTL loci associated with the target trait, and the mapping results obtained are as Figure 2 shown; its physical position is located at 5.76 Mb - 16.63 Mb on chromosome Ca_59Chr06, as Figure 3As shown. Further, develop linked molecular markers related to this QTL. When the pepper fruit branch type is solitary, the nucleotide at the 9,558,960th position on chromosome Ca_59Chr06 is T; when the pepper fruit branch type is fascicled, the nucleotide at the 9,558,960th position on chromosome Ca_59Chr06 is C.

[0020] Example 2: Verification of SNP molecular markers based on Kompetitive Allele -Specific PCR (KASP) technology.

[0021] (1) Design of KASP detection primers.

[0022] Extract the sequences 200 bp upstream and 200 bp downstream of the 9,558,960th base position on chromosome Ca_59Chr06 and organize them into the following format. T / C are the two haplotypes of solitary and fascicled.

[0023] The TT genotype sequence is as shown in SEQ ID NO.1: TTTTTTTTTTGGGTGGGGGGTGGGGGGGGAACCAAATTAATTTCTTACTTTTTTTTTCCCCTAATGTTTGATAAGTAAACAACAGAAAATCTTATCTCAAACACATTTATGTGTAATCTAGCAAAACCTTTAGAAGTGGCGAGGGTGAGGTGTGGGACCTCAAGGTGGCGACAGACAAGAGGTAGGAATTGAGGGTGTTATGTGGGTGAGAGGATACAATAAACATACGTGTCTCTTATAACACTTGTTTTCCCCACTTCTAATCAGGAATTTATTTTTCTGATTTTTAAGGAGCTTGTTTTTCTATAAAAAAAAATATTAACATAAACCGCACTAATATGGACCGAATTACTTCCTATATCGTATCATTTCAATATTACATAAAATCTCGAAAAAACTGC.

[0024] The CC genotype sequence is as shown in SEQ ID NO.2: TTTTTTTTTTGGGTGGGGGGTGGGGGGGGAACCAAATTAATTTCTTACTTTTTTTTTCCCCTAATGTTTGATAAGTAAACAACAGAAAATCTTATCTCAAACACATTTATGTGTAATCTAGCAAAACCTTTAGAAGTGGCGAGGGTGAGGTGTGGGACCTCAAGGTGGCGACAGACAAGAGGTAGGAATTGAGGGTGTTACGTGGGTGAGAGGATACAATAAACATACGTGTCTCTTATAACACTTGTTTTCCCCACTTCTAATCAGGAATTTATTTTTCTGATTTTTAAGGAGCTTGTTTTTCTATAAAAAAAAATATTAACATAAACCGCACTAATATGGACCGAATTACTTCCTATATCGTATCATTTCAATATTACATAAAATCTCGAAAAAACTGC; Using the Primer3Plus (https: / / www.primer3plus.com / ) online website, two forward primers and one reverse universal primer were designed. The 3'-end of the forward primers was the base T / C at the position of Ca_59Chr06:9558960. The nucleotide sequences of the two forward primers were shown as SEQ ID NO.3 (F1) and SEQ ID NO.4 (F2) respectively, and the nucleotide sequence of one reverse primer was shown as SEQ ID NO.5 (R).

[0025] (2) Verify the SNP molecular marker at the position of Ca_59Chr06:9558960.

[0026] Using the KASP genotyping test kit (FLU‐ARMS for KASP2× PCR Mix) of Guangzhou Good Biotechnology Co., Ltd., referring to its instruction manual, competitive allele-specific polymerase chain reaction was performed on 10 plants of D60 (single homozygous plants), 10 plants of CT4 (cluster homozygous plants), 5 plants of F1 (D60×CT4), and 50 peppers in the recessive trait extreme cluster pool, a total of 75 samples, for KASP genotyping to achieve the SNP verification in Example 1. The reaction system was shown in Table 1 and the reaction process was shown in Table 2. The KASP genotyping results were as Figure 4 shown.

[0027] Table 1: Component Table of Reaction System

[0028] Table 2: Reaction process table

[0029] The material with T base at chromosome Ca_59Chr06:9558960 can bind to and extend with the F1 primer, and HEX fluorescence will be detected at a wavelength of 533-580nm ( Figure 4 The green dot in the middle), the material with base C at chromosome Ca_59Chr06:9558960 can bind to and extend the F2 primer, and FAM fluorescence will be detected at a wavelength of 465-510nm ( Figure 4 If only HEX fluorescence is detected, it means that the genotype of the material at the Ca_59Chr06:9558960 position is TT. If only FAM fluorescence is detected, it means that the genotype of the material at the Ca_59Chr06:9558960 position is CC. If both HEX fluorescence and FAM fluorescence are detected, it means that the genotype of the material at the Ca_59Chr06:9558960 position is TC. Figure 4 In this example, the designed KASP primers were used to conduct competitive allele-specific polymerase chain reaction on 10 D60 (single homozygous plants), 10 CT4 (cluster homozygous plants), 5 F1 (D60×CT4) and 50 F2 (D60×CT4) plants with recessive extreme cluster peppers. Figure 4 The typing results show that the molecular marker Ca_59Chr06:9558960 related to the fruit branch type proposed in the embodiment of the present application has high stability and high credibility. The molecular marker can be used to quickly determine the type of pepper fruit branch, thereby accurately and efficiently screening the fruit branch type and exploring pepper varieties suitable for mechanized harvesting.

[0030] In summary, the present invention provides a SNP variation that can distinguish between solitary and clustered pepper fruit branches, which has been identified in a variety of solitary and clustered peppers and is conservative, and can be developed as a molecular marker for rapid, accurate, and reliable differentiation of pepper fruit branch development types. The present invention also provides detection primers and detection kits for detecting the variation, which have a positive effect on molecular assisted breeding of peppers with different fruit branch development types.

[0031] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A SNP molecular marker related to the single and clustered growth of pepper fruit branches, characterized in that, The SNP molecular marker polymorphism is T or C; the sequence of the TT genotype is shown in SEQ ID NO.1, and the corresponding phenotype is single-fruiting branch type; the sequence of the CC genotype is shown in SEQ ID NO.2, and the corresponding phenotype is clustered-fruiting branch type.

2. Use of the SNP molecular marker according to claim 1 in identifying single or clustered fruiting branches of peppers.

3. A primer for detecting the SNP molecular marker according to claim 1, characterized in that, The primer comprises two forward primers and one reverse primer, wherein the nucleotide sequences of the two forward primers are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively, and the nucleotide sequence of one reverse primer is shown in SEQ ID NO.

5.

4. Use of the reagent for detecting the SNP molecular marker according to claim 1 in identifying single or clustered fruiting branches of peppers.

5. The application according to claim 4, characterized in that, The reagent comprises two forward primers with nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4 and one reverse primer with nucleotide sequence shown in SEQ ID NO.5; the use comprises the following steps: performing PCR amplification on the genomic DNA of the pepper to be tested by using the reagent; if in the PCR amplification result, the fluorescence signal color is the same as the fluorescence linker color of the forward primer with the sequence shown in SEQ ID NO.3, the pepper to be tested is of the homozygous genotype TT and the phenotype is single-fruiting branch type; if the fluorescence signal color is the same as the fluorescence linker color of the forward primer with the sequence shown in SEQ ID NO.4, the pepper to be tested is of the homozygous genotype CC and the phenotype is clustered-fruiting branch type; if the fluorescence signal color is different from the fluorescence linker colors of the forward primers with the sequences shown in SEQ ID NO.3 or SEQ ID NO.4, the pepper to be tested is of the heterozygous genotype TC.

6. A kit for detecting single or clustered growth of pepper fruit branches, characterized in that, The kit comprises the primer according to claim 3 and PCR amplification reagents.

7. Use of the kit according to claim 6 in identifying single or clustered fruiting branches of peppers.

Citation Information

Patent Citations

  • Molecular marker for identifying capsicum annuum branching types and application

    CN112322770A

  • Molecular marker closely linked with capsicum fruitshape gene, primer, kit and application

    CN118563015A

  • KASP molecular marker closely linked with capsicum fruit color gene CaCHL1 as well as primer, kit, obtaining method and application of KASP molecular marker closely linked with capsicum fruit color gene CaCHL1

    CN119553004A

Cited By

  • Chili multi-branch gene CaBr1 linked KASP molecular marker as well as primer, kit and application of chilli multi-branch gene CaBr1 linked KASP molecular marker

    CN121249954A